| Literature DB >> 31431000 |
Nilton B Dos Santos1, Roseane D Franco1, Rosana Camarini1, Carolina D Munhoz1, Rosangela A S Eichler1, Mayara C F Gewehr1, Patricia Reckziegel1,2, Ricardo P Llanos1, Camila S Dale3, Victoria R O da Silva3, Vanessa F Borges4, Braulio H F Lima4, Fernando Q Cunha4, Bruna Visniauskas5, Jair R Chagas5, Sergio Tufik5, Fernanda F Peres2, Vanessa C Abilio2, Jorge C Florio6, Leo K Iwai7, Vanessa Rioli7, Benedito C Presoto8, Alessander O Guimaraes9, Joao B Pesquero9, Michael Bader10,11,12,13,14, Leandro M Castro15, Emer S Ferro16.
Abstract
Thimet oligopeptidase (THOP1) is thought to be involved in neuropeptide metabolism, antigen presentation, neurodegeneration, and cancer. Herein, the generation of THOP1 C57BL/6 knockout mice (THOP1-/-) is described showing that they are viable, have estrus cycle, fertility, and a number of puppies per litter similar to C57BL/6 wild type mice (WT). In specific brain regions, THOP1-/- exhibit altered mRNA expression of proteasome beta5, serotonin 5HT2a receptor and dopamine D2 receptor, but not of neurolysin (NLN). Peptidomic analysis identifies differences in intracellular peptide ratios between THOP1-/- and WT mice, which may affect normal cellular functioning. In an experimental model of multiple sclerosis THOP1-/- mice present worse clinical behavior scores compared to WT mice, corroborating its possible involvement in neurodegenerative diseases. THOP1-/- mice also exhibit better survival and improved behavior in a sepsis model, but also a greater peripheral pain sensitivity measured in the hot plate test after bradykinin administration in the paw. THOP1-/- mice show depressive-like behavior, as well as attention and memory retention deficits. Altogether, these results reveal a role of THOP1 on specific behaviors, immune-stimulated neurodegeneration, and infection-induced inflammation.Entities:
Keywords: MHC-I; THOP1; inflammation; neurodegeneration; peptidome; sepsis
Mesh:
Substances:
Year: 2019 PMID: 31431000 PMCID: PMC6722639 DOI: 10.3390/biom9080382
Source DB: PubMed Journal: Biomolecules ISSN: 2218-273X
Figure 1Generation and characterization of THOP1 knockout mouse. (A) representation of THOP1 gene structure and the location of the CSG163 line gene trap insertion. The position of the THOP1 locus on a schematic representation of the mouse chromosome 10 is shown as a red vertical line (chr10-qC1). The THOP1 exons are represented as blue blocks connected by arrowed lines, blue blocks indicating the coding and black blocks the untranslated regions. The gene trap 5′RACE cDNA sequence for the CSG163 strain is represented as red blocks connected at the 3′ end by dashed red lines to the Beta-Geo exon just downstream of the mouse En2 intron/exon splicing acceptor site (SA) region of the indicated gene trap vector pGT0Lxf. The forward and reverse primers are indicated and represented respectively as green and light blue or pink arrows; (B) typical results obtained by genotyping polymerase chain reaction (PCR) for THOP1+/-, THOP1-/- or WT mice (bp: base pairs); (C) Western blots show the presence of a single 78 KDa band corresponding to THOP1 in the different organs investigated in WT mice. Note the lack of this 78 kDa band in THOP1-/- mice in all organs investigated. The differences in Western blot band intensities correspond to the specific expression of THOP1 in the different tissues (highest in testis and kidneys. and lower in the liver); 60 µg of protein from crude 10.000× g supernatant was applied in each lane. The anti-THOP1 antiserum was previously described [34,35]. (D) THOP1 enzymatic activity was determined in different tissue homogenates from either THOP1-/- or WT mice using the quenched fluorescence substrate Abz-GGFLRRVNH2-EDDnp (QFS) in the presence or absence of NLN inhibitor Pro-Ile (5 mM). Experiments were conducted in triplicates that varied less than 5% among each other and results are presented as mean ± S.E.M. Statistical significance was determined by one-way ANOVA test. Tukey’s post hoc. * p < 0.05; n = 3 per group.
Figure 2Gene expression of peptidases and proteasome beta5 subunit in different areas of mouse brain. qRT-PCR was used to investigate the mRNA levels for specific peptidases or proteasome beta5-subunit (ProtB5): (A) striatum (ST), (B) hippocampus (HC), and (C) prefrontal cortex (PFC). Neprilysin (NEP), angiotensin converting enzyme 1 (ACE1), prolyl-oligopeptidase (POP), insulin degrading enzyme (IDE), dipeptidyl peptidase 4 (DPP4), or neurolysin (NLN). Results are expressed as mean ± S.E.M. Statistical significance was determined by Student’s t-test. * p < 0.05. n = 6–9.
Relative quantification of peptides from prefrontal cortex (PFC), striatum (ST), or hippocampus (HC).
| Protein Name | Peptide Sequence | Average Ratio | Average Ratio | Average Ratio | |
|---|---|---|---|---|---|
| Location | THOP1/WT | THOP1/WT | THOP1/WT | ||
| ±SE (n) | ±SE (n) | ±SE (n) | |||
| Acyl-CoA-binding protein | ATVGDVNTDRPGLLDL | C | 1.04 ± 0.32 (3) |
| |
| Acyl-CoA-binding protein | GDVNTDRPGLLDL | C |
| ||
| Acyl-CoA-binding protein | KQATVGDVNTDRPGLLDL 2+ | C | 1.11 ± 0.26 (3) |
| |
| Acyl-CoA-binding protein | KQATVGDVNTDRPGLLDL 3+ | C |
| 1.03 ± 0.27 (3) |
|
| Acyl-CoA-binding protein | SHFKQATVGDVNTDRPGLLDL | C | 1.36 ± 0.39 (3) | ||
| Acyl-CoA-binding protein | TVGDVNTDRPGLLDL | C | 1.07 ± 0.31 (3) |
| |
| Acyl-CoA-binding protein | VEKVDELKKKYGI 2+ | C |
|
| |
| Acyl-CoA-binding protein | VEKVDELKKKYGI 3+ | C |
| 0.91 ± 0.14 (3) |
|
| ATP synthase-coupling factor 6 | KFDDPKFEVIDKPQS | M | 1.12 ± 0.26 (2) | ||
| Cerebellin-4 | AANSKVAFSAVRSTN | V | 1.12 ± 0.11 (3) | ||
| Cerebellin-4 | SKVAFSAVRSTN | V | 0.89 ± 0.21 (3) | ||
| Clathrin coat assembly protein AP180 | ASKGLGSDLDSSLAS (1.52 ± 0.12) | M/C |
| 1.08 ± 0.12 (3) | 1.05 ± 0.04 (3) |
| Clathrin coat assembly protein AP180 | KGLGSDLDSSLASL (1.54 ± 0.16) | M/C |
| ||
| Clathrin coat assembly protein AP180 | SKGLGSDLDSSLASL | M/C |
| ||
| Clathrin coat assembly protein AP180 | SPSPTPATQSPKKPPAKDPLADLNIKDFL | M/C |
| 1.17 ± 0.18 (3) | 0.99 ± 0.06 (3) |
| Cysteine and glycine-rich protein 1 | GQGAGALVHSE | N | 1.08 ± 0.02 (3) |
| |
| Cytochrome b-c1 complex subunit Rieske | ARSGPFAPVLSAT | M | 0.81 ± 0.19 (3) | ||
| Cytochrome b-c1 complex subunit Rieske | GLNVPASVRF | M | 0.94 ± 0.21 (3) | ||
| Cytochrome b-c1 complex subunit Rieske | SGQAAARPLVA | M | 0.86 ± 0.21 (3) | 1.01 ± 0.10 (3) | |
| Cytochrome b-c1 complex subunit Rieske | SGQAAARPLVATV | M | 0.75 ± 0.14 (3) | 1.25 ± 0.20 (3) | 0.94 ± 0.08 (3) |
| Cytochrome b-c1 complex subunit Rieske | TVGLNVPASVRF | M | 0.95 ± 0.17 (3) | 1.17 ± 0.16 (3) | 0.98 ± 0.13 (3) |
| Cytochrome c oxidase subunit 5A | GISTPEELGLDKV | M |
| 1.05 ± 0.19 (3) |
|
| Cytochrome c oxidase subunit 5A | NDFASAVRILEV (1.43 ± 0.62) | M |
|
| |
| Cytochrome c oxidase subunit 5A | RPTLNELGISTPEELGLDKV | M |
| 1.20 ± 0.25 (3) |
|
| Cytochrome c oxidase subunit 6A1 | FHNPHVNPLPTGYEDE | M | 1.09 ± 0.13 (3) | 1.12 ± 0.14 (3) | |
| Cytochrome c oxidase subunit 6A1 | HNPHVNPLPTGYEDE | M | 0.86 ± 0.13 (3) | 1.13 ± 0.36 (3) | 1.30 ± 0.20 (3) |
| Cytochrome c oxidase subunit 6A1 | NPHVNPLPTGYEDE | M | 1.07 ± 0.18 (3) | ||
| Gamma-enolase | AGNSDLILPVPAFNVINGGSHAGNKL | C | 0.76 ± 0.20 (3) | ||
| Glyceraldehyde-3-phosphate dehyd. | AFRVPTPNVSVVDL | C/N |
| 0.99 ± 0.09 (3) | |
| LIM zinc-binding domain-containing Nebulette | TQVVSDAAYKGVQPHVV | C |
| 0.93 ± 0.22 (3) | |
| Macrophage migration inhibitory factor | AQATGKPAQYIA | C | 0.92 ± 0.12 (3) | ||
| Macrophage migration inhibitory factor | AQATGKPAQYIA | C | 1.17 ± 0.02 (2) | ||
| Macrophage migration inhibitory factor | AQATGKPAQYIAVHVVPDQL 2+ | C | 0.65 ± 0.03 (3) | 0.87 ± 0.07 (3) | |
| Macrophage migration inhibitory factor | AQATGKPAQYIAVHVVPDQL 3+ | C |
| 1.17 ± 0.07 (3) | 0.75 ± 0.15 (3) |
| Microtubule-associated protein 2 | AEDVTAALAKQGL | C | 0.87 ± 0.06 (3) | ||
| Microtubule-associated protein tau | ADEVSASLAKQGL | C | 0.78 ± 0.24 (3) | 1.17 ± 0.16 (3) | 0.95 ± 0.12 (3) |
| Neurogranin | GRKGPGPGGPGGAGGARGGAGGGPSGD | C |
| 0.84 ± 0.03 (3) | 1.08 ± 0.30 (3) |
| Neurogranin | KGPGPGGPGGAGGARGGAGGGPSGD 2+ | C |
| 0.64 ± 0.02 (3) |
|
| Neurogranin | KGPGPGGPGGAGGARGGAGGGPSGD 3+ | C | 0.78 ± 0.01 (3) |
| |
| Neurogranin | RKGPGPGGPGGAGGARGGAGGGPSGD | C | 0.94 ± 0.20 (3) | 1.28 ± 0.55 (3) |
|
| Peptidyl-prolyl cis-trans isomerase A | ADDEPLGRVSF | C | 0.85 ± 0.14 (3) | 1.10 ± 0.02 (3) | |
| Peptidyl-prolyl cis-trans isomerase A | ADKVPKTAENF (1.59 ± 0.21) | C | 0.71 ± 0.14 (3) | ||
| Peptidyl-prolyl cis-trans isomerase A | ADKVPKTAENFR | C | 1.36 ± 0.30 (2) | ||
| Peptidyl-prolyl cis-trans isomerase A | ADKVPKTAENFRAL | C | 0.77 ± 0.08 (3) | 1.26 ± 0.20 (3) | |
| Peptidyl-prolyl cis-trans isomerase A | EDENFILKHTGPGILSM | C | 0.80 ± 0.10 (3) | ||
| Peptidyl-prolyl cis-trans isomerase A | ELFADKVPKTAENF | C | 1.19 ± 0.23 (2) | ||
| Peptidyl-prolyl cis-trans isomerase A | ELFADKVPKTAENFRAL | C | 0.98 ± 0.35 (3) | ||
| Peptidyl-prolyl cis-trans isomerase A | ITADDEPLGRVSF | C | 0.66 ± 0.16 (3) | 0.88 ± 0.13 (3) | |
| Peptidyl-prolyl cis-trans isomerase A | LFADKVPKTAENFRAL | C | 0.93 ± 0.15 (3) | ||
| Peptidyl-prolyl cis-trans isomerase A | FDITADDEPLGRVSF | C | 1.03 ± 0.22 (3) | ||
| Peptidyl-prolyl cis-trans isomerase A | LFADKVPKTAENF | C | 0.96 ± 0.22 (3) | ||
| Peptidyl-prolyl cis-trans isomerase FKBP1A | VFDVELLKLE | C | 0.84 ± 0.13 (3) | 1.03 ± 0.22 (3) | |
| Phosphatidylethanolamine-binding protein 1 | AGVTVDELGKVL | C | 1.11 ± 0.24 (2) | ||
| Phosphatidylethanolamine-binding protein 1 | AGVTVDELGKVLTPTQV | C | 1.40 ± 0.04 (3) | 0.81 ± 0.11 (3) | |
| Phosphatidylethanolamine-binding protein 1 | DDYVPKLYEQLSGK | C | 0.67 ± 0.08 (3) | 1.11 ± 0.17 (3) | 0.79 ± 0.06 (3) |
| Phosphatidylethanolamine-binding protein 1 | DGLDPGKLYTL | C | 1.06 ± 0.20 (3) | ||
| Phosphatidylethanolamine-binding protein 1 | GLDPGKLYTL | C | 0.77 ± 0.15 (3) | ||
| Phosphatidylethanolamine-binding protein 1 | GVTVDELGKVLTPTQV | C | 1.22 ± 0.20 (3) | ||
| Phosphatidylethanolamine-binding protein 1 | KGNDISSGTVL | C | 1.10 ± 0.12 (3) | ||
| Phosphatidylethanolamine-binding protein 1 | KGNDISSGTVLSDYVGSGPPSGTGL | C | 1.38 ± 0.04 (2) | ||
| Proenkephalin-A | SPQLEDEAKELQ | V | 0.69 ± 0.25 (3) | 0.83 ± 0.20 (3) | |
| ProSAAS | ASAPLVETSTPLRL | V | 1.20 ± 0.22 (2) | ||
| ProSAAS | SLSAASAPLVETSTPLRL | V | 0.92 ± 0.08 (3) | 1.20 ± 0.32 (3) | 0.84 ± 0.16 (2) |
| Secretogranin-1 | LLDEGHYPVRESPIDTA | V |
| ||
| Secretogranin-1 | SFARAPQLDL | V | 1.33 ± 0.33 (3) | 0.85 ± 0.31 (3) | |
| Somatostatin | ANSNPAMAPRE (methionine oxidation) | V |
| ||
| Somatostatin | SANSNPAMAPRE | V |
|
| 1.10 ± 0.31 (3) |
| Somatostatin | SANSNPAMAPRE (methionine oxidation) | V |
|
| |
| Synapsin-1 | AGGPPHPQLNKS | C | 0.97 ± 0.29 (3) | ||
| Tubulin beta-2A chain | SGPFGQIFRPDNF | C | 1.07 ± 0.22 (3) | 0.80 ± 0.02 (3) | |
| Tubulin beta-3 chain | DDEESEAQGPK | C |
|
|
Peptides shaded in gray were previously found in Nln knockout mice (NLN-/-); the number in parenthesis indicate the relative levels of the peptide in whole brain extracts from NLN-/- compared to WT mice [54]. C. cytosol; M. mitochondria; N. nucleus; V. vesicles. Numbers in bold indicate changes (bigger than 1.5 or smaller than 0.5) in relative peptides level from WT and THOP1−/−.
Complete blood count for wild type (WT) and THOP1-/- animals.
| WT | THOP-/- | |
|---|---|---|
| Granulocytes (%) | 21.02 ± 0.63 | 24.22 ± 0.55 ** |
| Monocytes (%) | 6.62 ± 0.17 | 7.47 ± 0.27 * |
| Lymphocytes (%) | 72.46 ± 0.62 | 68.32 ± 0.80 ** |
| Platelets 109/L | 1509.00 ± 73.12 | 1159.00 ± 108.50 * |
| Hemoglobin g/L | 140.20 ± 1.74 | 135.30 ± 3.57 |
| WBC 109/L | 10.09 ± 1.00 | 8.64 ± 0.71 |
| RBC 1012/L | 9.62 ± 0.10 | 9.25 ± 0.28 |
| RDW | 12.80 ± 0.21 | 13.12 ± 0.29 |
| MCV fL | 46.78 ± 0.23 | 47.37 ± 0.26 |
| MCHC g/L | 311.22 ± 0.89 | 308.50 ± 1.54 |
White blood cells (WBC). Red blood cells (RBC). Red cell distribution width (RDW); Mean corpuscular volume (MCV); Mean corpuscular hemoglobin concentration (MCHC). *. p ≤ 0.05; **. p ≤ 0.001.
Figure 3Neurodegeneration induced by EAE and inflammatory profiles. (A) Evaluation of the clinical score over time of WT C57BL/6 female mice and THOP1-/- immunized with MOG35-55 emulsified with complete Freund’s adjuvant (CFA). Results are expressed as mean ± S.E.M. Statistical significance was determined by two-way ANOVA. Tukey post hoc: * p < 0.05. EAE WT n = 18 and EAE THOP-/- n = 15. Western blotting for TNF-α in dorsal hippocampus (B) or spinal cord (C) at 26th dpi; blots (B,C) were cropped (indicated by boxes) from the same membranes that were successively exposed to distinctive antibodies as indicated in Experimental Procedures (Supplemental Information—TNF-α Western blots). Results are expressed as mean ± S.E.M. Statistical significance was determined by Mann–Whitney test: * p < 0.05. EAE WT n = 6. EAE THOP1-/- n = 6. bact: beta-actin.
Figure 4Survival curves and behavior analysis of mice undergoing sepsis. (A) THOP-/- and WT mice survivors during 7 days after sepsis induction. Next, survived animals of each group were submitted to Open Field test and Western blot analysis of dorsal hippocampus. Results were expressed as % survival during 7 days (n = 6). (B) Distance tracking in open field task. (C) Total distance performed in Open field. (D) Average speed in open field (E) total immobility time and (F) total immobility episodes. (G) TLR4 and (H) TNF-α expression in total protein extract of the dorsal hippocampus. Behavior tests and Western blots were performed at the 8th day after sepsis induction. Results are expressed as mean ± S.E.M. Statistical significance was determined by Student’s t-test: * p < 0.05 vs. WT. WT. n = 3; THOP1-/-. n = 4.
Figure 5Hot plate test. (A) Regular basal nociceptive response of THOP1-/- or WT litter mates, evaluated by the hot plate test at different time points. Note that THOP1-/- latency to nociceptive stimulus is similar to WT at this determined dose of BK (0.1 µM; 40 µL). Data are expressed as mean ± SEM of 4–6 animals per group. Data were analyzed by two-way ANOVA followed by Bonferroni’s multiple comparison test. (B) Nociceptive response was evaluated after Bk was injected intraplantar (0.1 µM; 40 µL). Note that THOP1-/- latency to nociceptive stimulus is significantly lower than that of WT. Data presented as mean ± SEM. Data were analyzed by two-way ANOVA followed by Bonferroni’s multiple comparison test. **** p < 0.001 compared to either control (0 min) or to WT (after 5 or 30 min of Bk intraplantar administration).
Figure 6Depression-like behavior analysis using the forced swim (FST) and tail suspension (TST) tests. Panel (A): In the FST, Training corresponds to the first day of tests and Test corresponds to the second day of tests. Latency time to the first immobility episode and total period (in seconds) of animal immobility during the 5 min of forced swimming task duration. In both parameters, THOP1-/- mice present a mild (p < 0.05) depressive-like behavior compared with WT mice. Panel (B): TST were conducted as detailed in Experimental procedures. THOP1-/- have similar latency and higher immobility time compared to WT. Results are expressed as mean ± S.E.M. Statistical significance was determined by Student’s t-test: * p ≤ 0.05 vs. WT. WT. n = 8; THOP1-/-. n = 14.
Figure 7Prepulse inhibition of startle test. Percentage of prepulse inhibition of startle for each prepulse (PP) intensity: 75 dB (A), 80 dB (B), and 85 dB (C). Note that clozapine (czp) induced a significant increase in PPI response of THOP1-/- at both 80 and 85 dB (B,C), whereas it did not modify the response of WT mice (A–C). Results are expressed as mean ± S.E.M. Statistical significance was determined by one-way ANOVA test. Tukey’s post hoc: * p < 0.05; ** p < 0.01). n = 8. per group.
Figure 8Step-down passive avoidance task: in this task, the time the animal takes to step-off from the platform (step-off latency) was determined. The longer the mouse stays on the platform. the greater was the latency for step-off. indicating that the mouse learned the passive avoidance task. WT showed higher latency to step-down during tests as compared to training. THOP-/- showed an impairment of memory retention at training-tests. Results are expressed as mean ± S.E.M. Statistical significance was determined by two-way ANOVA test. Sidak’s post hoc: * p < 0.05 between WT training (T) and WT 1 h test; ** p < 0.01 between WT training (T) and WT 24 h test; No statistically significant differences were observed for the THOP1-/- mice between training and 1 h or 24 h tests. WT. n = 10; THOP1-/-. n = 9.
Figure 9Neurotransmitters and their metabolites levels in two different brain regions of WT and THOP1-/- mice. No differences were observed among the neurotransmitters and their metabolites in the PFC (A) or ST (B) from WT mice compared to THOP1-/- mice. However, the turnover ratio of 5HIAA/5HT was significantly lower in PFC of THOP1-/- mice (C). Similarly, the turnover ratios of HVA/DA (D) and DOPAC+HVA/DA (E) are lower in ST of THOP1-/- mice compared to WT mice. Results are expressed as mean ± S.E.M. Statistical significance was determined by Student’s t-test: ** p < 0.01; *** p < 0.001 vs. WT. n = 8.
Figure 10Gene expression of 5HT2a and DRD2 in different areas of mice brain. THOP1-/- mice showed upregulation of 5HT2a gene expression in ST (A), HC (B), and PFC (C); whereas, in the same brain areas, DRD2 mRNA showed no changes (A–C). Results are expressed as mean ± S.E.M. Statistical significance was determined by Student’s t-test. * p < 0.05. n = 6–9.
Primer sequences.
| Gene | Sequence | Amplicon (bp) | Accession Number |
|---|---|---|---|
| Neurolysin (Nln) | Fwd: CACCCTATCACAGACGAGCT | 106 | NM_029447 |
| Neprilysin (NEP) | Fwd: CCTGAACTTTGCCCAGGTGT | 148 | NM_001289462.1 |
| Angiotensin I Converting Enzyme 1 (ACE1) | Fwd: ACCCTAGGACCTGCCAATCT | 164 | NM_207624.5 |
| Prolyl oligopeptidase (POP) | Fwd: GGGTGCTCCGACACTAAACA | 98 | NM_011156.3 |
| Insulin Degrading enzyme (IDE) | Fwd: GTCCATGTTCTTGCCAGGGA | 161 | NM_031156.3 |
| Dipeptidyl peptidase 4 (DPP4) | Fwd: GACGGCAGAGGAAGTGGTT | 134 | NM_010074.3 |
| Proteasome subunit beta 5 (ProtB5) | Fwd: CCAAACTGCTCGCTAACATGG | 119 | NM_011186.1 |
| 5-Hydroxytryptamine (serotonin) receptor 2A (5-HT2A) | Fwd: GTTTCCTTGTCATGCCCGTG | 93 | NM_172812.2 |
| Dopamine D2receptor (DRD2) | Fwd: ATGGGAGTTTCCCAGTGAACA | 115 | NM_010077.2 |
| Hypoxanthine guanine phosphoribosyl transferase (HPRT) |
Fwd: TGCTGACCTGCTGGATTACA | 120 | NM_013556.2 |
| Ribosomal protein L19 (RPL19) | Fwd: CAATGCCAACTCCCGTCA | 102 | NM_009078.2 |
| Glyceraldehyde-3-phosphatedehydrogenase (GAPDH) | Fwd: GTGCAGTGCCAGCCTCGTCC | 75 | BC085275.1 |