Literature DB >> 31393961

Investigation of the effect of UV-B light on Arabidopsis MYB4 (AtMYB4) transcription factor stability and detection of a putative MYB4-binding motif in the promoter proximal region of AtMYB4.

Mehali Mitra1, Puja Agarwal1, Anurima Kundu1, Victor Banerjee2, Sujit Roy1.   

Abstract

Here, we have investigated the possible effect of UV-B light on the folding/unfolding properties and stability of Arabidopsis thaliana MYB4 (AtMYB4) transcription factor in vitro by using biophysical approaches. Urea-induced equilibrium unfolding analyses have shown relatively higher stability of the wild-type recombinant AtMYB4 protein than the N-terminal deletion forms after UV-B exposure. However, as compared to wild-type form, AtMYB4Δ2 protein, lacking both the two N-terminal MYB domains, showed appreciable alteration in the secondary structure following UV-B exposure. UV-B irradiated AtMYB4Δ2 also displayed higher propensity of aggregation in light scattering experiments, indicating importance of the N-terminal modules in regulating the stability of AtMYB4 under UV-B stress. DNA binding assays have indicated specific binding activity of AtMYB4 to a putative MYB4 binding motif located about 212 bp upstream relative to transcription start site of AtMYB4 gene promoter, while relatively weak DNA binding activity was detected for another putative MYB4 motif located at -908 bp in AtMYB4 promoter. Gel shift and fluorescence anisotropy studies have shown increased binding affinity of UV-B exposed AtMYB4 to the promoter proximal MYB4 motif. ChIP assay has revealed binding of AtMYB4 to the promoter proximal (-212 position) MYB4 motif (ACCAAAC) in vivo. Docking experiments further revealed mechanistic detail of AtMYB4 interaction with the putative binding motifs. Overall, our results have indicated that the N-terminal 62-116 amino acid residues constituting the second MYB domain plays an important role in maintaining the stability of the C-terminal region and the overall stability of the protein, while a promoter proximal MYB-motif in AtMYB4 promoter may involve in the regulation of its own expression under UV-B light.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31393961      PMCID: PMC6687144          DOI: 10.1371/journal.pone.0220123

Source DB:  PubMed          Journal:  PLoS One        ISSN: 1932-6203            Impact factor:   3.240


Introduction

The MYB domain proteins represent one of the largest families of transcription factors in plants, playing key roles in various developmental and stress-responsive processes. The MYB transcription factors are characterized by the presence of variable numbers of N-terminus conserved DNA-binding MYB repeats (R) and the C-terminal domain shown to be involved in mediating protein-protein interactions [1, 2]. The N-terminal MYB domains have also been shown to participate in protein-protein interactions [3, 4]. In Arabidopsis, rice, maize, soybean and other plants, several members of MYB transcription factor family have been identified as key regulators of various cellular processes, including cell cycle and cell morphogenesis, biotic and abiotic stress responses [4, 5, 6]. In plants, majority of MYB proteins belong to the R2R3-MYB subfamily. Members of R2R3-MYB subfamily regulate multiple responses in plants, such as biotic and abiotic stresses [7, 8], hormone signaling, phenylpropanoid biosynthesis [9], determination of cell shape and regulation of differentiation [10]. More than over 100 R2R3- type MYB members have been reported in dicots and monocots [11]. Earlier studies in Arabidopsis have shown that MYB4, a member of R2R3-type subfamily of MYB transcription factor, acts as transcriptional repressor of C4H gene, which encodes cinnamate 4-hydroxylase enzyme. Cinnamate 4-hydroxylase is one of the key enzymes in hydroxycinnamate ester biosynthesis pathway, leading to the formation of UV-B absobing cinnamate esters in plants [6]. MYB4 has been shown to act as negative regulator of C4H, thus regulating the accumulation of UV-B absorbing phenylpropanoid compounds under UV-B irradiation. Interestingly, UV-B light has been shown to down regulate MYB4 transcript accumulation in wild-type Arabidopsis seedlings, resulting in increased accumulation of C4H transcript [12]. Previous studies have shown transient induction of MYB4 transcript in Arabidopsis under various wavelengths of light and the effect was more prominent under UV-B light [12]. Within the R2R3-MYB subgroup, four members, including MYB4 (others are MYB3, MYB7 and MYB32) possess the characteristic and conserved LLsrGIDPxT/SHRxI/L motif and the EAR repression motif (pdLHLD/LLxiG/S) at the C-terminal domain [12]. In addition, MYB4 has been shown to contain a putative zinc-finger motif (CX1-2CX7-12CX2C) and another conserved GY/FDFLGL motif in the C-terminal region [13]. The GY/FDFLGL motif has been shown to mediate the interaction of MYB4 with SAD2 (Sensitive to ABA and Drought 2), an importin β-like protein, which facilitates transport of MYB4 into the nucleus, where MYB4 repress the expression of the target genes like C4H via promoter binding [13]. Several studies have shown that stability of protein is crucial for maintaining its function in extreme environmental conditions. Subtle change in protein conformation may cause loss of its functional activity [14]. However, despite the prominent role of MYB4 in the context of UV-B stress response in plants, information regardingthe effect of UV-B on the stability of this important class of regulatory protein under UV-B light is limited. In this work, we have thoroughly investigated the biophysical characteristics, including the changes in folding/unfolding properties, secondary structural components and thermodynamic stability of recombinant AtMYB4 protein in vitro after exposure to UV-B light. Along with full length wild-type recombinant AtMYB4, we have also used two other N-terminal deletion fragments, AtMYB4Δ1 and AtMYB4Δ2, lacking the N-terminal first and second MYB domains, to understand the role of the N-terminal MYB domains on the overall stability of the protein under UV-B light. Furthermore, based on negative regulatory effect of MYB4 on its own gene expression, as demonstrated earlier [1], we have analyzed ~1000 bp upstream promoter fragment of AtMYB4 and detected a putative MYB4-motif binding activity of AtMYB4 to the promoter proximal (-212 position) MYB4 motif (ACCAAAC). Together, these results have shown that UV-B light may not significantly disrupt the structural stability of AtMYB4, while binding of this protein to its own promoter at the promoter proximal putative MYB4-binding ACCAAAC element may regulate AtMYB4 expression under UV-B light.

Materials and methods

Isolation of RNA and molecular cloning of full-length AtMYB4cDNA

Total RNA was isolated from 7-days-old seedlings of wild-type Arabidopsis plant (Col-0) by using RNeasy plant mini extraction kit (Qiagen) following manufacturer’s protocol. First strand cDNA was synthesized from 1 μg of total RNA sample using SuperScript III first strand cDNA synthesis Reverse Transcription kit (Thermo Fisher Scientific). The full-length cDNA fragment (849 bp), encoding 282 amino acids with the predicted molecular mass of 32-kDa protein was generated by RT-PCR using the gene specific primers ( and ) containing the BamHI and XhoI sites in the forward and reverse primers, respectively (underlined). The amplified product was cloned into the BamHI-XhoI sites of pET28a (Novagen) bacterial expression vector and sequence verified. The N-terminus deletion forms of AtMYB4 cDNAs, including AtMYB4Δ1 (lacks the N-terminus first DNA binding MYB domain, 1–61 amino acid residues) and AtMYB4Δ2 (devoid of both first and the second MYB domains at the N-terminus region of the protein, 61–116 amino acid residues) were generated by PCR amplification using the full length AtMYB4 cDNA as template (AtMYB4Δ1:5’-GG and AtMYB4Δ2:5’- GG) (S1 Fig). The deletion fragments were subsequently cloned into the BamHI-XhoI sites of pET28a (Novagen) bacterial expression vector and sequence of cloned fragments were verified.

Expression, and purification of recombinant full length and N terminus deletion fragments of AtMYB4

The full length 849 bp AtMYB4 cDNA was amplified by PCR and cloned in frame at the BamHI-XhoI sites of pET28a expression vector (Novagen), while the N terminus truncated forms of AtMYB4 cDNA were amplified by PCR using pET28a:AtMYB4 cDNA construct as template. The N-terminus deletion mutants of AtMYB4 cDNAs, including AtMYB4Δ1 and AtMYB4Δ2 were also cloned into the BamHI-XhoI sites of pET28a expression vector (Novagen). The pET28a:AtMYB4 recombinant plasmids encoding either the full-length ~32-kD protein or the N terminus deletion constructs, pET28a:AtMYB4Δ1 (~24-KD) and pET28a:AtMYB4Δ2 (~18-KD) were expressed in E. coli cells (BL21 [DE3] pLysS strain) as N-terminus 6X-His tagged fusion proteins. Recombinant protein expression was induced with 1 mM isopropylthio-β-galactoside (IPTG) for 18 h at 37°C and protein sample was isolated from 2 L of bacterial culture by following the procedure described previously [15]. Cells were harvested by centrifugation at 5,000 rpm in 4°C for 30 min and bacterial pellets were resuspended in a 30 ml lysis buffer containing 50 mM Tris-HCl, pH 7.5, 300 mM NaCl, 5 mM MgCl2, 10 mM β-mercaptoethanol and 1 mM PMSF. Lysozyme was added to a final concentration of 1 mg/ml and cell lysate was then incubated on ice for 1 h. The lysates were then briefly sonicated (6 cycles of 1 min each) to destroy cell membranes and reduce viscosity, followed by centrifugation at 15,000 rpm in 4°C for 10 min. After centrifugation, solubility of 6X-His tagged recombinant proteins was checked in 12% SDS- PAGE. The pellet fraction was found to contain the major part of the expressed proteins (S1 Fig) and therefore it was solubilized in a buffer containing urea (8 M urea, 50 mM Tris-HCl, pH 7.5, 0.5 M NaCl, 10 mM β-ME, 1 mM PMSF), followed by gentle swirling of the sample on a rotary shaker for 45 min at room temperature (25°C). Solubilized samples were centrifuged at 15,000 rpm for 15 min. The supernatant fraction containing the major part of the expressed proteins was then purified under denaturing conditions via Ni-NTA resin mediated affinity chromatography under denaturing conditions following manufacturer’s instructions (Qiagen). Along with measuring the OD280 values of the column fractions, the purified protein factions were verified by resolving in 10% SDS-Polyacrylamide gel and also confirmed by Western blotting using anti-AtMYB4 antibody (1:500 K dilutions) (Fig 1A–1C). Purified protein fractions containing recombinant protein were then refolded by removing urea following ‘step-dialysis’ procedure in the similar buffer containing 7, 6, 5, 4, 3, and 2 M urea for 2 h each at room temperature and finally in urea-free protein refolding buffer (50 mM Tris-HCl, pH 7.5, 50 mM NaCl, 5% glycerol, 1 mM β-mercaptoethanol, 1 mM PMSF) for 12 h at 4°C with three changes. Dialyzed protein sample was concentrated by lyophilization and ~1 ml of protein sample was then applied to Sephacryl S300-HR (GE Healthcare) size exclusion column (1.0 x 50 cm, BioRad), followed by elution in buffer containing 10 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 1 mM β-mercaptoethanol and 1 mM PMSF. Fluorescence spectra of urea solubilized recombinant protein samples were determined before and after removal of urea via step dialysis. Spectral pattern of the dialyzed protein samples with a prominent peak near 340 nm have indicated appropriate refolding of the proteins after urea removal by dialysis. All experiments were carried out using the refolded protein samples. Main peak fractions were analyzed by resolving in 10% SDS-PAGE and Western blotting using anti-AtMYB4 antibody (Fig 1D–1F). The major peak fractions were then pooled, concentrated, dialyzed against protein refolding buffer and stored in aliquots at -80°C.
Fig 1

Purification of recombinant (N-terminal 6X-His tagged) AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins.

A-C. Protein elution profiles of recombinant full length AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins from Ni-NTA affinity Column (Qiagen, Germany). The included gel images in (A-C) correspond to Coomassie blue stained 10% SDS-PAGE of the indicated column fractions (upper panel) and protein gel blot analysis of the corresponding fractions using anti-AtMYB4 antibody (1:500 dilution) (lower panel). Fraction numbers are indicated at the bottom of each lane. D-F.Protein elution profiles of Ni-NTA affinity Column purified recombinant AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins from Sephacryl S-300 column (Sigma-Aldrich). The embedded gel images in (D-F) represent Coomassie blue stained 10% SDS-PAGE of the indicated column fractions. Fraction numbers are indicated at the bottom of each lane.

Purification of recombinant (N-terminal 6X-His tagged) AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins.

A-C. Protein elution profiles of recombinant full length AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins from Ni-NTA affinity Column (Qiagen, Germany). The included gel images in (A-C) correspond to Coomassie blue stained 10% SDS-PAGE of the indicated column fractions (upper panel) and protein gel blot analysis of the corresponding fractions using anti-AtMYB4 antibody (1:500 dilution) (lower panel). Fraction numbers are indicated at the bottom of each lane. D-F.Protein elution profiles of Ni-NTA affinity Column purified recombinant AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins from Sephacryl S-300 column (Sigma-Aldrich). The embedded gel images in (D-F) represent Coomassie blue stained 10% SDS-PAGE of the indicated column fractions. Fraction numbers are indicated at the bottom of each lane.

Sequence alignment, phylogenetic analysis and 3D structure modeling

Multiple sequence alignment of MYB4 protein from Arabidopsis thaliana and other selected plant genomes were performed using ClustalW module of BioEditv7.2.5 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html) (S2 Fig). A phylogenetic tree was generated after identifying the best 100 homologues using the protein sequence ATMYB4 at NCBI BLAST, followed by multiple sequence alignment using MEGA 7.0 (S1 Table). The tree was generated using neighbor joining algorithm with 1000 bootstrap replicates for identifying the best tree. A total of 122 informative sites were detected from the alignment which resulted in the tree having 10 clades. Each clade was colored differently using FIGTREE v10 (S3D Fig). Homology model of AtMYB4 protein was constructed using the protein modeling software, MODELLER 12.

UV-B treatment of recombinant AtMYB4

For UV-B irradiation, protein samples were taken in a 1 cm light-path quartz cuvette and UV-B exposure was given following the method described earlier [15, 16, 17]. UV-B irradiation was given with an UV-B dose of 200 J/m2 for different time points up to 4 h in the dark at 25°C as described previously [15]. In all cases, protein samples were irradiated with the UV-B dose of 200 J/m2 and further higher dose was avoided as it created strong photo-chromatic effects.

Fluorescence spectroscopy

Fluorescence spectra of samples containing 0.05 mg/ml of purified protein in a final volume of 600 μL of 50 mM Tris-HCl, 1 mM β-mercaptoethanol and 1 mM PMSF, pH 7.5, was taken in a quartz cuvette (4 X 4 mm) and measurements were performed in a Jasco Spectrofluorometer FP-8500 [15, 17]. Tryptophan fluorescence quenching assay was performed by following the method described previously [15] with minor changes (Supporting information).

Bis-ANS binding assay

Bis-ANS (4,4’-dianilino-1,1’-binaphthyl-5,5- disulfonic acid) binding study was carried out in a JascoSpectrofluorometer FP-8500 using 0.02 mg/ml of purified recombinant protein sample titrated with an aqueous solution of 300 μM Bis-ANS in a 3 ml quartz cuvette by following the procedure described earlier [18]. A small aliquot of Bis-ANS solution was added at a time; the solution was then mixed by gentle pipetting and left for 2 min to attain equilibrium. Fluorescence emission spectrum was then recorded between 450 and 550 nm with an excitation wavelength of 390 nm. The data was analyzed following Scatchard equation. A titration of 0.2 μM Bis-ANS using 10.0 mg/ml or 4.0 mg/ml of recombinant protein was carried out. The reverse titration data were used to obtain the quantitative relationship between fluorescence intensity change and the amount of bound Bis-ANS [19]. The titration curves for the protein samples were analyzed by plotting v versus v/S following the Scatchard equation: v = n—KD [v/S], considering n number of identical non-interacting sites per subunit of the protein samples, where v and S indicate the concentrations of bound and free Bis-ANS (μM), respectively. KD represents the dissociation constant. A reverse titration assay of Bis-ANS with the protein samples were also carried out for the conversion of the change in fluorescence intensity into bound Bis-ANS [20].

Urea unfolding assay

For urea denaturation experiments, 0.05 mg/ml of purified protein samples were mixed in ratios to produce solutions ranging from 0 to 8 M urea at intervals of 0.5 M. Solutions were allowed to equilibrate at ambient temperature for 2 h, transferred to cuvette thermostated at 25°C, and then allowed to equilibrate until no change in fluorescence was observed. Tryptophan fluorescence spectra of the samples were recorded over the range from 300 to 400 nm with the excitation wavelength of 295 nm. The unfolding profiles were constructed by essentially following the method as described before [18, 21].

Circular dichroism (CD) spectroscopy

Far-UV CD spectroscopy of purified recombinant AtMYB4 protein samples was performed in a JASCO-810 Spectropolarimeter by following the protocol described previously [22, 23]. Approximately 0.5 mg/ml purified recombinant protein was used in a total reaction volume of 1.5 ml. Spectral measurements were monitored in the wavelength ranging from 200 to 260 nm at 25°C. Results were expressed in terms of milideg (θ).

Fourier transform infrared (FT-IR) spectroscopy

FT-IR spectroscopy was performed in a Spectrum 100 FT-IR spectrometer (Perkin Elmer) by following the protocol described previously [22, 24] with minor modifications. Experimental steps were carried out under N2 environment as described previously [25].

In vitro protein aggregation studies

UV-B induced aggregation pattern of purified recombinant proteins was analyzed by monitoring the static light scattering in a UV-Vis spectrophotometer (Shimadzu, UV-1800). Reactions were carried out using approximately 0.1 mg/ml purified recombinant protein samples by following the procedure described before [15]. In vitro aggregation studies were also performed in a Jasco Spectrofluorometer FP-8500. About 0.1 mg/ml of purified recombinant protein samples (untreated or UV-B exposed) was used to measure the static light scattering pattern. The O.D. values of the samples were recorded at 360 nm over a time period of 120 min.

Dynamic light scattering

Dynamic light scattering measurements were performed at 25°C unless stated otherwise using a Malvern Zetasizer Nanoseries model equipped with a standard laser (4 mW, 633 nm) and a measurement angle of 173° [23]. Before DLS measurement, the protein samples were centrifuged briefly at 10,000 rpm for 5 min at 4°C followed by filtration of the supernatant through 0.2 μm Millipore filters and then taken in the cuvette. Concentration of protein samples in the cuvette was kept at 0.1 mg/ml. The R distribution measurements were performed at least 3 times, taking the average value of 10 measurements each time. R represents the hydrodynamic radius and defined as the radius of a hypothetical sphere that diffuses at the same rate as the particle or molecule being measured.

Electrophoretic mobility shift assay

Based on the presence of putative MYB binding motifs in the proximal promoter regions of AtMYB4 promoter (-212 and -908 bp upstream of transcription start site), synthetic oligonucleotides were designed (MYB4-Cis1 and MYB4-Cis2). To determine the binding activity of AtMYB4 protein to the putative MYB4-Cis-acting motifs in vitro, electrophoretic mobility shift assay was performed using ~10 μg of purified recombinant AMYB4 protein with ~125 ng of the synthetic oligonucleotides by using the electrophoretic mobility shift assay (EMSA) kit (Molecular Probe, Invitrogen) following manufacturer’s instructions. The Syber green stained nucleic acid in the gels were visualised under Gel documentation system (BIORAD) at 300 nm for documentation of the images. The specificity of binding AtMYB4 to the putative MYB4 motifs was determined in DNA binding assays by using three mutant versions of MYB4-Cis1 and MYB4-Cis2 motifs, respectively.

Chromatin immunoprecipitation and protoplast preparation

Two-weak old Arabidopsis seedlings were harvested and cross-linked with 1% formaldehyde in IP buffer (0.4 M sucrose, 10 mM Tris-HCl, pH 8.0, 5 mM β-mercaptoethanol, 0.1 mM PMSF and proteinase inhibitor cocktail) under vacuum for 20 min on ice and then quenched by replacing with 1× PBS containing 0.125 M glycine. ChIP assay was conducted as described previously [26]. The chromatin solution was sonicated by using a Sonifier 450 (Branson, http://www.sonifier.com). The sonicated chromatin suspension was immunoprecipitated using anti-AtMYB4 serum or pre-immune serum, and DNA was recovered using the method described previously [27, 28]. About 10% of non-immunoprecipitated DNA and input DNA were reverse crosslinked and used as input DNA control. Both immunoprecipitated DNA and input DNA were analyzed by semi-quantitative PCR. Protoplast isolation from Arabidopsis thaliana (Col-0 and atmyb4) leaf mesophyll cell and transfection was performed following Kim and Somers [29] with some modifications. GUS activity measurement were performed by following the protocol of Weigel and Glazebrook [30].

Fluorescence anisotropy

Fluorescence anisotropy measurement was carried out following the method described previously [23] with some modifications. Fluorescence anisotropy was recorded in a Hitachi model F-8500 spectrofluorometer equipped with a polarization accessory. Excitation of Fluorescein labeled Oligos ( and was done at 495 nm. Fluorescence anisotropy (A) values were obtained using the expression: A = (IVV−G x IVH)/(IVV+ 2 x G x IVH). Here, IVV and IVH represent the vertically (0°, 0°) and horizontally (0°, 90°) polarized components of probe (emission wavelength 520 nm) with excitation by vertically polarized light at 495 nm. G stands for the sensitivity factor of the instrument. The excitation and emission slits were set to 5 nm. The concentration of Fluorescein labeled Oligos (MYB4-Cis1Flcand MYB4-Cis2Flc) were 5 μM, whereas protein concentration was varied between 0–1.4 μM. The curve data were fitted to the equation using Microcal Origin 6.0 software. y = Bmax * x/A + x Here Bmax represents the maximum value of anisotropy during the binding process and A represents dissociation constant (KD) of AtMYB4-labeled oligo complex. These experiments were performed at 25°C.

Molecular docking studies

Automated docking simulations were performed with GOLD 3.0.1 (Cambridge Crystallographic Data Centre) and cross checked with HADDOCK (https://haddock.science.uu.nl/) [31, 32, 33]. Each complex was performed with 100 iterations and a Gold Score fitness function was used to screen the complexes [34]. The parameters used in the genetic algorithms included the following: population size 100, selection pressure 1.1, number of operations 110, number of islands 10, niche size 4, migrate 10, mutate 95, and crossover 95. The best result was selected using conformational clustering analysis and the scoring function. To refine the docked solution, in situ ligand minimization was performed using the CHARMm force field in GROMACS in a solvated sphere with SHAKE constraints [35]. The conjugate gradient method required 100 steps at 50 picoseconds intervals with the complex being heated to 300K. The final stable complex that was obtained was then analyzed using NUPROPLOT software (standalone version) to study the actual interacting sites of the protein and cognate DNA molecule [36, 37].

Identification of MYB4 DNA binding regulatory motif from genome wide scans

The identified sequence was aligned with the existing angiospermic full length genome sequences available (total = 53) at PHYTOZOME (https://phytozome.jgi.doe.gov/pz/portal.html) using a modified BLOSUM 62 matrix with gap opening penalty of 5 and extension penalty of 2. The obtained results were then subjected to multiple sequence alignment using MAFFT (https://mafft.cbrc.jp/alignment/software/) and the phylogenetic tree was generated in newick format. For the motif based search, the binding motifs were first aligned and then they were analysed using GOMO (http://meme-suite.org/doc/gomo.html) for their gene ontology based prediction of homologous upstream regulatory elements in genes based on gene ontology. The obtained results were tabulated. Finally the individual motifs were subjected to homology search using TOMTOM (http://meme-suite.org/tools/tomtom) to reveal unique binding signatures of transcription factor modules across plant genomes (S2 Table).

Results and discussion

Prediction of structural model of AtMYB4 protein

Previous studies in Arabidopsis have indicated role of MYB4 as negative regulator of cinnamate 4-hydroxylase (C4H) gene, which encodes for cinnamate 4-hydroxylase, the second enzyme in phenylpropanoid pathway involved in the formation of multiple UV-B protective secondary metabolites. On the other hand, UV-B light has been shown to suppress MYB4 gene expression, thus facilitating synthesis of UV-B absorbing flavonoids [12]. Based on this, we first investigated the stability and possible change in the folding/unfolding properties of AtMYB4 protein following UV-B irradiation. For this, we reasoned that a good structural model of AtMYB4 could be beneficial for explaining the possible conformational change in the protein structure. A structural model of Arabidopsis MYB4 protein was then generated by homology modeling approach. The AtMYB4 protein, encoded by 849 bp open reading frame (1287 bp gene size), is a single polypeptide protein, comprising of 282 amino acid residues with an estimated molecular mass of ~32 kDa. AtMYB4 is composed of two DNA binding MYB domains in tandem at the N-terminal part of the protein. The amino acids from 9 to 61 constitute the first MYB domain, while amino acids from 62 to 116 accounts for the second MYB domain at the N-terminal region. Amino acids from 117 to 282 constitute the C-terminal domain of AtMYB4 (S3A–S3C Fig). The N-terminal MYB domains serve as the site for interactions with DNA, while the C-terminal region has been shown to be involved in mediating protein-protein interaction and transcriptional repression function with the possession of a EAR repression motif (pdLHLD/LLxiG/S) [12]. To build up a homology based structural model of AtMYB4, protein sequences were first gathered from the GENPEPT resource at the NCBI. After this, redundant sequences were discarded by comparing the collected sequences with those in SWISS-PROT. The conserved domains in the selected protein sequences were next determined by CDART at the NCBI Conserved Domain Database [31, 32, 33]. A STRUCTURE BLAST was then performed using the selected protein sequences with identified conserved domain to create the template for the homology based modelling. For the generation of a suitable homology model, a three-pronged procedure was utilized, such as the server based and software-facilitated modelling using the homologous sequences and then an Ab Initio modelling approach using the identified sequences which shared approximately 40% homology. Templates used for the analyses include 1H8A, 1A5J and 1MSE, respectively obtained from the protein databank [24]. Homology model of the target protein was constructed using the protein modeling software, MODELLER 12 [26, 38]. However, one of the major problems in homology modeling is having a sequence similarity of less than ~20% between the target sequence and the template sequence. Homology model generated using such low similarity as reported previously [17] has been considered to be unreliable and less accurate. To improve the model and selection of a more appropriate model, we performed umbrella sampling among all the structures generated by homology modeling to identify the structural model with less free energy. This approach was based on the use of both Monte Carlo and Molecular Dynamics simulations and appeared to be suitable in our study for the generation of a homology based structural model of AtMYB4. Here, the modifications of the potential function can be represented as: `V’(rN) = `V (rN) + W(rN) Where W(r N) is a weighting function, which can be expressed as a quadratic form: W(rN) = kw(rN–r0N)2 The umbrella sampling approach facilitated in reducing the number of models from 128 to 1, while in Ab initio approach, the Car-Parrinello method was utilized for the generation of model structures. This method provides an opportunity to utilize an alternative of matrix diagonalization methods to integrate molecular dynamics and simulated annealing for finding values of basic set of co-efficients to minimize the energy. Interface residue detection was carried out on the basis of the assumption that an amino acid can be defined as an interface residue if it loses >1A°2 of accessible surface area (ASA) when it passes from the uncomplexed state (protein only) to complexed (protein–DNA) condition. The total number of interface residues in a single protein defines its nucleic acid binding site. For each binding site, the parameters, such as the size, polarity, interface sequence segmentation and the number of intermolecular hydrogen bonds as well as the Van der Waals interactions were considered. Overall, these evaluations have facilitated generation of a prediction based structural model of AtMYB4. The ribbon diagram of AtMYB4 protein structure has shown in S3A and S3B Fig. The structure was coloredon the basis of the amino acid type information. In the other ribbon structure, within the DNA binding MYB domains, the blue regions indicated the predicted nucleic acid binding amino acid residues of the protein according to the interaction propensities (S3B Fig). The structural model of AtMYB4 has revealed two DNA binding MYB domains at the N-terminal and a C-terminal domain (Fig 2A). The N-terminal MYB domains, including 9–61 amino acids and 62–116 amino acids adopt a tandem packed structure of mainly staggered α-helices (Fig 2A). The C-terminal region, again mostly composed of α-helices assembled into a solenoid fold with a horseshoe like shape. Previous studies have shown that MYB4 interacts with TOPLESS-RELATED corepressors for suppression of protein phosphatase 2C gene transcription and contains a LxLxL EAR repression motif located at around 190 aa residues at the C-terminal end of MYB4 [2]. Based on this information and the present structural model, it was also not possible to predict whether the C-terminal domain of MYB4 acts as activation domain.The characteristics of the N- terminal domain imply that the integrity of this region is important to the structural framework of AtMYB4. From this, it can be speculated that disruption of the integrity of C-terminal part of the protein (corresponds to AtMYB4Δ2 form of AtMYB4) may affect AtMYB4 native structure with reduced stability of AtMYB4 in vivo. The structural model of AtMYB4 has also revealed that there is a cavity in the center of the solenoid fold assembled by the MYB domains and together with the other parts of the protein and the solenoid inner surface, forms about four binding pockets at the surface (Fig 2B and 2C). The surface pockets showed different surface properties in terms of area and volumes (Fig 2B, lower panel).
Fig 2

Structural model of AtMYB4.

A. The N-terminal first and second MYB domains are labeled and shown in green and blue colour, respectively. The C-terminal transcriptional activation domain has been shown in yellow colour. B and C. The binding pockets and the surface properties are shown with the area and volume of the four surface pockets. Accessible surface area of AtMYB4 has been represented as Spiral Plot with the buried residues are located at the core while exposed residues are at the surface. Colour Code used: Blue: Positively charged residues (R, K, H), Red: Negatively charged residues (D, E), Green: Polar uncharged residues (G, N, Y, Q, S, T, W), Yellow: Cystein, Gray: Hydrophobic residues (All others).

Structural model of AtMYB4.

A. The N-terminal first and second MYB domains are labeled and shown in green and blue colour, respectively. The C-terminal transcriptional activation domain has been shown in yellow colour. B and C. The binding pockets and the surface properties are shown with the area and volume of the four surface pockets. Accessible surface area of AtMYB4 has been represented as Spiral Plot with the buried residues are located at the core while exposed residues are at the surface. Colour Code used: Blue: Positively charged residues (R, K, H), Red: Negatively charged residues (D, E), Green: Polar uncharged residues (G, N, Y, Q, S, T, W), Yellow: Cystein, Gray: Hydrophobic residues (All others).

Tryptophan fluorescence studies of UV-B irradiated recombinant AtMYB4

Previously, several studies have utilized bacterially expressed purified recombinant proteins to study the effect of UV-B light on the stability and folding/unfolding properties of proteins in vitro [15, 16, 18, 39] and have revealed valuable information on the structure-function aspects of various key regulatory proteins. Since AtMYB4 shows responsiveness to UV-B light [12], we first investigated the biophysical properties of the purified recombinant AtMYB4 in vitro following exposure to UV-B light. The N-terminal 6X-His tagged recombinant proteins were purified using Ni-NTA affinity resin, followed by Sephacryl S-300 gel filtration chromatography (Fig 1). We first studied the tryptophan fluorescence spectra of bacterially purified recombinant full length AtMYB4 under control condition and after UV-B exposure to monitor whether the protein undergoes any conformational changes under UV-B light. We have also utilized two other recombinant purified N-terminal deletion mutants of this protein, namely AtMYB4Δ1 (Del1, lacking the N-terminal first MYB domain) and AtMYB4Δ2 (Del2, lacking the N-terminal second MYB domain) in the similar set of experiments to understand the relative influence of the N-terminal domains on the conformational stability of the C-terminal region and the full length protein as a whole. The recombinant purified protein samples were exposed to UV-B light (200 J/m2) for up to 4 h in the dark at 25°C and then tryptophan fluorescence spectra were recorded. The tryptophan fluorescence intensity of all three forms of proteins (AtMYB4, AtMYB4Δ1 and AtMYB4Δ2) were clearly decreased with increasing duration of exposure to UV-B light (Fig 3A–3C). However, no clear shift in emission maxima, which remained nearly constant at around 340 nm, could be detected for AtMYB4 and its N-terminal deletion forms, suggesting that the polarity of the tryptophan microenvironment remained largely unaffected after exposure to the mentioned dose of UV-B light. We considered two possibilities for this situation. The observed decrease in the tryptophan fluorescence intensity of the proteins after UV-B exposure may directly result from the conformational changes within the protein molecule itself or due to degradation of tryptophan residues or due to both. On the other hand, the total tryptophan fluorescence intensity of untreated control AtMYB4 protein showed the maximum intensity with emission maximum at 340 nm, while AtMYB4Δ1 showed marginal decrease, but ~20% drop in tryptophan intensity at 340 nm was observed for AtMYB4Δ2 protein (Fig 3D), indicating that the first N-terminal MYB domain associated residues have only marginal effect on the microenvironment of tryptophan residues. However, the N-terminal second MYB domain associated residues appears to have more prominent effect on the tryptophan microenvironment. This observation was consistent when total tryptophan fluorescence intensity of 4 h UV-B irradiated protein sample samples were compared (Fig 3D, embedded panel).
Fig 3

Tryptophan fluorescence spectra of untreated control and UV-B irradiated purified recombinant AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins.

About 0.05 mg/ml of purified recombinant AtMYB4 (A), AtMYB4Δ1 (B) and AtMYB4Δ2 (C) protein samples in a final volume of 500 μL of 50 mM Tris-HCl buffer, pH 7.5 (containing 1 mM β-ME and 1 mM PMSF) were irradiated with an UV-B dose of ~200 J/m2 for the indicated time points in the dark at 25°C. Tryptophan fluorescence spectra of control and UV-B irradiated protein samples were measured by following the procedure described under ‘Materials and Methods’. The 0-h time point served as the control. (D) Tryptophan fluorescence spectra of untreated control and 4 h UV-B treated (embedded image) AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins. E and F. Normalized tryptophan fluorescence spectra (per tryptophan residue) of untreated control (E) and UV-B exposed (~200 J/m2 for 4 h) AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins (F).G-I. UV-B mediated oxidative degradation of tryptophan residues to N-formylkynurenine in AtMYB4 (G), AtMYB4Δ1 (H) and AtMYB4Δ2 (I) proteins following UV-B exposure for various time points. Fluorescence spectra were measured using excitation wavelength of 365 nm with the emission wavelengths ranging from 390 to 530 nm and emission scan speed of 240 nm/min, using 0.05 mg/ml of purified protein samples.

Tryptophan fluorescence spectra of untreated control and UV-B irradiated purified recombinant AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins.

About 0.05 mg/ml of purified recombinant AtMYB4 (A), AtMYB4Δ1 (B) and AtMYB4Δ2 (C) protein samples in a final volume of 500 μL of 50 mM Tris-HCl buffer, pH 7.5 (containing 1 mM β-ME and 1 mM PMSF) were irradiated with an UV-B dose of ~200 J/m2 for the indicated time points in the dark at 25°C. Tryptophan fluorescence spectra of control and UV-B irradiated protein samples were measured by following the procedure described under ‘Materials and Methods’. The 0-h time point served as the control. (D) Tryptophan fluorescence spectra of untreated control and 4 h UV-B treated (embedded image) AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins. E and F. Normalized tryptophan fluorescence spectra (per tryptophan residue) of untreated control (E) and UV-B exposed (~200 J/m2 for 4 h) AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins (F).G-I. UV-B mediated oxidative degradation of tryptophan residues to N-formylkynurenine in AtMYB4 (G), AtMYB4Δ1 (H) and AtMYB4Δ2 (I) proteins following UV-B exposure for various time points. Fluorescence spectra were measured using excitation wavelength of 365 nm with the emission wavelengths ranging from 390 to 530 nm and emission scan speed of 240 nm/min, using 0.05 mg/ml of purified protein samples. Since AtMYB4 and its N-terminal deletion forms contain different number of tryptophan residues (6 trp residues in AtMYB4, 3 trp residues in AtMYB4Δ1 and 1 in AtMYB4Δ2 fragment), we next compared the normalized tryptophan fluorescence intensity by using fluorescence per tryptophan residue of control and UV-B treated protein samples. This has facilitated to normalize the tryptophan fluorescence intensity in all the three protein samples to understand the relative position of the tryptophan residues on the protein structure. Surface location of tryptophan residue will produce more fluorescence intensity while fluorescence intensity will be less when it becomes buried within the structural folds. Again, change in folding property due to some treatment (such as UV-B light, as used here) may cause surface located tryptophan residue becomes buried or expose the previously buried tryptophan residue to the surface. Consideration of per residue tryptophan fluorescence spectra in AtMYB4Δ2 protein showed maximum intensity at 340 nm both under control condition and after UV-B treatment than AtMYB4 and AtMYB4Δ1, respectively (Fig 3E and 3F). This result has indicated that the single tryptophan residue present within the AtMYB4Δ2 region appears to be exposed, mainly contribute to the fluorescence intensity and affect the microenvironment of tryptophan residues within the protein structure in general after UV-B exposure as evidenced with ~60% drop in tryptophan intensity at 340 nm for AtMYB4Δ2 after UV-B exposure (Fig 3E and 3F). Even the normalized tryptophan fluorescence (per tryptophan residue) intensity of control and UV-B exposed AtMYB4Δ2 protein was also higher than AtMYB4. Tryptophan fluorescence quenching analysis also indicated substantial change in microenvironment of tryptophan residue in UV-B irradiated AtMYB4Δ2 (S4 Fig). Taken together, these results have indicated that subsequent deletion of the N-terminal MYB domains probably exposes the tryptophan residue located at the C-terminal region of the protein, resulting in substantial change in on the microenvironment of the tryptophan residues. Previous studies have established UV-B mediated degradation of tryptophan residues to kynurenine which produces characteristic tryptophan emission spectrum with maximum at around 450 nm [15, 18]. Based on this, we next compared kynurenine spectra of AtMYB4 and its N-terminal deletion forms under control and after UV-B exposure for various time points (Fig 3G–3I). The extent of kynurenine formation was considerably less in all three forms of the protein under control condition than the UV-B exposed ones. After 4 h of UV-B exposure, kynurenine formation in AtMYB4 was found to be slightly higher than the N-terminal deletion forms of the protein. AtMYB4Δ1 and AtMYB4Δ2 showed almost similar level of kynurenine formation after 4 h of UV-B irradiation (Fig 3G–3I). However, comparison of per residue tryptophan fluorescence spectra of kynurenine formation in control and UV-B irradiated protein samples revealed that kynurenine formation was maximum in AtMYB4Δ2 after UV-B exposure (S5 Fig). Together, these results have indicated that deletion of the N-terminal second MYB domain helps in exposing the C-terminal tryptophan residue for the subsequent degradation following UV-B irradiation. Apart from this, the results also suggest that the N-terminal conserved DNA binding MYB domains possibly help in stabilizing the C-terminal regulatory region of AtMYB4.

Analysis of conformational change of recombinant AtMYB4 after UV-B exposure in vitro

Surface hydrophobicity characteristics of proteins provide important information about the possible change in the structural conformation of proteins during stress conditions and also play crucial role in regulating protein-protein interactions [35]. Based on this, We next performed Bis-ANS binding assay to investigate the possibility of exposure of hydrophobic pockets on the protein surface of AtMYB4 and its N-terminal deletion forms after UV-B exposure [15]. Bis-ANS (4, 4’-dianilino-1, 1’-binaphthyl-5, 5- disulfonic acid) acts as a conformation sensitive hydrophobic probe and has been extensively used in several studies for probing the surface-exposed hydrophobicity of proteins [19, 40, 41, 42]. Bis-ANS shows low fluorescence quantum yield in aqueous solution, while becomes highly fluorescent after binding to hydrophobic pockets [21]. Fluorometric titration of control and UV-B treated proteins by Bis-ANS were carried out to determine the number of Bis-ANS binding sites (n) and the binding constant (KD). The results were analyzed by Scatchardplots (Fig 4A, 4C, 4D, 4F, 4G and 4I). The number of binding sites (n) and the dissociation constant for binding (KD) were determined from the slope and intercepts of the plots (Table 1). For the untreated control protein samples, the number of hydrophobic sites were clearly increased from AtMYB4 to AtMYB4Δ1 and AtMYB4Δ2, respectively, indicating that removal of the N-terminal MYB domains results in the exposure of some hydrophobic groups to the surface of the globular protein structure. However, for all the three protein samples (AtMYB4, AtMYB4Δ1 and AtMYB4Δ2) the hydrophobic sites were decreased with the concomitant increase in dissociation constant (KD) after UV-B treatment, suggesting partial loss of their native conformation (Table 1).
Fig 4

Changes in surface hydrophobicity of purified recombinant AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins after UV-B exposure.

A Bis-ANS binding titration of untreated control and UV-B irradiated recombinant AtMYB4. B and C. Determination of stoichiometry (n) and dissociation constant (KD) of untreated control and UV-B treated recombinant AtMYB4. D. Bis-ANS binding titration of untreated control and UV-B irradiated recombinant AtMYB4Δ1.E and F.Determination of stoichiometry (n) and dissociation constant (kd) respectively of untreated control and UV-B treated recombinant AtMYB4Δ1.G.Bis-ANS binding titration of untreated control and UV-B irradiated recombinant AtMYB4Δ2. H and I. Determination of stoichiometry (n) and dissociation constant (kd) respectively of untreated control and UV-B treated AtMYB4Δ2. About 0.02 mg/ml of each type of purified recombinant protein sample in 50 mMTris-HCl buffer; pH 7.5 (containing 1 mM PMSF and 1 mM β-mercaptoethanol) was titrated by addition of aqueous solution of Bis-ANS. The excitation and emission wavelengths were 390 and 490 nm, respectively. The intensities at 490 nm, from the titration, were plotted as a function of Bis-ANS concentration.

Table 1

Determination of stoichiometry (n) and dissociation constant (KD) of untreated control and UV-B irradiated recombinant AtMYB4 and the N terminus deletion forms.

ProteinsnKD (μM)
AtMYB4 (No UV-B control)0.31±0.023.20 ± 0.02
AtMYB4 + UV-B (200J/m2, 4 h)0.22 ± 0.014.17± 0.03
AtMYB4Δ1 (No UV-B control)0.50±0.034.6± 0.04
AtMYB4Δ1 +UV-B (200J/m2, 4 h)0.32±0.015.32 ± 0.02
AtMYB4Δ2 (No UV-B control)0.62± 0.015.81 ± 0.02
AtMYB4Δ2 +UV-B (200J/m2, 4 h)0.43±0.026.1 ± 0.02

± (Errors represent SD from triplicate measurements)

Changes in surface hydrophobicity of purified recombinant AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins after UV-B exposure.

A Bis-ANS binding titration of untreated control and UV-B irradiated recombinant AtMYB4. B and C. Determination of stoichiometry (n) and dissociation constant (KD) of untreated control and UV-B treated recombinant AtMYB4. D. Bis-ANS binding titration of untreated control and UV-B irradiated recombinant AtMYB4Δ1.E and F.Determination of stoichiometry (n) and dissociation constant (kd) respectively of untreated control and UV-B treated recombinant AtMYB4Δ1.G.Bis-ANS binding titration of untreated control and UV-B irradiated recombinant AtMYB4Δ2. H and I. Determination of stoichiometry (n) and dissociation constant (kd) respectively of untreated control and UV-B treated AtMYB4Δ2. About 0.02 mg/ml of each type of purified recombinant protein sample in 50 mMTris-HCl buffer; pH 7.5 (containing 1 mM PMSF and 1 mM β-mercaptoethanol) was titrated by addition of aqueous solution of Bis-ANS. The excitation and emission wavelengths were 390 and 490 nm, respectively. The intensities at 490 nm, from the titration, were plotted as a function of Bis-ANS concentration. ± (Errors represent SD from triplicate measurements)

Urea unfolding study

To determine the relative thermodynamic stability of AtMYB4 and the N-terminal deletion forms of the protein, we next analyzed and compared urea induced unfolding profiles of the untreated control and UV-B treated protein samples by measuring the tryptophan fluorescence of the protein solutions as a function of urea concentration. As a result of shift of the emission maxima from 337 to over 350 nm in presence of increasing concentration of urea from 0 to 8 M, the data were plotted as fluorescence intensity ratio (I337/I350) against urea concentration as described previously [15]. Urea induced denaturation profiles yielded sigmoidal shape of the curves for all the protein samples, indicating cooperativity (Fig 5A–5C). Calculation of C0.5 values (50% denaturation) of the proteins showed some decrease in C0.5 for UV-B irradiated AtMYB4 (2.97 M urea) than the untreated control protein (3.48 M urea). However, AtMYB4Δ1 and AtMYB4Δ2 did not show any considerable difference in C0.5 values for untreated control and UV-B treated protein samples (Table 2).
Fig 5

Thermodynamic stability of recombinant AtMYB4 and its N-terminal deletion forms.

A-C. Urea induced denaturation profiles of untreated control and UV-B irradiated AtMYB4 (A), AtMYB4Δ1 (B) and AtMYB4Δ2 (C). The experiments were performed using 0.05 mg/ml of purified protein in 50 mM Tris-HCl buffer, pH 7.5 (containing 1 mM β-ME and 1 mM PMSF). Untreated control and UV-B irradiated (~200 J/ m2 UV-B irradiation for 4 h at 25°C) protein samples were incubated in presence of increasing concentrations of urea (0–8 mM) in a reaction volume of 600 μL for about 16 h at room temperature (25°C). Samples were excited at 295 nm and emission was scanned between 300 to 400 nm. Ratios of fluorescence intensities at 337 and 350 nm were plotted as function of urea concentration.

Table 2

Parameters of equilibrium urea unfolding of recombinant AtMYB4 and the N terminus deletion forms of the protein under control and after UV-B treatment.

ProteinsΔG1 (kJ/mol)ΔG11 (kJ/mol)ΔG (kJ/mol)C0.5 values
AtMYB4 (No UV-B control)11.6 ± 2.25.1 ± 1.216.7 ± 3.43.4878±0.195
AtMYB4 + UV-B (200J/m2, 4 h)10.8 ± 2.15.2 ± 1.116.0 ± 3.22.9739±0.0004
AtMYB4Δ1 ((No UV-B control)11.4 ± 2.75.4 ± 1.916.8 ± 4.63.4245±0.208
AtMYB4Δ+ UV-B (200J/m2, 4 h)10.3 ± 2.35.5 ± 1.115.8 ± 3.43.4614±0.197
AtMYB4Δ2 ((No UV-B control)11.3 ± 3.15.7 ± 2.117.0 ± 5.23.5793±0.184
AtMYB4Δ2 + UV-B (200J/m2, 4 h)10.8 ± 2.54.8 ± 0.615.6 ± 3.13.5133±0.517

± (Errors represent SD from triplicate measurements)

Thermodynamic stability of recombinant AtMYB4 and its N-terminal deletion forms.

A-C. Urea induced denaturation profiles of untreated control and UV-B irradiated AtMYB4 (A), AtMYB4Δ1 (B) and AtMYB4Δ2 (C). The experiments were performed using 0.05 mg/ml of purified protein in 50 mM Tris-HCl buffer, pH 7.5 (containing 1 mM β-ME and 1 mM PMSF). Untreated control and UV-B irradiated (~200 J/ m2 UV-B irradiation for 4 h at 25°C) protein samples were incubated in presence of increasing concentrations of urea (0–8 mM) in a reaction volume of 600 μL for about 16 h at room temperature (25°C). Samples were excited at 295 nm and emission was scanned between 300 to 400 nm. Ratios of fluorescence intensities at 337 and 350 nm were plotted as function of urea concentration. ± (Errors represent SD from triplicate measurements) The standard free energy change (ΔG0) required for complete unfolding of the proteins from their native state in absence of urea was calculated by fitting the experimental denaturation profile based on the three-state model [25] assuming one intermediate. The thermodynamic parameters thus determined are summarized in Table 2. For AtMYB4, AtMYB4Δ1 and AtMYB4Δ2, the ΔG0I values were found to be higher than ΔG0II both for the control and UV-B irradiated protein samples, suggesting that the intermediate forms of the proteins, generated during unfolding, are located away from the native state of the respective proteins in the free energy coordinate. It is interesting to mention that in spite of having deletion in the sequences; the stability (ΔG) of all the untreated control AtMYB4 variants was of similar level (Table 2). However, after UV-B exposure, AtMYB4Δ2 showed more reduction in ΔG0 value compared to AtMYB4 and AtMYB4Δ1 (Table 2). Again, this may imply role of N-terminal region in the regulation of the overall stability of AtMYB4.

Prolong UV-B exposure alters secondary structure in N-terminal deletion forms of AtMYB4

To further determine any possible change at the secondary structural level, we next analyzed the far-UV circular dichroism (CD) spectra of untreated control and UV-B treated recombinant AtMYB4 and its N-terminal deletion forms. The CD spectra of AtMYB4 and its N-terminal deletion versions have indicated typical characteristics of alpha helical protein (Fig 6A–6C). The AtMYB4 variants showed some degree of change in the CD spectra on prolonged UV-B dosage. Nonetheless, AtMYB4Δ2 showed significant change in its spectral pattern compared to AtMYB4 and AtMYB4Δ1.
Fig 6

Evaluation of changes in the secondary structure of AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins by far-UV CD and Fourier transform infrared spectroscopy (FTIR).

A-C.Far-UV CD spectra of untreated control, 2h and 4h UV-B irradiated AtMYB4 (A), AtMYB4Δ1 (B) and AtMYB4Δ2 (C) proteins, respectively. D-F.Amide I FT-IR spectra of untreated control and 4 h UV-B irradiated (~200 J/m2)AtMYB4 (D), AtMYB4Δ1 (E) and AtMYB4Δ2 (F) proteins.

Evaluation of changes in the secondary structure of AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins by far-UV CD and Fourier transform infrared spectroscopy (FTIR).

A-C.Far-UV CD spectra of untreated control, 2h and 4h UV-B irradiated AtMYB4 (A), AtMYB4Δ1 (B) and AtMYB4Δ2 (C) proteins, respectively. D-F.Amide I FT-IR spectra of untreated control and 4 h UV-B irradiated (~200 J/m2)AtMYB4 (D), AtMYB4Δ1 (E) and AtMYB4Δ2 (F) proteins. The CD spectral data were further quantitatively analyzed by fitting each spectrum with several secondary structure analysis programme, such as CDNN [15, 43]. As shown in Table 3, we could not able to detect any significant increase either in Δ-sheet component or random coil contribution at the expense of helical structure in AtMYB4 after UV-B exposure. Similarly, removal of the first N-terminal MYB domain from AtMYB4 (AtMYB4Δ1) showed only marginal change in β-sheet component or random coil contribution than the full length AtMYB4 under control condition (no UV-B) (Table 3). AtMYB4 and the other two N-terminal deletion forms showed α-helix in the range of 15–20% and the observed variations were in most cases within the limits of experimental error. The β-sheet and turn were found in the range of ~22–34% and 18–21%, respectively. However, untreated control AtMYB4 and its N-terminal deletion forms showed relatively higher proportion of unordered part (31–36%). Apart from this, as compared to AtMYB4, untreated control AtMYB4Δ2 showed decreased α-helical content and relatively higher proportion of β-sheet structure (Table 3). After UV-B exposure, AtMYB4 showed marginal increase in β-sheet structure. However, for AtMYB4Δ1, significant increment in β-sheet structure with the concomitant decrease in α-helix could be detected after UV-B exposure. In contrast, for AtMYB4Δ2, the α-helix content has increased with some loss of β-sheet structure after UV-B exposure (Table 3).
Table 3

Analysis of changes in the secondary structure compositions (in percentage) of full length and the N terminus truncated forms of recombinant purified AtMYB4 before and after UV-B exposure by far-UV CD spectroscopy.

Proteinsα-Helix (%)β-Sheet (%)Unordered (%)Turn (%)
AtMYB4 (No UV-B control)19±127±235±219±1
AtMYB4 + UV-B (200J/m2, 2 h)1827±135±220±1
AtMYB4 + UV-B (200J/m2, 4 h)17±129±134±120±2
AtMYB4Δ1 (No UV-B control)20±225±136±119±1
AtMYB4Δ1 + UV-B (200J/m2, 2 h)14±134±331±121±1
AtMYB4Δ1 + UV-B (200J/m2, 4 h)14±234±231±221
AtMYB4Δ2 (No UV-B control)15±133±232±120±1
AtMYB4Δ2 + UV-B (200J/m2, 2 h)20±123±136±121±1
AtMYB4Δ2 + UV-B (200J/m2, 4 h)24±222±136±118±1

± (Errors represent SD from triplicate measurements)

± (Errors represent SD from triplicate measurements) The CD spectra data were further validated by performing the Fourier transform infrared spectroscopy (FT-IR) using the similar set of protein samples. The amide I band of FT-IR data of untreated control and UV-B treated proteins were resolved by Fourier self-deconvolution and compared (Fig 6D–6F). For the untreated control proteins, the amide-I spectra showed band peak near 1640 cm-1, indicating the α-helical conformation of the protein samples. However, after UV-B exposure, band peak shifted towards near 1660 cm-1 for AtMYB4 and the other N-terminal deletion forms, suggesting conformational change in AtMYB4 structure.

Deletion of N-terminal MYB domains enhances propensity of aggregation of AtMYB4 after UV-B exposure

UV-B light is known to frequently induce protein misfolding and aggregation, destruction or modification of amino acid residues, or both [23]. Considering the change in the secondary structural components of AtMYB4 and its N-terminal deletion forms due to UV-B exposure, we further studied possible influence of UV-B irradiation on the stability of AtMYB4 in vitro. To address this issue, we first carried out light scattering experiments to compare the scattering profile of purified recombinant untreated control proteins with the UV-B treated proteins to monitor the possibility of protein aggregation after UV-B exposure. As compared to untreated control, UV-B treated AtMYB4 did not show any significant increase in light scattering after UV-B exposure (Fig 7A). However, AtMYB4Δ1 and particularly AtMYB4Δ2 showed slightly higher light scattering pattern after UV-B exposure for 4 h (Fig 7B and 7C), suggesting somewhat higher tendency of aggregate formation of UV-B irradiated AtMYB4Δ1 and AtMYB4Δ2. Monitoring of light scattering of UV-B treated purified bovine γ-crystallin protein showed clear aggregation pattern, as reported previously [15] and has been used as positive control.
Fig 7

Analysis of the possibility of UV-B induced aggregation of AtMYB4 in vitro.

A-C Aggregation assay using untreated control, 2h and 4h UV-B irradiated purified recombinant AtMYB4 (A), AtMYB4Δ1 (B) and AtMYB4Δ2 (C) proteins in UV-B spectrophotometer. D-F.Fluorescence spectra of untreated control and 4h UV-B irradiated purified recombinant AtMYB4 (D), AtMYB4Δ1 (E) and AtMYB4Δ2 (F) proteins. G-I. Aggregation assay by measurement of dynamic light scattering patterns of untreated control, 2h and 4h UV-B irradiated purified recombinant AtMYB4 (G), AtMYB4Δ1 (H) and AtMYB4Δ2 (I)proteins.

Analysis of the possibility of UV-B induced aggregation of AtMYB4 in vitro.

A-C Aggregation assay using untreated control, 2h and 4h UV-B irradiated purified recombinant AtMYB4 (A), AtMYB4Δ1 (B) and AtMYB4Δ2 (C) proteins in UV-B spectrophotometer. D-F.Fluorescence spectra of untreated control and 4h UV-B irradiated purified recombinant AtMYB4 (D), AtMYB4Δ1 (E) and AtMYB4Δ2 (F) proteins. G-I. Aggregation assay by measurement of dynamic light scattering patterns of untreated control, 2h and 4h UV-B irradiated purified recombinant AtMYB4 (G), AtMYB4Δ1 (H) and AtMYB4Δ2 (I)proteins. Although, static light scattering patterns of proteins in a spectrophotometer are routinely performed as a measure of protein aggregate formation, monitoring light scattering pattern in a spectrofluorometer provides higher sensitivity for detection of even marginal level protein aggregation than UV-B spectrophotometric measurements. Therefore, to further determine the possibility of even small level of UV-B induced aggregation of AtMYB4 or its N-terminal deletion forms, we then performed light scattering experiments in a spectrofluorometer. UV-B exposed proteins showed relatively higher propensity of light scattering than untreated controls (Fig 7D–7F). Again, consistent with the light scattering pattern observed in UV-spectrophotometric scan, AtMYB4Δ2 showed notably higher light scattering after UV-B exposure for 4 h than the other two protein forms (Fig 7F). Together, these results suggest that deletion of the N-terminal DNA binding MYB domains affects protein stability, thus the C-terminal part, lacking both the N-terminal MYB domains (AtMYB4Δ2) shows increased tendency of aggregation after extended duration of UV-B exposure. Dynamic light scattering (DLS) provides a non-invasive technique for measuring the size of particles and molecules in suspension for monitoring oligomerization and/or aggregation. DLS helps in measuring the random movement of particles undergoing Brownian motion and will not be applicable when the particle motion is not random. The speed of the Brownian motion is again influenced by the particle size, sample viscosity and temperature [44, 45]. To further validate the aggregation pattern of AtMYB4 and its N-terminal deletion forms after UV-B treatment as obtained in UV-vis spectrophotometric studies, we next carried out DLS analysis using the purified recombinant proteins as described under ‘Materials and Methods’. As shown in Fig 7G and 7H, the size of AtMYB4 and AtMYB4Δ1 proteins were within the monomer size range of up to 2 nm, eliminating the possibility of formation of dimes or oligomers. However, relative increase in protein particle size, particularly in UV-B treated AtMYB4Δ2 have indicated the possibility of protein aggregation (Fig 7I) and was also consistent with the aggregation pattern of AtMYB4Δ2 in UV-B and fluorescence spectra. Taken together, these results have suggested that deletion of the N-terminal second MYB domain prominently influence the stability of AtMYB4 and the impact could be detected in case of UV-B irradiated protein samples.

Detection of additional putative MYB4 binding motif in the promoter proximal region of AtMYB4

Previous studies have shown transient inducible nature of MYB4 transcript in Arabidopsis under various light conditions, particularly UV-B light which has been shown to suppresses AtMYB4 expression after 6 h of exposure [12]. On the other hand, an importin β-like protein, SAD2 plays crucial role in mediating nuclear trafficking of MYB4 protein. In sad2-1 mutant, MYB4 protein has been shown to fail to move to the nucleus, resulting in over accumulation of MYB4 mRNA. Based on this, it has been suggested that MYB4 protein binds to its promoter and repress its own transcription, thus maintaining an autoregulatory feedback loop for MYB4 protein and mRNA [1]. Further experiments have detected three putative MYB binding elements, ACCTACC (-1009 to -1003), ACCAACC (-2773 to -2767) and ACCTAAC (-1935 to -1929) in the distal region of AtMYB4 promoter and recombinant AtMYB4 protein showed binding activity to these MYB elements [1]. In our study, biophysical characterization of recombinant AtMYB4 has shown that the overall structural stability of wild-type (full length) AtMYB4 protein remains relatively unaffected following exposure to UV-B light in vitro and therefore, it still can act as a transcription factor. Therefore, to get more insight into the structure function aspects of this protein, we next investigated the possible mechanism of regulation of AtMYB4 expression and investigated the possible existence of additional putative MYB4 motifs in the promoter proximal region, which might play more prominent role in the autoregulation of MYB4 expression. For this, we first isolated ~1.0 kb upstream promoter fragment of AtMYB4. Sequence analysis of AtMYB4 promoter (PlantPan2.0, http://plantpan2.itps.ncku.edu.tw/) has revealed the existence of at least two additional putative MYB4 binding motifs located in the region of -212 () and -908 () positions, respectively relative to the transcription start site in AtMYB4 promoter (S6A and S6B Fig). Based on this information, we then prepared pool of synthetic oligonucleotides containing the putative MYB4 binding motifs detected within AtMYB4 promoter and additional putative MYB binding motifs found in the promoters of other predicted targets of MYB4 in Arabidopsis, such as C4H, PAL, CHS and CI. After sequence alignment, consensus of MYB4 motif was generated using WebLogo-3 (http://weblogo.threeplusone.com/create.cgi) (S6C Fig). In addition, a genome wide scan in Arabidopsis using the putative core MYB4-binding elements detected in AtMYB4 promoter facilitated identification of additional MYB4-binding motifs in the promoters of various other transcription factor genes, including AGAMOUS, CCA1, LHY1, REV6 (homeodomain transcription factor), suggesting possible regulatory function of MYB4 transcription factor in diverse cellular pathways (S2 Table). We next investigated whether the putative MYB4-binding element located within the AtMYB4 promoter proximal region plays any role in regulation of AtMYB4 expression. To test this possibility, electrophoretic gel mobility shift assay was carried out using purified 6X-His-tagged recombinant AtMYB4 (containing both the N-terminal DNA binding MYB domains) and AtMYB4Δ1 (lacking the N-terminal first MYB domain) proteins (Table 4). The purified recombinant proteins were used in gel shift assays with synthetic oligonucleotides tested one-by-one for the DNA binding activity. AtMYB4 showed strong DNA binding activity for MYB4-Cis1, while only weak DNA-protein complex could be detected for MYB4-Cis2 motif (Fig 8A). Interestingly, AtMYB4Δ1 showed considerably weak MYB4-motif binding activity than the wild-type protein (AtMYB4), demonstrating important role of the N-terminal first MYB domain in mediating the DNA-protein interactions (Fig 8B). However, additional in vivo study is needed to establish this notion.
Table 4

Primer sequences used for gel mobility shift assay, chromatin immune-precipitation and fluorescence anisotropy.

Primers5’——3’ Sequence
MYB4-Cis1FTTCAACCAAACCCAATTCAACCAAACCCAA
MYB4-Cis1RTTGGGTTTGGTTGAATTGGGTTTGGTTGAA
MYB4-Cis2FACCTATAATATCTGGCGACCTATAATATCTGGCG
MYB4-Cis2RCGCCAGATATTATAGGTCGCCAGATATTATAGGT
MYB4-Cis1/m1FTTCAGCCGAACCCAATTCAGCCGAACCCAA
MYB4-Cis1/m1RTTGGGTTCGGCTGAATTGGGTTCGGCTGAA
MYB4-Cis1/m2FTTCAATCAAATCCAATTCAATCAAATCCAA
MYB4-Cis1/m2RTTGGATTTGATTGAATTGGATTTGATTGAA
MYB4-Cis1/m3FTTCAACAAATCCCAATTCAACAAATCCCAA
MYB4-Cis1/m3RTTGGGATTTGTTGAATTGGGATTTGTTGAA
MYB4-Cis2/m1FACCTATGATACCTGGCGACCTATGATACCTGGCG
MYB4-Cis2/m1RCGCCAGGTATCATAGGTCGCCAGGTATCATAGGT
MYB4-Cis2/m2FACCTATAACGTCTGGCGACCTATAACGTCTGGCG
MYB4-Cis2/m2RCGCCAGACGTTATAGGTCGCCAGACGTTATAGGT
MYB4-Cis2/m3FACCTATAATGCCTGGCGACCTATAATGCCTGGCG
MYB4-Cis2/m3RCGCCAGGCATTATAGGTCGCCAGGCATTATAGGT
PrimersPrimers used in ChiP assay
Amplicon 1 Forward:5’ CCACCAAATGCTTCAATCCT 3’
Amplicon 1 Reverse:5’TGGTTTAGATCTTATTTCGTCTCAAA3’
Amplicon 2 Forward:5’TCTGGCGATAAAAGCCATTC3’
Amplicon 2 Reverse:5’CGTCTTTTAACTTCGACCGATT3’
Amplicon 3 Forward:5’TCATACGATAGGTAAGAGACTCCAAA3’
Amplicon 3 Reverse:5’AACCAACTCTGTCAAGAAATTAATCA3’
Amplicon 4 Forward:5’AACGAAAGGCCACCATACAC3’
Amplicon 4 Reverse:5’GGTTTTGACTTAAAGCTAGAGAGGAA3’
Primers3’fluorescein labeled oligonucleotide primers used in fluorescence anisotropy
MYB4-Cis1-Flc5’AACCTTCAACCAAACCCAAAT3’
MYB4-Cis2-Flc5’GACCTATAATATCTGGCGAT3’
Fig 8

Determination of DNA binding activity of AtMYB4.

Gel mobility shift assays with recombinant AtMYB4 (A) and AtMYB4Δ1(B) using the putative MYB4 binding motifs MYB4-Cis1 and MYB4-Cis-2, respectively. Lanes 1 and 4 in (A) and (B) represent free oligo without any protein. The position of DNA-protein complex has been indicated on the right sige of the gel images. Lanes 2 and 3 contained 10 μg of purified recombinant AtMYB4 (A) and AtMYB4Δ1 (B), respectively with 125 ng of MYB4-Cis1 or MYB4-Cis2 oligo. C and D. Gel mobility shift assays using recombinant AtMYB4 with increasing concentrations of MYB4-Cis1 (C) and MYB4-Cis2 (D), respectively. No protein was added in lane 1 while lanes 2–4 contained 10 μg of purified recombinant AtMYB4 with 25, 75 and 125 ng of MYB4-Cis1 (C) and MYB4-Cis2 (D), respectively. The positions of free oligo and DNA-protein complex are shown on the right side of the gel images. E and F. Gel mobility shift assays using increasing concentrations of recombinant AtMYB4. No protein was added in lane 1, while lanes 2–4 contained 5, 10 and 15 μg of purified recombinant AtMYB4. The DNA binding assays were performed using 125 ng of MYB4-Cis1 (E) or MYB4-Cis2 oligo (F), respectively. Representative gel images from at least three independent experiments have been shown.

Determination of DNA binding activity of AtMYB4.

Gel mobility shift assays with recombinant AtMYB4 (A) and AtMYB4Δ1(B) using the putative MYB4 binding motifs MYB4-Cis1 and MYB4-Cis-2, respectively. Lanes 1 and 4 in (A) and (B) represent free oligo without any protein. The position of DNA-protein complex has been indicated on the right sige of the gel images. Lanes 2 and 3 contained 10 μg of purified recombinant AtMYB4 (A) and AtMYB4Δ1 (B), respectively with 125 ng of MYB4-Cis1 or MYB4-Cis2 oligo. C and D. Gel mobility shift assays using recombinant AtMYB4 with increasing concentrations of MYB4-Cis1 (C) and MYB4-Cis2 (D), respectively. No protein was added in lane 1 while lanes 2–4 contained 10 μg of purified recombinant AtMYB4 with 25, 75 and 125 ng of MYB4-Cis1 (C) and MYB4-Cis2 (D), respectively. The positions of free oligo and DNA-protein complex are shown on the right side of the gel images. E and F. Gel mobility shift assays using increasing concentrations of recombinant AtMYB4. No protein was added in lane 1, while lanes 2–4 contained 5, 10 and 15 μg of purified recombinant AtMYB4. The DNA binding assays were performed using 125 ng of MYB4-Cis1 (E) or MYB4-Cis2 oligo (F), respectively. Representative gel images from at least three independent experiments have been shown.

Recombinant AtMYB4 binds specifically to the promoter proximal MYB4-binding element

Next, to validate the specificity of AtMYB4 binding activity to the putative MYB4 motis, we further carried out gel shift assays using low concentrations of both the oligonucleotide sequences (MYB4-Cis1 and MYB4-Cis2) as probe. As shown in Fig 8C and 8D, the intensity of the DNA-protein complex was specifically detected even when about 50-fold less molar levels of MYB4-Cis1 and MYB4-Cis2 were used for interaction with recombinant AtMYB4 protein. However, AtMYB4 binding to MYB4-Cis2 motif was clearly weak than MYB4-Cis1 (Fig 8C and 8D). In addition, the binding activity was also increased when increasing amount of recombinant AtMYB4 was used (Fig 8E and 8F), suggesting binding specificity of AtMYB4 for the putative MYB4 motif (s). For gel shift assay, we used non-radiolabeled Syber green based EMSA Kit (Molecular Probe, Invitrogen). Therefore, we could not able to carry out the classical competition assays using labeled oligo and non-labeled competitor for determination of binding specificity. Instead, we have used the mutant versions of MYB4-Cis1 and MYB4-Cis2 to validate the binding specificity. Furthermore, additional gel shift assays using the mutant versions of MYB4-Cis1 and MYB4-Cis2 did not produce any DNA-protein complex or very weak complexes were formed, thus also demonstrated the binding specificity of AtMYB4 for MYB4-Cis1 and MYB4-Cis2, respectively (Fig 9A and 9B) (Table 4). However, relative intensities of the DNA-protein complexes formed by the interactions of AtMYB4 with MYB4-Cis1 and MYB4-Cis2 motifs have clearly indicated comparatively strong interaction of AtMYB4 with MYB4-Cis1 motif than MYB4-Cis2 sequence. These observations have suggested that AtMYB4 protein probably binds to the MYB4-Cis1 motif, located within the promoter proximal region (-212 bp relative to transcription start site), with higher affinity and may involve in the transcriptional regulation of AtMYB4 expression.
Fig 9

Binding specificity of AtMYB4 to the putative MYB4 motifsA and B. Gel mobility shift assays were carried out using recombinant AtMYB4 with the wild-type and mutant versions of MYB4-Cis1 (A) and MYB4-Cis2 oligos (B). No protein was added in lane 1 while lane 2 contained wild-type MYB4-Cis1 or MYB4-Cis2. Lanes 3–5 contained mutant versions of MYB4-Cis1 (A) or MYB4-Cis2 (B), respectively. Representative gel images from at least three independent experiments have been shown. C. Gel mobility shift assays using untreated control and UV-B irradiated recombinant AtMYB4 with MYB4-Cis1 (A) and MYB4-Cis2 oligos. No protein was added in lanes 1 and 4, while lanes 2 and 5 contained untreated control recombinant AtMYB4. UV-B irradiated recombinant AtMYB4 protein was used in lanes 3 and 6. 10 μg of purified recombinant AtMYB4 used in the reaction with 125 ng of each type of oligo. Quantification of data in lanes 1–6 are shown in right panel of Fig 9C. Representative gel images from at least three independent experiments have been shown for A, B and C. D. Diagram showing the locations of the amplicons used in ChiP assays. A1-A4 indicates the locations of the amplicons within AtMYB promoter. E. ChiP PCR using the four amplicons with A1 and A2 containing the putative MYB4 motifs. ChiP PCR using anti-AtMYB4 IgG and pre-immune serum are shown on the upper and middle panels, while the lower panel indicates equal amount of input DNA used. F. Quantification of data in Fig 10E. Relative intensity percentage of amplification of the four amplicons was normalized against input DNA after background subtraction. Densitometric scanning of the amplified bands in the representative gel image from at least three independent trials using Image J. G. Relative GUS activities were measured in wild-type and atmyb4 leaf protoplasts after transfection with pMYB435Smini:GUS construct.

Binding specificity of AtMYB4 to the putative MYB4 motifsA and B. Gel mobility shift assays were carried out using recombinant AtMYB4 with the wild-type and mutant versions of MYB4-Cis1 (A) and MYB4-Cis2 oligos (B). No protein was added in lane 1 while lane 2 contained wild-type MYB4-Cis1 or MYB4-Cis2. Lanes 3–5 contained mutant versions of MYB4-Cis1 (A) or MYB4-Cis2 (B), respectively. Representative gel images from at least three independent experiments have been shown. C. Gel mobility shift assays using untreated control and UV-B irradiated recombinant AtMYB4 with MYB4-Cis1 (A) and MYB4-Cis2 oligos. No protein was added in lanes 1 and 4, while lanes 2 and 5 contained untreated control recombinant AtMYB4. UV-B irradiated recombinant AtMYB4 protein was used in lanes 3 and 6. 10 μg of purified recombinant AtMYB4 used in the reaction with 125 ng of each type of oligo. Quantification of data in lanes 1–6 are shown in right panel of Fig 9C. Representative gel images from at least three independent experiments have been shown for A, B and C. D. Diagram showing the locations of the amplicons used in ChiP assays. A1-A4 indicates the locations of the amplicons within AtMYB promoter. E. ChiP PCR using the four amplicons with A1 and A2 containing the putative MYB4 motifs. ChiP PCR using anti-AtMYB4 IgG and pre-immune serum are shown on the upper and middle panels, while the lower panel indicates equal amount of input DNA used. F. Quantification of data in Fig 10E. Relative intensity percentage of amplification of the four amplicons was normalized against input DNA after background subtraction. Densitometric scanning of the amplified bands in the representative gel image from at least three independent trials using Image J. G. Relative GUS activities were measured in wild-type and atmyb4 leaf protoplasts after transfection with pMYB435Smini:GUS construct.
Fig 10

Fluorescence anisotropy titration of purified recombinant AtMYB4 and AtMYB4Δ1.

Anisotropy of 5 μM fluorescein tagged oligos ( and were used. Botholigos contained fluorescein labeling at the 3’ end (MYB4 binding motifs are underlined). The data was plotted as a function of increasing protein concentration of untreated control and UV-B AtMYB4 (A and B) and AtMYB4Δ1(C and D) proteins. UV-B dose of ~200 J/m2 for 4 h at 25°C was used.

Although our results have indicated that UV-B light may not significantly affect the structural stability of AtMYB4 protein, we next tested whether UV-B exposure has any effect on the MYB4-element binding activity of recombinant AtMYB4 in vitro. Gel shift assay was performed using untreated control and UV-B exposed recombinant AtMYB4 protein with MYB4-Cis1 and MYB4-Cis2 motifs, respectively (Fig 9C). Interestingly, for both the putative MYB4 motifs, the DNA binding activity was further increased when UV-B exposed AtMYB4 protein was used than the control protein (Fig 9C, lanes 2–6) (data quantification shown in right panel of Fig 9C). Together, these results have indicated that the propensity of MYB4 motif binding of AtMYB4 protein probably increases after UV-B exposure, thus proving one clue for explaining reduced expression level of MYB4 under UV-B stress.

AtMYB4 binds to MYB4-Cis1 element in vivo

We further carried out chromatin immunoprecipitation (ChIP) assay to examine in vivo binding of AtMYB4 protein to the putative MYB4 motifs detected in AtMYB4 gene promoter, Chromatin was prepared from two-week-old wild-type Arabidopsis seedlings and then immuno-precipitated with the anti-AtMYB4 antibody. Primer pairs specific to sequences flanking the selected sites were designed (Table 4) (Fig 9D). PCR was performed using primers specific to the target site of AtMYB4 promoter (-212 region as amplicon 1, -908 region as amplicon 2) along with addition sites as negative control (without any putative MYB4 motif, amplicons 3 and 4). The amplified signal for amplicon 1 with the MYB4-Cis1 sequence in the ChIP DNA from Arabidopsis seedlings was significantly stronger as compared to amplicon 2 containing MYB4-Cis2, while no significant enrichment of signals could be detected for amplicons 3 and 4, respectively (Fig 9E). In addition, Chip assay using pre-immune serum did not reveal signal enrichment for any amplicons (Fig 9E, middle panel). About 10% of non-immunoprecipitated DNA and input DNA were reverse crosslinked and used as input DNA control (Fig 9E, lower panel). Fig 9F indicates quantification of data in Fig 9E (lanes 1–4). Together, these results have indicated specific in vivo binding of AtMYB4 to MYB4-Cis1 motif located at the promoter proximal region, while relatively weak signal for MYB4-Cis2 motif suggested that this motif may also provide an alternative binding site for AtMYB4 protein. However, as UV-B treatment downregulates AtMYB4 expression and [1, 12] thus also limits AtMYB4 protein level, amplifications of MYB4-Cis1 and MYB4-Cis2 sites in ChiP DNA prepared from UV-B irradiated two-week old wild-type Arabidopsis seedlings were found to be only marginal, as observed in some initial trials. To address this point, AtMYB4 overexpressor line in wild-type Arabidopsis (Col-0) has been generated recently and following characterization, the overexpressor line will be utilized in Chip assay in future experiments to investigate the binding potentialities of AtMYB4 protein to the putative MYB4 motifs present in its own promoter under UV-B stress. To investigate whether interaction between MYB4 and the promoter proximal MYB4-binding element (ACCAAAC) of its own proter has any effect on MYB4 expression under UV-V light, a 300 bp promoter fragment of AtMYB4 from -300 to -1 was fused to 35S minimal promoter (-70) with a TATA box and the β-glucuronidase (GUS) reporter gene (pMYB435Smini:GUS). The 35S minimal promoter (-70):GUS vector (35Spmini:GUS) was used as a control. Both plasmid constructs were independently transferred into wild-type and atmyb4 leaf mesophyll protoplasts [29]. Expression of pMYB435Smini:GUS level in atmyb4 mutant was not affected under UV-B light. On the other hand, expression of pMYB435Smini:GUS was reduced to more than ~45% in the wild-type after UV-B exposure of the protoplasts (Fig 9G). Together, these results indicate that interaction of MYB4 with the promoter proximal MYB4-binding element may involve in repression of MYB4 transcription under UV-B light.

Fluorescence anisotropy analysis of the interaction of AtMYB4 with MYB4 motifs

To further validate the results of DNA binding assays involving AtMYB4 and the putative MYB4 motifs, we next carried out fluorescence anisotropy analysis. Fluorescence anisotropy provides a useful technique for analyzing the binding interaction of a fluorescently labeled oligonucleotide ligand with proteins. In general, as the interaction between a ligand and the protein increases, this reduces the rotational diffusion of the ligand and leads to increase in anisotropy [44]. In fluorescence anisotropy experiments, we have used the similar set of putative MYB4 binding motifs, MYB4-Cis1Flc (5’AACCTTCA, located at -212 position) and MYB4-Cis2Flc (5’GACCTA, located at -908 and relative to the transcription start site in AtMYB4 promoter) with fluorescein labeling at the 3’end (Table 4). As shown in Fig 10A and 10B, initially steady increase in anisotropy could be detected for both the interactions involving AtMYB4-MYB4-Cis1Flc and AtMYB4-MYB4-Cis2Flc, respectively along with the increasing concentration of AtMYB4. Thus, during the initial phase, the added protein was immediately bound to MYB4-Cis1Flc or MYB4-Cis2Flc. Subsequently, the increase in anisotropy was smaller and then reached a saturation phase or plateau. The plateau represents anisotropy of saturated AtMYB4-oligo complex. This experiment was also carried out using AtMYB4Δ1, which carries only the second N-terminal DNA binding MYB domain (devoid of the first N-terminal MYB domain) to further assess the oligo binding ability in presence of single DNA binding MYB domain (Fig 10C and 10D). In general, untreated control AtMYB4 showed higher binding affinity to both MYB4-Cis1Flc and MYB4-Cis2Flc than AtMYB4Δ1, implying the possible important role of the first N-terminal DNA binding MYB domain in regulating efficient DNA binding of the protein. However, UV-B treated AtMYB4 and AtMYB4Δ1 showed higher binding affinity for the putative MYB4 binding sites (Table 5). In addition, UV-B treated AtMYB4 and AtMYB4Δ1 showed relatively better binding affinity for MYB4-Cis1Flc. Overall, these observations have clearly indicated that the rate of MYB4 protein binding to the corresponding DNA motifs increases after UV-B treatment. This has provided one important clue for the possible mechanism of UV-B mediated transcriptional repression of AtMYB4, which may occur due to enhanced binding of AtMYB4 to the specific binding sites under prolong hour of exposure to UB-B, leading to transcriptional repression of its own expression. This assumption is consistent with the previous report which indicated compromised MYB4 transcript level in wild-type Arabidopsis under UV-B stress due to binding of MYB4 to its own promoter [12]. This data was consistent with the enhanced binding affinity of UV-B treated AtMYB4 to the MYB4 motifs as obtained in anisotropy experiments. However, further in vivo experiments are required to establish this notion.
Table 5

Fluorescence anisotropy titration of purified recombinant AtMYB4 and AtMYB4Δ1 proteins using 5 μM 3’ fluorescein tagged oligos ( and , respectively.

ProteinsOligonucleotideKD (nM)
AtMYB4 (No UV-B control)MYB4-Cis1-Flc122 ± 25
AtMYB4 + UV-B(200J/m2, 4 h)MYB4-Cis1-Flc95 ± 26
AtMYB4 (No UV-B control)MYB4-Cis2-Flc149 ± 16
AtMYB4 + UV-B(200J/m2, 4 h)MYB4-Cis2-Flc130 ± 15
AtMYB4Δ1 (No UV-B control)MYB4-Cis1-Flc260 ± 20
AtMYB4Δ1 + UV-B(200J/m2, 4 h)MYB4-Cis1-Flc150 ± 9
AtMYB4Δ1 (No UV-B control)MYB4-Cis2-Flc190 ± 17
AtMYB4Δ1 + UV-B(200J/m2, 4 h)MYB4-Cis2-Flc180 ± 16

± (Errors represent SD from triplicate measurements)

Fluorescence anisotropy titration of purified recombinant AtMYB4 and AtMYB4Δ1.

Anisotropy of 5 μM fluorescein tagged oligos ( and were used. Botholigos contained fluorescein labeling at the 3’ end (MYB4 binding motifs are underlined). The data was plotted as a function of increasing protein concentration of untreated control and UV-B AtMYB4 (A and B) and AtMYB4Δ1(C and D) proteins. UV-B dose of ~200 J/m2 for 4 h at 25°C was used. ± (Errors represent SD from triplicate measurements)

Molecular docking analysis of interaction between MYB4 and DNA binding motif

The N-terminal MYB domains of MYB transcription factor mediate the DNA-protein interactions. To further validate of the results of DNA binding activity of AtMYB4 obtained in gel shift assays, we next looked at the in silico evidence of AtMYB4 interaction with the putative MYB4 binding motif. The molecular docking model of AtMYB4 and cognate DNA segments (MYB4-Cis1 and MYB4-Cis2) interactions are shown in Fig 11A and 11E. Docking studies have revealed the propensity towards the formation of non-hydrogen bonded (hydrophobic) interactions. AtMYB4 interactions with MYB4-Cis1 and MYB4-Cis2 have shown involvement of six and three hydrogen bonded contacts, respectively (S4 Table). The average free energies of the interactions were found to be about -1095.34 Kcal/mole for MYB4-Cis1 motif and -1002.48 for MYB4-Cis2, respectively, indicating formation of thermodynamically more stable DNA-protein complex between AtMYB4 and MYB4-Cis1 than MYB4-Cis2. Furthermore, AtMYB4-MYB4-Cis1 interaction was found to be stabilized by 45 non-hydrogen-bonded hydrophobic interactions. On the other hand, about 25 non-hydrogen-bonded hydrophobic interaction points could be detected for AtMYB4-MYB4-Cis2 interaction (S4 Table). Together, these data have suggested that AtMYB4 forms more stable complex with MYB4-Cis1 than MYB4-Cis2, also consistent with the observations in gel shift assays (Fig 8). The most commonly found amino acid residues of AtMYB4 involved in the DNA binding interaction were identified to be ARG151, THR159, for DNA Chain-A and ASP194 for DNA Chain-B, respectively (S4 Table).
Fig 11

Molecular docking based interaction studies of AtMYB4 transcription factor with MYB4-Cis1 and MYB4-Cis2 cognate DNA segments.

A-D. The docked complexes showing the interactions of recombinant full length (wild-type) AtMYB4 with MYB4-Cis1 oligo (A) and three other mutant forms of MYB4-Cis1(B-D). E-H.The docked complexes of recombinant full length (wild-type) AtMYB4 with MYB4-Cis2 oligo (E) and three other mutant forms of MYB4-Cis2 (F-H). The ball and stick model of the docked complexes were generated in RasWin. The changed nucleotides in the mutant oligos are indicated in red colour. The N-terminal DNA binding region and the C-terminal domain of AtMYB4 are indicated.

Molecular docking based interaction studies of AtMYB4 transcription factor with MYB4-Cis1 and MYB4-Cis2 cognate DNA segments.

A-D. The docked complexes showing the interactions of recombinant full length (wild-type) AtMYB4 with MYB4-Cis1 oligo (A) and three other mutant forms of MYB4-Cis1(B-D). E-H.The docked complexes of recombinant full length (wild-type) AtMYB4 with MYB4-Cis2 oligo (E) and three other mutant forms of MYB4-Cis2 (F-H). The ball and stick model of the docked complexes were generated in RasWin. The changed nucleotides in the mutant oligos are indicated in red colour. The N-terminal DNA binding region and the C-terminal domain of AtMYB4 are indicated. Again, to validate MYB4 motif binding specificity of AtMYB4, we next used the mutant versions of MYB4-Cis1 (Fig 11B–11D) and MB4-Cis2 motifs in docking studies (Fig 11F–11H). The docked complex of AtMYB4 with mutant forms of MYB4 motifs showed the interaction with the oligo sequence mainly through the formation of non-hydrogen bonded hydrophobic interactions. MYB4-Cis1/m1 and MYB4-Cis2m/2 showed three hydrogen bonded interaction points along with 25 and 28 non-hydrogen bonded interactions hydrophobic. The other mutants displayed fewer hydrogen bonded (2 to 3) and hydrophobic interactions (S5 Table). In addition, the average free energies of the interactions were found to be within the range of -552.34 to -567.64 Kcal/mole, respectively, indicating thermodynamically less stable interactions. Together, these results have demonstrated formation of weak complex in the interactions involving AtMYB4 and mutant versions of MYB4 motifs. These observations have also supported the binding specificity of AtMYB4 and consistent with the results obtained in DNA binding assays using mutant forms of MYB4 motifs (Fig 9A and 9B).

Conclusion

As an integral part of plant response to environmental stress, among the different types of secondary metabolites produced in plants after UV-B irradiation, flavonoids play key role in UV-B protection by acting as UV-B absorbing sunscreen compounds. The R2R3-MYB subgroup 4 comprises of 4 members, namely, MYB3, MYB4, MYB7 and MYB32 [13]. Three members of the R2R3-MYB subgroup 4 transcription factors, including MYB4, MYB7 and MYB32 act as repressor of phenylpropanoid pathway [5, 12, 46]. MYB4 shows responsiveness to UV-B irradiation and involved in repression of phenylpropanoid pathway through regulation of expression of C4H gene in wild type Arabidopsis [1, 12]. Thus, myb4 knockout mutant showed enhanced tolerance to UV-B light than wild-type Arabidopsis due to increased accumulation of hydroxycinnamate esters. It was also shown that AtMYB4 overexpression in wild-type Arabidopsis caused compromised accumulation of cinnamate esters and leads to hypersensitivity to UV-B light. Again, myb4 loss-off-function mutant showed marginal effect in relation to expression of chalcone synthase (CHS) and flavonoid accumulation [12]. However, upon UV-B light, MYB protein has been shown to repress its own expression via binding to its own promoter [1, 12]. Further studies have shown interaction of MYB4 via its C-terminal GY/FDFLGL motis with SAD2 (an importin β-like protein), which facilitates nuclear trafficking of MYB4 protein for transcriptional repression of its target genes of phenylpropanoid pathway. However, earlier studies did not address whether UV-B light affect the binding potential of MYB4 to its own promoter. Moreover, although earlier studies have shown that C-terminal domain of MYB4 participates in protein-protein interactions [1, 2], the relative contribution of the N-terminal DNA binding MYB domains on the overall stability of MYB4 protein remains unclear. Also, not much is known about the structural stability of MYB4 protein under UV-B. In the present study, we have investigated the changes in the overall folding/unfolding characteristics, thermodynamic stability, changes in the secondary structural components and possibility of aggregation of purified recombinant AtMYB4 protein in vitro following UV-B exposure. We performed tryptophan fluorescence analysis of recombinant wild type and N- terminal detection forms of AtMYB4 which revealed important role of N-terminal DNA binding MYB domain, more specifically the second MYB domain in maintaining the microenvironment of tryptophan residues of the overall protein structure. CD spectral analysis of untreated control and UV-B irradiated proteins indicated considerable change in the secondary structural element in AtMYB4Δ2 protein due to UV-B exposure, further suggesting importance of N-terminal DNA binding region in the regulation of structural conformation of AtMYB. Again, urea induced unfolding assays and in-vitro aggregation studies indicated that recombinant AtMYB4 and even AtMYB4Δ1 protein remain relatively unaffected by UV-B light. However, AtMYB4Δ2 showed considerable change in secondary structure with higher propensity of aggregation in vitro following exposure to UV-B light. Together, these results have suggested that the N-terminal 62–116 amino acid residues constituting the second MYB domain plays an important role in maintaining the stability of the C-terminal region of the protein and the overall stability of the protein under UV-B light. Analysis of AtMYB4 promoter, DNA binding assays, fluorescence anisotropy and molecular docking analysis have provided important information on the binding activity of AtMYB4 to the putative MYB4 motif ACCAAAC located in the promoter proximal region of AtMYB4 promoter (-212 position). Fluorescence anisotropy experiments using untreated control and UV-B exposed recombinant AtMYB4 protein and molecular docking analysis using wild type and mutant versions of MYB4-binding elements have indicated binding specificity of AtMYB4 to the promoter proximal (-212 position) MYB4 motif (ACCAAAC). Together, these observations have suggested possible role of the promoter proximal MYB4-binding element in the regulation of AtMYB4 expression under UV-B light. However, additional in vivo study is required for elucidation of more detailed mechanism of UV-B mediated regulation of MYB4 and its target in the context of UV-B response in plants.

Methods.

(DOC) Click here for additional data file.

Results.

(DOC) Click here for additional data file.

Identification of best 100 homologues of AtMYB4 from various other plant genomes using the protein sequence ATMYB4 at NCBI BLAST.

(DOC) Click here for additional data file.

Genome wide scans for identification of MYB4 binding motifs in various gene promoters.

(DOC) Click here for additional data file.

Acrylamide and KI quenching constants (KSV) of control and UV-B irradiated purified recombinant AtMYB4 and the N terminus deletion forms of the protein.

(DOC) Click here for additional data file.

AtMYB4-MYB4- Cis1 and AtMYB4–MYB4-Cis-2 binding.

Amino acid residues involved in non-bonded contacts/Hydrophobic interaction. (XLSX) Click here for additional data file.

Interactions involving AtMYB4 and mutant forms of MYB4-Cis1 and MYB4-Cis2.

Amino acid residues involved in Non-bonded contacts/Hydrophobic interactions. (XLSX) Click here for additional data file.

Schematic representation of domain organization of Arabidopsis thaliana MYB4 transcription factor.

(TIF) Click here for additional data file.

Multiple sequence alignments of AtMYB4 protein with the homologous sequences from other higher plant genomes.

(DOCX) Click here for additional data file.

Structural and phylogenetic features of AtMYB4.

(TIF) Click here for additional data file.

Quenching of intrinsic tryptophan fluorescence of recombinant AtMYB4, AtMYB4Δ1 (Del1) and AtMYB4Δ2 (Del2) by acrylamide and iodide.

(TIF) Click here for additional data file. A and B. Per residue tryptophan fluorescence spectra showing UV-B mediated oxidative degradation of tryptophan residues to N-formylkynurenine in AtMYB4, AtMYB4Δ1 and AtMYB4Δ2 proteins under control condition (A) or following UV-B exposure for 4 h (B). (TIF) Click here for additional data file.

Nucleotide sequence of AtMYB4 promoter.

(TIF) Click here for additional data file.
  43 in total

1.  The Protein Data Bank.

Authors:  H M Berman; J Westbrook; Z Feng; G Gilliland; T N Bhat; H Weissig; I N Shindyalov; P E Bourne
Journal:  Nucleic Acids Res       Date:  2000-01-01       Impact factor: 16.971

2.  Modeling and optimization of rotational C-arm stereoscopic X-ray angiography.

Authors:  A S Talukdar; D L Wilson
Journal:  IEEE Trans Med Imaging       Date:  1999-07       Impact factor: 10.048

Review 3.  Multifunctionality and diversity within the plant MYB-gene family.

Authors:  H Jin; C Martin
Journal:  Plant Mol Biol       Date:  1999-11       Impact factor: 4.076

Review 4.  Effects of ultraviolet radiation on plant cells.

Authors:  F Hollósy
Journal:  Micron       Date:  2002       Impact factor: 2.251

Review 5.  The R2R3-MYB gene family in Arabidopsis thaliana.

Authors:  R Stracke; M Werber; B Weisshaar
Journal:  Curr Opin Plant Biol       Date:  2001-10       Impact factor: 7.834

6.  UCSF Chimera--a visualization system for exploratory research and analysis.

Authors:  Eric F Pettersen; Thomas D Goddard; Conrad C Huang; Gregory S Couch; Daniel M Greenblatt; Elaine C Meng; Thomas E Ferrin
Journal:  J Comput Chem       Date:  2004-10       Impact factor: 3.376

7.  Chromatin techniques for plant cells.

Authors:  Chris Bowler; Giovanna Benvenuto; Pierre Laflamme; Diana Molino; Aline V Probst; Muhammad Tariq; Jerzy Paszkowski
Journal:  Plant J       Date:  2004-09       Impact factor: 6.417

8.  Estimation of the number of alpha-helical and beta-strand segments in proteins using circular dichroism spectroscopy.

Authors:  N Sreerama; S Y Venyaminov; R W Woody
Journal:  Protein Sci       Date:  1999-02       Impact factor: 6.725

9.  Transcriptional repression by AtMYB4 controls production of UV-protecting sunscreens in Arabidopsis.

Authors:  H Jin; E Cominelli; P Bailey; A Parr; F Mehrtens; J Jones; C Tonelli; B Weisshaar; C Martin
Journal:  EMBO J       Date:  2000-11-15       Impact factor: 11.598

10.  Role of ATP on the interaction of alpha-crystallin with its substrates and its implications for the molecular chaperone function.

Authors:  Ashis Biswas; Kali P Das
Journal:  J Biol Chem       Date:  2004-07-30       Impact factor: 5.157

View more
  2 in total

1.  The N-terminal MYB domains affect the stability and folding aspects of Arabidopsis thaliana MYB4 transcription factor under thermal stress.

Authors:  Mehali Mitra; Puja Agarwal; Sujit Roy
Journal:  Protoplasma       Date:  2021-01-05       Impact factor: 3.356

2.  An MKP-MAPK protein phosphorylation cascade controls vascular immunity in plants.

Authors:  Hui Lin; Muyang Wang; Ying Chen; Kinya Nomura; Shugang Hui; Jinshan Gui; Xiawei Zhang; Yue Wu; Jiyun Liu; Qun Li; Yiwen Deng; Laigeng Li; Meng Yuan; Shiping Wang; Sheng Yang He; Zuhua He
Journal:  Sci Adv       Date:  2022-03-09       Impact factor: 14.136

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.