Coordinate regulation of the expression of SdsR toxin and its downstream pphA gene by RyeA antitoxin in Escherichia coli.

In Escherichia coli, SdsR and RyeA, a unique pair of mutually cis-encoded small RNAs (sRNAs), act as toxin and antitoxin, respectively. SdsR and RyeA expression are reciprocally regulated; however, how each regulates the synthesis of the other remains unclear. Here, we characterized the biosynthesis of the two sRNAs during growth and investigated their coordinate regulation using sdsR and ryeA promoter mutant strains. We found that RyeA transcription occurred even upon entry of cells into the stationary phase, but its apparent expression was restricted to exponentially growing cells because of its degradation by SdsR. Likewise, the appearance of SdsR was delayed owing to its RyeA-mediated degradation. We also found that the sdsR promoter was primarily responsible for transcription of the downstream pphA gene encoding a phosphatase and that pphA mRNA was synthesized by transcriptional read-through over the sdsR terminator. Transcription from the σ70-dependent ryeA promoter inhibited transcription from the σS-dependent sdsR promoter through transcriptional interference. This transcriptional inhibition also downregulated pphA expression, but RyeA itself did not downregulate pphA expression.

Introduction

There are over 100 noncoding small RNAs (sRNAs) in Escherichia coli[1-7]; these can be divided into two categories: cis-acting and trans-acting. Cis-acting sRNAs, which are cis-encoded, act as antisense RNAs because they bind to sense mRNAs transcribed on the opposite DNA strand, thereby up- or downregulating their expression[8-10]. Trans-acting sRNAs have been widely studied and shown to regulate target mRNAs by base pairing with them through seed regions, usually with the help of the RNA-binding protein Hfq[11-13]. A single trans-acting sRNA can affect a variety of physiological events by interacting with multiple target mRNAs[6,11,14-17]. Therefore, sRNAs play a pivotal role in coordinating various aspects of cellular metabolism by fine-tuning the expression of their target genes.

Two sRNAs, SdsR and RyeA, have a number of characteristics that make them unique. They are cis-encoded sRNAs for each other[4,18-20], while SdsR also function as a trans-acting sRNA[18,21]. SdsR acts as a regulator of multiple mRNAs by base-pairing with tolC, mutS, and yhcB in E. coli[18,22,23], and with several mRNAs, including ompD, in Salmonella[21,24]. Unlike SdsR, RyeA has not yet been reported to function as a trans-acting sRNA. Recently, our group showed that SdsR and RyeA act as toxin and antitoxin, respectively[18]. The toxin function of SdsR is mediated by repression of yhcB encoding an inner membrane protein, which is involved in cell envelope biogenesis and cell shape maintenance[25-27]. Since both the toxin and antitoxin are sRNAs, the SdsR/RyeA pair represents a novel type of toxin-antitoxin system.

SdsR and RyeA show reciprocal expression patterns[18]. RyeA expression is dominant in the mid-exponential phase, whereas SdsR expression becomes higher starting from the late exponential phase to the stationary phase[4]. Therefore, SdsR, as an RpoS-dependent sRNA, is highly expressed during the stationary phase, but is barely expressed in the exponential phase.

The pphA gene, downstream of sdsR, encodes a phosphatase, also called PrpA, that is similar to Salmonella PrpA[28] and λ-PP, a phosphoprotein phosphatase of bacteriophage lambda[29]. PphA plays a role in the protein misfolding response pathway by positively modulating the CpxR/CpxA two-component system, which activates htrA transcription[30]. It is likely that there are other target proteins of PphA because additional phosphoproteins accumulate in a pphA mutant[30]. It has been reported that pphA transcription is induced by heat shock and that its promoter, which is located far upstream of the sdsR promoter[30], has some homology to the promoter consensus sequences of RNA polymerase σ32-holoenzyme (Eσ32). However, a subsequent study suggested that pphA may not be heat-shock inducible[31]. Expression of pphA is also induced during biofilm formation and upon urea stress[32,33]. Therefore, it remains unclear how pphA expression is regulated.

In this study, we examined biosynthesis of the two sRNAs during growth and coordinate regulation of SdsR toxin and its downstream pphA gene by RyeA. We found that both SdsR and pphA expression are under control of the sdsR promoter and tightly down-regulated during exponential growth by expression of ryeA.

Results

Biosynthesis of SdsR and RyeA

As there has been some confusion in the literature regarding biosynthesis of SdsR and RyeA in E. coli[4,15,16,19], we set to clarify their biosynthesis. To determine the precise transcription initiation sites from each promoter, we subcloned the sdsR (−79 to +11 relative to its transcription start site) and ryeA (−80 to +10 relative to its most downstream transcription start site) promoter-containing DNA fragments to plasmid pKK232-8 to generate ryeA-CAT and sdsR-CAT transcriptional fusions, respectively. We then analyzed sdsR-CAT and ryeA-CAT fusion transcripts using primer extension (Fig. 1A,B). An analysis of primer extension products revealed that the sdsR promoter starts transcription at a site 1 nt downstream of the previously reported 5′ end of E. coli SdsR, which corresponds to the 5′ end of Salmonella SdsR[34]. On the other hand, the ryeA promoter starts transcription at three sites, of which the most downstream site is the previously predicted 5′ end. In parallel, we performed 5′ RACE experiments using total cellular RNAs with or without the E. coli RNA pyrophosphatase (RppH) treatment and the RACE products were analyzed on an agarose gel (Fig. 1C). The predicted RyeA band () was detected at comparable amounts in both RppH-treated and untreated RNAs, whereas the predicted SdsR band () was observed only in RppH-treated RNA. These results suggest that RyeA and SdsR have different phosphorylation status at the 5′ end: SdsR retains 5′ triphosphate, but RyeA carries 5′ monophosphate. Each RACE band (the corresponding gel area of band was used for SdsR in RppH-untreated RNA) was eluted from the gel and subjected to DNA sequencing analysis (Table 1). The 5′ end of SdsR, observed with RppH-treated RNA, not RppH-untreated, corresponds to its transcription start. On the other hand, RyeA showed only one 5′ end corresponding to its most downstream transcription start site regardless of being treated with RppH. These results suggest that while SdsR has a triphosphate at the 5′ end as a primary transcript, RyeA largely exists as a single processed transcript with a monophosphate at the 5′ end, which could be formed by removing 1 or 2 nucleotides, or pyrophophate from three different primary RyeA transcripts.

Figure 1

Identification of 5′ and 3′ ends of RyeA and SdsR. (A) Schematic representation of the region containing the sdsR/ryeA locus and its nucleotide sequence. Promoter regions (−35 and −10) of sdsR and ryeA are underlined, and their transcription start sites are indicated by arrows. (B) Primer extension analysis of ryeA-CAT and sdsR-CAT fusion transcripts. The regions +341 to +132 (containing the ryeA promoter) and −79 to +11 (containing the sdsR promoter) were cloned into pKK232-8 to generate ryeA-CAT and sdsR-CAT plasmids, respectively. Total cellular RNA extracts were prepared from either MG1655 cells containing the ryeA-CAT or sdsR-CAT plasmid grown for 2 h, 6 h, or 10 h at 37 °C. The 32P-labeled primer CAT_R was used to analyze ryeA-CAT and sdsR-CAT fusion transcripts. Primer extension products were analyzed on a 5% polyacrylamide sequencing gel containing 8 M urea. The DNA ladders (G, A, T and C) were prepared by dideoxy sequencing using the template plasmid DNA and the same primer. Loading amounts are indicated below the lanes. The transcription start nucleotides are indicated by arrows. (C) RACE analysis. The 5′ or 3′ RACE products (primary PCR products or nested PCR products) were analyzed on 2% agarose gels. Predicted RACE products were indicated by , , , and . For 5′ RACE, E. coli RNA pyrophosphatase (RppH)-treated RNA and untreated RNA were used. M, 100 bp size markers; R, RyeA; S, SdsR.

Table 1

Determination of 5′ and 3′ ends of SdsR and RyeA.

		SdsRa	RyeAa
5′ ends of RNAb	−RppHc	+3 (1), +31 (2), +32 (1), +34 (1), NDd (5)	+1 (11), +33 (1), +36 (3), NDd (5)
	+RppHc	+1(6), +3(1), +31(1), NDd (2)	+1 (17), +25 (1), +36 (1), NDd (1)
3′ ends of RNAb		+100 (3), +101 (10), +102 (2), NDd (5)	+261 (1), +263 (7), +269 (3), +270 (9)

aThe RACE products a and b shown in Fig. 1C and c and d in Fig. 1D were cloned by T-blunt vector and analyzed by DNA sequencing. In case of SdsR in RppH-untreated RNA, the corresponding gel area of band b was used for analysis.

bThe positions of both ends at which each RNA terminates are represented relative to the transcription start for SdsR and the most downstream transcription start for RyeA. The numbers in parentheses indicate the frequency of occurrence.

cUntreated and treated with RppH are indicated by − RppH and + RppH, respectively.

dND, non-detectable.

The 3′ ends of SdsR and RyeA were analyzed by 3′ RACE (Fig. 1C and Table 1). A sequence analysis of RACE products suggested that SdsR has heterogeneous 3′ ends that terminate at base positions ranging from +100 to +102 relative to its own transcription start site, whereas RyeA has 3′ ends of +261 to +270 relative to the most downstream transcription start site.

In vitro transcription was carried out to determine whether the 3′ ends of SdsR and RyeA correspond to their transcription termini. Plasmid DNA, pSdsR(−379/+222), containing an sdsR/ryeA transcription unit consisting of −379 to +222 relative to the sdsR transcription start site was used as a template for in vitro transcription assays (Fig. 2A). Since the sdsR promoter is known to be σS-dependent[24], we used both RNA polymerase σS-holoenzyme (EσS) and Eσ70. As shown in the left half gel of Fig. 2B,C, Eσ70 in the absence of EσS (Eσ70/EσS, 1/0) generated almost exclusively RyeA transcripts although it transcribed sdsR at about 10% levels as compared to the RyeA transcripts. On the other hand, EσS alone (Eσ70/EσS, 0/1) produced only SdsR transcripts without generating RyeA transcripts. These results suggest that transcription of sdsR is mostly mediated by EσS, but that ryeA transcription are mediated solely by Eσ70. SdsR transcripts of ~100 nt and RyeA transcripts of ~270 nt were detected, indicating that SdsR and RyeA observed in vivo are primary transcripts and their 3′ termini are generated by Rho-independent termination. We also found a read-through transcript of ~310 nt that passes over the sdsR terminator and terminates at the following rnpB terminator[35], suggesting that genes downstream of sdsR could be regulated by sdsR transcription.

Figure 2

In vitro transcription of the sdsR/ryeA locus. (A) Schematic representation of DNA template used for in vitro transcription. The sdsR region of −379 to +222 in the sdsR promoter-rnpB terminator fusion plasmids was shown. Termination sites are indicated by T. (B) In vitro transcription was performed using different ratio of Eσ70 and EσS on the sdsR(−379/+222) and sdsR(−379/+222ryeAP)-carrying plasmids. The DNA template with the ryeA promoter mutation is shown as −379/+222ryeAP. In vitro transcribed RNAs were subjected to Northern blot analysis. The membrane was probed with an anti-RyeA probe for RyeA signals. Then the membrane was briefly washed and reprobed with an anti-SdsR probe without stripping. The asterisks indicate the remaining RyeA signals in the anti-SdsR probed membrane. (C) Northern band signals were presented in a line graph along the x-axis with increasing the ratio of EσS to Eσ70. Relative band intensities of each RNA species are expressed as a ratio to the intensities of the corresponding RNA species transcribed solely by EσS.

Regulation of SdsR and RyeA biosynthesis

To determine the effects of SdsR on the biosynthesis of RyeA, or vice versa, we constructed sdsR and ryeA promoter mutant strains in which their −10 elements were inactivated by changing each of them to CTCGAG. We then examined levels of SdsR and RyeA in the promoter mutant cells during growth (Figs 3 and S1). As expected, SdsR and RyeA were not detected in the sdsR and ryeA promoter mutant strains, respectively (Fig. 3A). In wild-type cells, RyeA was expressed during the early exponential phase, and its expression sharply decreased in the mid-exponential phase. The sdsR promoter mutation increased RyeA synthesis during the exponential phase and allowed its continued synthesis in the stationary phase. On the other hand, SdsR expression started in the late-exponential phase in wild-type cells, but appeared at an earlier stage in ryeA promoter mutant cells (Fig. 3B). Since the larger ryeA covers the entire sdsR, the whole 104-nt SdsR sequence can base-pair with RyeA. We performed analysis of mutual degradation to determine whether interaction between two sRNAs leads to degradation of each other (Fig. S2). We ectopically co-expressed both SdsR and RyeA, but expression of SdsR was increased at a fixed expression level of RyeA, or vice versa. We found that when one is overexpressed, degradation of the other is facilitated, suggesting that this extensive base-pairing leads to degradation of both sRNAs. Because SdsR and RyeA are degraded each other, it is likely that the early appearance of SdsR in ryeA promoter mutant cells and the prolongation of RyeA expression to the stationary phase in sdsR promoter mutant cells are attributable to the absence of mutual degradation of the two sRNAs. The lack of RyeA degradation products of about 60 nt in sdsR promoter mutant cells further supports reciprocal regulation of the two sRNAs through degradation of each other. This mutual degradation could serve to further restrict RyeA expression to the exponential phase and SdsR expression to the stationary phase.

Figure 3

Reciprocal regulation of RyeA and SdsR. (A) Effects of the sdsR promoter mutation on RyeA and vice versa. Analysis of cellular levels of SdsR and RyeA during growth. Overnight cultures were diluted 1:100 in LB medium and grown at 37 °C. Aliquots of cells were sampled from the cultures at specific time intervals and total cellular RNAs were isolated. Cellular levels of SdsR and RyeA were analyzed by Northern blotting. The membrane was probed with an anti-RyeA probe for RyeA signals. Then the membrane was briefly washed and reprobed with an anti-SdsR probe wiout stripping. SdsR(p), the processed form of SdsR. RyeA(d), a degradation product of RyeA. 5 S, 5 S rRNA. The asterisks indicate the remaining RyeA signals in the anti-SdsR probed membrane. (B) Relative band intensities of each RNA are shown with growth times. Relative amounts of RyeA or SdsR are represented as arbitrary units after normalization of the corresponding Northern signals to 5 S rRNA. Cell growth was monitored by measuring optical density (OD) at 600 nm. The change of RyeA expression by the sdsR promoter mutation or SdsR expression by the ryeA promoter mutation is indicated by an arrow. WT, MG1655 cells; sdsRP, sdsR −10 promoter mutant cells; ryeAP, ryeA −10 promoter mutant cells (mean ± SD; n = 3).

The tight growth phase-specific control of SdsR and RyeA may be needed for SdsR- or RyeA-mediated regulation of certain genes in specific growth phases. To identify such genes, we performed an RNA-seq analysis of ryeA and sdsR promoter mutant cells as well as wild-type cells. For this RNA-seq analysis, cultures were sampled in both the exponential phase (3 h) and stationary phase (8 h), and genes in sdsR or ryeA promoter mutant cells that showed a greater than 2-fold change and a p-value < 0.05 were selected for further characterization. We identified 17 genes (7 upregulated and 10 downregulated) in the exponential phase and 5 genes (2 upregulated and 3 downregulated) in the stationary phase for ryeA promoter mutant cells (Tables S1 and S2). In contrast, sdsR promoter mutant cells showed many changed genes: 171 genes (110 upregulated and 51 downregulated) in the exponential phase and 55 genes (33 upregulated and 22 downregulated) in the stationary phase (Tables S3–5). Selected genes were confirmed by qRT-PCR analysis (Table S6), which showed that RNA-seq data were reliable. A Gene Ontology (GO) analysis showed that many of the genes that were altered by the sdsR promoter mutation, either downregulated or upregulated, were related to transport function and encoded membrane proteins (Fig. S3), an observation consistent with previous RNA-seq analysis of SdsR-overexpressing cells[18].

As expected, the RNA-seq data revealed upregulation of RyeA and SdsR in sdsR and ryeA promoter mutant cells, respectively (Fig. 4A,B). We also examined the RNA-seq data to see how expression of known SdsR target genes is affected by the sdsR or ryeA promoter mutation (Table S7). The sdsR promoter mutation increased tolC and yhcB expression by about 2-fold in the stationary phase and exponential phase, respectively. In contrast, the ryeA promoter mutation led to a slight decrease in tolC and yhcB expression, suggesting that RyeA can modulate SdsR-mediated gene regulation. However, mutS, another target for SdsR[18,22,23], did not show gene expression profiles that would be expected from sdsR or ryeA promoter mutant cells, implying that it may not be a primary target of SdsR.

Figure 4

Analysis of RyeA, SdsR, and pphA RNA expression. Expression dynamics of SdsR and pphA mRNA in ryeA promoter mutant cells. (A,B) Read counts for RyeA and SdsR from RNA-seq data are plotted against ryeA and sdsR chromosomal positons. WT, MG1655 cells; ryeAP, ryeA promoter mutant cells; sdsRP, sdsR −10 promoter mutant cells. E, exponential phase cells (3 h post-inoculation); S, stationary phase cells (8 h post-inoculation). (C) RNA read counts for pphA mRNA are plotted against pphA chromosomal positons. Since a specific region of higher RNA-seq reads is AU-rich, the higher efficiency of random reverse transcription priming on the AU-rich sequence may cause that transcript depth. (D) qRT-PCR analysis of changes in pphA mRNA levels by the ryeA or sdsR −10 promoter mutation. Total cellular RNAs were isolated from WT and the promoter mutant cells at 8 h post-inoculation, and subjected to qRT-PCR. Fold changes relative to WT cells are shown. (E) The same total RNAs were subjected to RT-PCR. RT-PCR products were analyzed in a 2% agarose gel. In (D), mean ± SD; n = 5–6; *P ≤ 0.05, **P ≤ 0.001 by Student’s t-test.

Interestingly, the RNA-seq data showed that the pphA gene, downstream of sdsR, was downregulated in sdsR promoter mutant cells and upregulated in ryeA promoter mutant cells (Fig. 4C). An analysis of pphA expression by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and semi-quantitative RT-PCR confirmed the same downregulation in sdsR promoter mutant cells and upregulation in ryeA promoter mutant cells (Fig. 4D,E). These data indicate that pphA expression may be regulated by the sdsR/ryeA regulatory circuit.

pphA is co-transcribed with SdsR from the sdsR promoter

The previously reported pphA promoter, located about 180 bp upstream of the sdsR promotor, is known as a heat-shock promoter[30]. Therefore, transcription from this promoter should pass through the sdsR/reyA locus to transcribe the pphA gene; furthermore, the sdsR promoter can generate pphA transcripts. To determine which promoter makes the greater contribution to pphA expression, we constructed various transcriptional sdsR-lacZ fusions and analyzed their transcriptional activities using LacZ assays (Fig. 5). The promoter region containing a DNA fragment 200 bp upstream and 100 bp downstream (−379 to −170 relative to the 5′ end of SdsR) from the previously known pphA transcription site showed little LacZ activity at 37 °C and even at 42 °C. However, a promoter region extended to include the sdsR/ryeA locus (+222) exhibited high LacZ activity at 37 °C that was not significantly further increased at 42 °C. Therefore, it is unlikely that the previously reported heat inducible pphA promoter is responsible for the observed LacZ activity of the −379/+222 construct. Furthermore, the sdsR promoter mutation sharply decreased the LacZ activity of sdsR(−379+222)-lacZ, indicating that the sdsR promoter is a major contributor to pphA transcription. The −329 to +222 promoter region was fused to the CAT gene in plasmid pKK232-8 and the 5′ ends of the fused mRNA, transcribed in vivo, were analyzed by primer extension analysis (Fig. S4). Most extension products were from sdsR transcripts, and no extension products from the reported pphA promoter were detected. These data, taken together with in vitro data showing read-through transcripts traversing the sdsR terminator (Fig. 2B), suggest that the sdsR promoter rather than the previously reported pphA promoter is responsible for pphA transcription.

Figure 5

LacZ analysis for sdsR and pphA transcription. (A) Schematic diagrams of various sdsR-lacZ transcriptional fusion constructs are shown along with their LacZ activities for DJ480ΔryeA/sdsR cells grown for 2 h (E) and 10 h (S) post-inoculation at 37 °C or 42 °C. sdsRP, sdsR −10 promoter mutation; ryeAP, ryeA −10 promoter mutation. (B,C) The LacZ activities are presented in bar graph (mean ± SD; n = 3).

Effects of ryeA transcription on expression of SdsR and sdsR-pphA dicistronic mRNA

Next, we examined whether ryeA transcription affected pphA expression using the ryeA promoter mutant. To avoid possible effects of chromosomally expressed SdsR and RyeA, we constructed the sdsR-lacZ fusions in an sdsR/ryeA-knockout background. The LacZ activity of the sdsR(−379/+222)-lacZ fusion was increased by about 4-fold by the ryeA promoter mutation (Fig. 5). This increase could be attributable to the absence of RyeA (acting in trans) or ryeA transcription itself (acting in cis). To discriminate between these two possibilities, we analyzed LacZ activity following ectopic expression of RyeA. To determine conditions for ectopically expressing RyeA at levels comparable to those generated by the endogenous ryeA promoter, we varied the concentration of isopropyl β-D-1-thiogalactopyranoside (IPTG) used to induce expression (Fig. 6A). We found that RyeA levels induced by 0.005 mM IPTG were comparable to those produced by the ryeA promoter. Induction of RyeA caused no decrease in LacZ activity (Fig. 6B), suggesting that the absence of RyeA is not responsible for the increase in LacZ activity. Therefore, it is likely that ryeA transcription, not RyeA, inhibits pphA expression by reducing read-through transcription from the sdsR promoter. Then we examined how ryeA transcription affects the read-through transcription during the growth using the sdsR(−379/+222)-lacZ fusion. We found that the ryeA transcription represses LacZ expression at all growth phases and delays its expression 3 h to the stationary phase (Fig. S5). To further confirm that read-through transcripts are increased by the ryeA mutation, we inserted a Brevibacterium albidum tRNAArg sequence between the sdsR sequences and the CAT coding sequence in the sdsR-CAT fusion constructs and examined exogenous tRNA expression as well as SdsR in an sdsR/ryeA-knockout background (Fig. 7). The reason that we used heterologously expressed B. albidum tRNAArg, was because the tRNA was previously shown to be metabolically stable in E. coli and detectable by Northern blot analysis without cross-hybridization with E. coli tRNAs[36]. The ryeA promoter mutation caused an increase in tRNAArg expression, confirming that the ryeA mutation increases read-through transcription. Taken together, these data show that pphA expression is inhibited by ryeA transcription itself, and not by RyeA.

Figure 6

Effects of RyeA on sdsR transcription. (A) Ectopically expressed RyeA in DJ480ΔryeA/sdsR cells carrying the sdsR(−379/+222)-lacZ or sdsR(−379/+222ryeAP)-lacZ fusion were analyzed. Total cellular RNAs from pRyeA-containing cells induced with different IPTG concentration were analyzed by Northern blotting. pRyeA, RyeA-expressing plasmid derived from vector pHM4T. (B) LacZ activities were measured in cells ectopically expressing RyeA by induction with 0.005 mM IPTG. Exponential (E) and stationary (S) phase cells (grown for 2 h and 10 h, respectively) were used for LacZ assays (mean ± SD; n = 3).

Figure 7

Analysis of read-through transcripts traversing the sdsR terminator. (A) Schematic representation of sdsR-tRNAArg-CAT fusion plasmids. The B. albidum tRNAArg gene was inserted in the region before the CAT gene of pKK232-8 plasmid. (B) Northern blot analysis of Arg-tRNA, RyeA, and SdsR. Total cellular RNA from cells carrying the sdsR(−379/+222)-tRNAArg-CAT or sdsR(−379/+222ryeAP)-tRNAArg-CAT fusion plasmid were isolated and analyzed by Northern blotting. In each panel the spliced images from the same Northern membrane are shown with the insertion of a dividing lines between the spliced lanes.

To examine whether the increase in read-through transcripts was caused by reduced termination efficiency at the sdsR terminator, we introduced a terminator mutation into the sdsR(−79/+222)-lacZ fusion (Fig. 8). This terminator mutation did not affect the ryeA promoter mutation-induced increase in LacZ activity, suggesting that the increase in read-through transcripts caused by the ryeA promoter mutation does not result from reduced termination efficiency. Therefore, it seems likely that transcription from the ryeA promoter interferes with transcription of sdsR.

Figure 8

sdsR terminator-independency of transcriptional interference between the sdsR and ryeA promoter. (A) Schematic diagrams of sdsR(−79/+222)-lacZ transcriptional fusion constructs are shown along with their LacZ activities for DJ480ΔryeA/sdsR cells grown for 2 h (E) and 10 h (S) post-inoculation at 37° (B) The LacZ activities are presented in bar graph. sdsRT, sdsR terminator mutation; ryeAP, ryeA −10 promoter mutation (mean ± SD; n = 3).

Because it is known that transcriptional interference can occur in DNA constructs with convergent promoters[37], we examined the existence of transcriptional interference with respect to ryeA transcription using in vitro transcription assays using pSdsR(−379/+222) carrying the ryeA promoter and its ryeA promoter mutant derivative, pSdsR(−379/+222ryeAP) (Fig. 2). For these assays, we used different ratios of Eσ70 and EσS. As expected, the increased ratio of EσS/Eσ70 increased SdsR and its read-through transcripts (SdsR-rnpB) with the decrease of RyeA (Fig. 2B,C), which may be reminiscent of their reciprocal synthesis during growth. The ryeA promoter mutation increased both SdsR and read-through transcripts, producing the highest increase in levels at an Eσ70 to EσS ratio of 1:9 (Fig. 2B), which may be similar to that in the stationary phase in vivo.

Transcriptional interference can be due to promoter occlusion, colliding RNA polymerases, or transcription-induced changes in DNA supercoiling that affect initiation of transcription. Promoter occlusion is not likely because the two promoters are far apart. We tested whether positive supercoiling induced by transcription from the ryeA promoter could affect transcription from the sdsR promoter. For this purpose, we treated cells with novobiocin, a gyrase subunit B inhibitor. Growth of E. coli cells was inhibited by novobiocin with a 50% inhibitory concentration (IC50) of 100 μg/ml (Fig. S6A). We examined effects of ryeA transcription on sdsR transcription in the presence of novobiocin at 100 μg/ml (Fig. S6B). Since SdsR levels could be affected by RyeA in trans, we analyzed the novobiocin effects in LacZ activity from sdsR(−379/+222)-lacZ fusion rather than those in SdsR levels. Novobiocin had little effect on the increase of LacZ activity by the ryeA mutation, suggesting that transcription-induced changes in DNA supercoiling contribute little to the observed transcriptional interference. On the other hand, when we examined the ryeA and sdsR promoter activities during growth using lacZ transcriptional fusions, the ryeA and sdsR promoters showed transcription activities in all the growth phases, although ryeA promoter is more active in the exponential phase than the sdsR promoter (Fig. S7). These results altogether suggest the possibility that two oppositely transcribing RNA polymerases collide in the cell. Therefore, it seems likely that ryeA transcription inhibits transcription from the sdsR promoter through transcriptional interference, which may occur by RNA polymerase collision sometime between RNA polymerase binding to the sdsR promoter and the transcription elongation step up until the RNA polymerase reaches the ryeA promoter by collision between oppositely transcribing RNA polymerases.

Discussion

In this study, we first defined the transcription units and biogenesis of sdsR and ryeA in more detail, showing that 3′ ends of both SdsR and RyeA correspond to their own transcription termini. We identified three transcription initiation start sites from the ryeA promoter. The primary ryeA transcripts are trimmed at the 5′ end to form processed RNAs with 5′ monophosphate whose 5′ end corresponds to the most downstream transcription start, which can generate RyeA of 272 nt with the longest 3′ end. On the other hand, the 5′ end of SdsR, which is the same as the sdsR transcription initiation site, retains triphosphate. This may explain that RyeA has a much shorter half-life than SdsR in the cell[18] because RNA with 5′ monophosphate is more vulnerable to degradation than RNA with 5′ triphosphate[38]. The transcription of sdsR terminates at base positions ranging from +100 to +102 relative to its own transcription start site, generating the longest SdsR (102 nt) in the cell.

RyeA is expressed in the exponential phase, whereas SdsR expression starts in late-stationary phase. Since we showed here that RyeA and SdsR are almost exclusively transcribed in vitro by Eσ70 and EσS, respectively, acting at their respective promoters, the growth-dependent regulation of RyeA and SdsR should be mediated by the sigma factor selectivity of the two promoters. Promoter mutation analyses revealed that mutual degradation of SdsR and RyeA also contributes to discrete growth phase-dependent regulation of the expression of each sRNA. Furthermore, RyeA transcription can interfere with SdsR transcription, generating less SdsR when RyeA transcription occurs. As a result of this biosynthetic pathway, more restricted stationary phase expression of SdsR can be achieved through the coupled action of degradation of SdsR by RyeA expressed in the exponential phase and inhibition of SdsR transcription through transcriptional interference by RyeA transcription from the σ70-dependent ryeA promoter.

RNA-seq analysis showed that expression of pphA, encoding a phosphatase, downstream of sdsR was decreased by the sdsR promoter mutation and increased by the ryeA promoter mutation, suggesting that pphA expression is controlled by the sdsR/ryeA regulatory circuit. We showed that pphA mRNA is transcribed as an sdsR-pphA dicistronic RNA from the σS-dependent sdsR promoter rather than from the previously reported heat-inducible pphA promoter. Thus, pphA mRNA may not be transcribed from the heat-inducible promoter, as suggested previously[30]. However, pphA expression differs from SdsR expression in that it is not affected in trans by RyeA although the ryeA transcription represses pphA expression. Therefore, pphA could be expressed at an earlier growth phase than SdsR. Trans-acting sRNAs usually downregulate expression of multiple target genes by inhibiting translation initiation of mRNA or by inducing degradation[5]. Our RNA-seq analysis showed that the sdsR promoter mutation upregulated more than 100 genes, but the ryeA promoter mutation led to only a few upregulated genes, suggesting that a major function of RyeA is to downregulate SdsR as a cis-encoded sRNA. The finding that the well-known SdsR target gene tolC[22] was repressed by the ryeA promoter mutation and activated by the sdsR mutation supports this possibility.

Our study showed that pphA expression begins with transcription from the sdsR promoter, and requires read-through transcription over the sdsR terminator and continued transcription into the pphA coding region. RNA-seq data showed that there was a considerable amount of read-through RNA over the sdsR terminator, but the amount of RNA continued to decrease with progression into the pphA open reading frame. Therefore, it is likely that other regulatory systems, such as premature termination or translational control, in addition to the sdsR/ryeA regulatory circuit are involved in pphA regulation. This remains to be determined in the future.

Antisense RNAs are expressed through convergent transcription, and their expression promotes transcriptional interference[37]. Transcriptional interference can come into play through various mechanisms, depending on the promoter strength and transcription velocity[39]. In this context, the sdsR/ryeA transcription unit is interesting because transcription levels from the ryeA and sdsR promoter vary during growth, leading to different transcriptional interference levels depending on growth conditions. It is likely that the sdsR/ryeA region at which transcriptional interference between two RNA polymerases occurs depends on the growth phase. SdsR transcription can be affected by convergent ryeA transcription at both initiation and elongation steps because the entire sdsR transcription unit is encompassed by the ryeA gene. Like SdsR expression, pphA expression is also affected by transcriptional interference by ryeA transcription.

To summarize, we herein characterized regulation of the expression of the toxin SdsR, including its downstream pphA gene, and the antitoxin RyeA (Fig. 9). SdsR expression is tightly regulated during growth through transcription from the σS-dependent sdsR promoter, RyeA-mediated degradation of SdsR, and transcriptional interference from the σ70-dependent ryeA promoter. On the other hand, downstream pphA expression, like that of SdsR, is also under control of both sdsR and ryeA promoters, but is unaffected by RyeA. Therefore, the sdsR/ryeA regulatory circuit plays a critical role in tightly controlling growth-dependent expression of SdsR toxin and pphA to ensure that they are not expressed during the exponential phase.

Figure 9

Schematic model of the sdsR/ryeA regulatory circuit. During transcription of RyeA, SdsR and dicistronic sdsR-pphA mRNA, transcriptional interference (TI) occurs in cis through collision of Eσ70 with EσS. RyeA and SdsR bind each other and the RyeA and SdsR duplex is degraded with the help of RNase III. This results in inhibition of SdsR regulation of target gene mRNA expression.

Experimental Procedures

Strains, plasmids, and oligonucleotides

All strains and plasmids used in this study are listed in Table 2. All primers and oligonucleotides used in this study are shown in Table 3. To generate sdsR and ryeB promoter mutant strains, each −10 element was changed to ‘CTCGAG’ using scarless mutagenesis, as described previously[40]. A series of lysogen-containing lacZ transcriptional fusion constructs was prepared. Briefly, various promoter regions around ryeA/sdsR were amplified, and the resulting fragment was cloned between the EcoRI and BamHI sites of the pRS1553 vector to generate lacZ transcriptional fusion plasmids. Lysogens were constructed by transforming E. coli strain DJ480 with the various fusion plasmids and transfecting with λRS468 to construct the corresponding lacZ fusion lysogens. Single-copy integration was confirmed by PCR[41]. For point mutations in sdsR-lacZ fusions, site-directed mutagenesis was performed, as described previously[18]. DJ480ΔsdsR/ryeA strain was generated from MG1655ΔsdsR/ryeA by P1-mediated transduction[42] and confirmed by sequence analysis of the amplified, knocked-out region. pRyeA and pSdsR carrying a pBR322 origin ectopically express IPTG-inducible RyeA and SdsR, respectively[43]. Plasmid pAKA-ara containing a pACYC184 origin was constructed by cloning the pBAD-AraC DNA sequence into the AvaI/EcoRI sites of plasmid pAKA, and used as a cloning vector to generate pRyeA-ara and pSdsR-ara, as described previously[44], which express arabinose-inducible RyeA and SdsR, respectively. To generate sdsR- or ryeA-CAT fusion plasmids, sdsR or ryeA promoter-containing DNA fragments were obtained via PCR amplification of genomic DNA. The resulting PCR products were digested with BamHI/HindIII and ligated into pKK232–8. To generate sdsR-tRNAArg-CAT fusion plasmids, a B. albidum tRNAArg sequence[36,45] was amplified by PCR and inserted immediately upstream of the CAT gene in the sdsR-CAT fusion plasmids. Template DNA plasmids for in vitro transcription were prepared by cloning sdsR or ryeA promoter-containing DNA fragments into the HindIII/EcoRI site of plasmid pLS16[35]. The oligonucleotides employed are listed in Table 3.

Table 2

Strains and plasmids used in this study.

Name	Description	Source
Strains
MG1655	E. coli MG1655 wild type	Laboratory stock
ryeAP m	MG1655 chromosomal ryeA promoter mutant (mutation on -10 promoter substituted to Xho1 site)	This study
sdsRP m	MG1655 chromosomal sdsR promoter mutant (mutation on -10 promoter substituted to Xho1 site)	This study
MG1655ΔsdsR/ryeA	MG1655ΔryeA/sdsR::kanR	[18]
DJ480	E. coli DJ480 wild type used for lacZ fusion	[51]
DJ480ΔsdsR/ryeA	P1 transduction from MG1655ΔsdsR/ryeA	This study
Plasmids
pWRG99	Plasmid carrying temperature-sensitive λ-red recombinase and I-SceI endonuclease	[40]
pWRG100	Template DNA plasmid for constructing scarless mutants	[40]
pKK232-8	A plasmid encoding cat gene encoding cam acetyltransferase (CAT) for chloramphenicol resistance	[52]
p22A	A derivative of pGEM3 carrying B. albidum tRNAArg	[36, 45]
pRS1553	A cloning vector for construction of lacZ transcriptional fusion	[43]
pHM4T	A derivative of pHM1, AmpR, IPTG-inducible RNA expression vector	[44]
pRyeA	A deriavative of pHM4T carrying ryeA full sequence, with a mutation on -10 promoter element of sdsR.	[18]
pSdsR	A deriavative of pHM4T carrying sdsR full sequence.	[18]
pLS16	In vitro transcription template vector	[44]
pAKA-ara	A derivative of pAKA, TcR, arabinose-inducible RNA expression vector	This study
pRyeA-ara	A deriavative of pAKA-ara carrying ryeA full sequence, with a mutation on -10 promoter element of sdsR.	This study
pSdsR-ara	A derivative of pAKA-ara carrying sdsR full sequence	This study

Table 3

Oligonucleotide sequences.

Name	Sequence 5′-3′	Use
RyeA-p1	GCGGCGCAACTGCTCAAGACAACC	Chromosomal ryeA -10 promoter mutant cloning
RyeA-p2	TCACTCGAGACACACACTCTACTG	Chromosomal ryeA -10 promoter mutant cloning
RyeA-p3	TGTGTGTCTCGAGTGACTATAAAG	Chromosomal ryeA -10 promoter mutant cloning
RyeA-p4	CAAACTGGAAAACCTGGCGTCGTC	Chromosomal ryeA -10 promoter mutant cloning
SdsR-p1	GCGGCGCAACTGCTCAAGACAACC	Chromosomal sdsR -10 promoter mutant cloning
SdsR-p2	TCACTCGAGACACACACTCTACTG	Chromosomal sdsR -10 promoter mutant cloning
SdsR-p3	TGTGTGTCTCGAGTGACTATAAAG	Chromosomal sdsR -10 promoter mutant cloning
SdsR-p4	CAAACTGGAAAACCTGGCGTCGTC	Chromosomal sdsR -10 promoter mutant cloning
SdsR-pRcom1	ATAGCCTTTTGATTTCCAAT	Chromosomal sdsR -10 promoter mutant cloning
SdsR-pRcom2	CTGTATTCGGTCCAGGGAAA	Chromosomal sdsR -10 promoter mutant cloning
5RACE_F	GATATGCGCGAATTCCTGTAGAAC	5′ RACE primer
5RACE_RyeAR	CCGCCTCAGTTCTTTCACCA	5′ RACE GSP1 primer
5RACE_SdsRR		5′ RACE GSP1 primer
5RACE_Nested	CCTGTAGAACGAACACTAGAAG	5′ RACE primer
5RACE_Nested_RyeAR	GCAAGGCAACTAAGCCTGCA	5′ RACE GSP2 primer
5RACE_Nested_SdsRR	TCGGTCCAGGGAAATGGCTC	5′ RACE GSP2 primer
3RACE_R	GAGCATGCGGCCGCTAAGAACAGT	3′ RACE primer
3RACE_RyeAF	AAAGTCAGCGAAGGAAATGC	3′ RACE primer
3RACE_SdsRF	GCAAGGCAACTAAGCCTGCA	3′ RACE primer
3RACE_Nested_RyeAF	CACGATTCCTGTATTCGGTC	3′ RACE primer
3RACE_Nested_R	CGGCCGCTAAGAACAGTGAA	3′ RACE primer
AvaIAraCF	CCCTCGGGCTGGCCCCG	pBAD-AraC cloning into pAKA
AraCREcoRI	CGGAATTCGTT TGGCCAAACA GTAGAGAG	pBAD-AraC cloning into pAKA
HD3pphAPF	CCCAAGCTTGCGAAGAGGTGATGCTG	−379 +222 cloning into pLS16
ERIpphAR	CGGAATTCGCGCTAAAGATCACATAATC	−379 +222 cloning into pLS16
BamHISdsRPF	CGGGATCCAGCTGATGACCACC	sdsR-CAT fusion
HinDIIISdsRPR	CCCAAGCTTAGTTGCCTTGCCC	sdsR-CAT fusion
HINDIIIryeAPF	CCCAAGCTTCGCTGACTTTATAGTCAACC	ryeA-CAT fusion
BAMHIryeAPR	CGGGATCCTTGCGGCGCAACTGC	ryeA-CAT fusion
BAMHI-379PF	CGGGATCCGCGAAGAGGT GATG	sdsR(-379 +131)-CAT fusion
Hind3 + 131R	CCCAAGCTTAAGGAAATGC TTCTGGC	sdsR(-379 +131)-CAT fusion
tRNA_F	TACAAGCTTGCGCTCGTAGCTCAG	sdsR-tRNAArg-CAT fusion
tRNA_R	TATAAGCTTTGGTGCGCCCGGCGG	sdsR-tRNAArg-CAT fusion
ERI-379F	CGGAATTCGCGAAGAGGTGATG	sdsR-lacZ fusion
ERI-79F	CGGAATTCAGCTGATGACCACC	sdsR-lacZ fusion
ERI + 104F	CGGAATTCATCTGTTAAAAGCCAGAAGC	sdsR-lacZ fusion
ERI + 142F	CGGAATTCTAGTCAACCATAACACACACT	sdsR-lacZ fusion
ERIA-80F	CGGAATTCCGCTAAAGATCACATAATC	ryeA-lacZ fusion
BHI-170R	CGGGATCCGTCATCAGCTGAAATG	sdsR-lacZ fusion
BHI + 11R	CG GGATCCAGTTGCCTTGCCC	sdsR-lacZ fusion
BHI + 222R	CGGGATCCGCGCTAAAGATCACATAATC	sdsR-lacZ fusion
BHI + 237R	CGGGATCCCAATATTTTCCTCCCGCGCT	sdsR-lacZ fusion
BHIA + 10R	CGGGATCCCGCTGACTTTATAGTCAACC	ryeA-lacZ fusion
CAT_R	GGTGGTATATCCAGTGATTTTTTTC	Primer extension primer for RyeA and SdsR
SdsR + 59R	GCTCTTGGGA GAGAGCCG	Primer extension primer for pphA
RyeA_NP	CGTGTTCGGTCTCTTTTTATCTG	RyeA Northern probe
SdsR_NP	CGTGCGCTAAAAGTTGGCATTAATGC	SdsR Northern probe
5SRNA + 90R	GAGACCCCACACTACCATCGG	5S RNA Northern probe
tRNA_NP	GAAACCTGTACTCTATCCAACTGAGCTA	tRNA Northern probe
pphA_F	TATCAGAGAATTGCGGGTCATC	pphA mRNA qRT-PCR
pphA_R	ACGTCTCCCACTGAGATAAGTA	pphA mRNA qRT-PCR
asnA_F	GATGGCACGCAGGATAACT	asnA mRNA qRT-PCR
asnA_R	CTGAAGTCGTGTTGCCCTAA	asnA mRNA qRT-PCR
aphA_F	GCAAGATCACACAGGCAATC	aphA mRNA qRT-PCR
aphA_R	CGACCGAAACCCAATGAATG	aphA mRNA qRT-PCR
stpA_F	CGCGTCCGGCGAAATATAA	stpA mRNA qRT-PCR
stpA_R	AGATCAGGAAATCGTCGAGAGA	stpA mRNA qRT-PCR
ytfE_F	GTGAACTGGCGCTCTCTATT	ytfE mRNA qRT-PCR
ytfE_R	GGTTGTTCAGCGAGCTTTG	ytfE mRNA qRT-PCR
ynfF_F	TCAGGTTCGAGCGTGTTTAC	ynfF mRNA qRT-PCR
ynfF_R	GGGCTTCGTCCCAACTTATC	ynfF mRNA qRT-PCR
tolC_F	TAG TAA CCC GGA ATT GCG TAA G	tolC mRNA qRT-PCR,[18]
tolC_R	AGC CGT TGC TAT AGG TGT AAT C	tolC mRNA qRT-PCR,[18]
putA_F	GGCCAATGAGAGCGATGAA	putA mRNA qRT-PCR
putA_R	GCTTGTTCCAGCAGCATAGA	putA mRNA qRT-PCR
gapA_F	GCACCACCAACTGCCTGGCT	gapA mRNA qRT-PCR,[50]
gapA_R	CGCCGCGCCAGTCTTTGTGA	gapA mRNA qRT-PCR,[50]
PM_RyeAF	CGCTGACTTTATAGTCACTCGAGACACACACTCTACTGTC	ryeA promoter mutation
PM_RyeAR	TAACAAGAATGTTAAAAAACGCTGGACTCAGACAGTAGAGTGTGTGTC	ryeA promoter mutation
SdsRtMF	CATTTCCCTGGAGGCAATACAG GAATCGTGTT	sdsR terminator mutation
SdsRtMR	TCCAGGGAAATGGCTCTTGGGAGAGAGCCGTG	sdsR terminator mutation
PM_SdsRF	CCTTTACTCGAGGATGACGACGCCAG	sdsR promoter mutation
PM_SdsRR	GTCATCCTCGAGTAAAGGGCAAGGCAAC	sdsR promoter mutation

Primer extension

An SdsR +59R primer (5′-GCT CTT GGG AGA GAG CCG-3′) was 5′ end-labeled with [γ-32P]ATP using T4 polynucleotide kinase. The primer was then used to analyze sdsR(−379/+131)-CAT fusion transcripts. Total cellular RNA was isolated from cells carrying the sdsR(−379/+131-CAT fusion plasmid. The labeled primer was used for primer extension analysis, as previously described[46].

RACE assays

5′ and 3′ RACE analysis for RyeA and SdsR were performed as described previously[47]. Total cellular RNAs from mid-exponential phase (4 h) and stationary phase (8 h) cells were used for RyeA and SdsR, respectively. For 5′ RACE total cellular RNA was treated with 5 unit of E. coli RppH (New England Biolabs) in a 50 μl reaction before RNA ligation.

In vitro transcription by E. coli RNA polymerase

In vitro transcription using E coli RNA polymerase was performed as described previously[46]. E. coli RNA polymerase holoenzyme Eσ70 was purchased from New England Biolabs. σS (RpoS) was purified using the plasmid described previously[46]. EσS was reconstructed by combining the core enzyme (New England Biolabs) and σs in a molar ratio of 1:2. After 1 h reaction at 37 °C, the reaction was terminated by adding phenol/chloroform.

Northern blotting

E. coli cells were grown overnight in LB broth in the presence of appropriate antibiotics. Overnight cultures were diluted 1:100 in fresh LB medium and further cultured at 37 °C. Total cellular RNA was extracted at the desired time points using the acidic hot-phenol method, as described previously[35]. RNA was generated in vitro using the T7 RiboMAX Express Large Scale RNA Production System (Promega). Northern blot analysis was carried out as described previously[35]. Briefly, 5–10 μg of total RNA was fractionated on a 5% polyacrylamide gel containing 7 M urea and electrotransferred to a Hybond-XL membrane (Amersham Biosciences). Membranes were hybridized with 32P-labeled DNA probes in PerfectHyb Plus Hybridization Buffer (Sigma Aldrich) and analyzed using an FLA 7000 Image Analyzer (Fuji).

Mutual degradation assays of SdsR and RyeA

MG1655ΔsdsR/ryeA cells were co-transformed with a plasmid pair of pSdsR-ara/pRyeA or pRyeA-ara/pSdsR. Overnight cultures of the transformed cells were diluted (1:100) into LB medium containing ampicillin (100 μg/ml) and tetracycline (10 μg/ml), and grown at 37 °C for 2 h. Arabinose of 0.2% was added into the culture and cells were grown for 5 min or 25 min. Then 0.1 mM IPTG was added into each culture and cells were further grown further. Aliquots of the cell culture were taken in intervals and their RyeA and SdsR contents were analyzed by Northern blotting

RNA-seq sample preparation and analysis

E. coli MG1655 wild-type, ryeA promoter mutant, and sdsR promoter mutant cells were grown at 37 °C overnight. After diluting 1:100, overnight cultures were grown for 3 h (exponential phase) and 8 h (stationary phase); total RNA was extracted at each point. All preparation procedures were as previously described[18]. All RNA sequencing and alignment procedures were conducted by ChunLab. Ribosomal RNA was depleted using a Ribo-Zero rRNA removal kit (Epicentre) according to the manufacturer’s instructions. Libraries for Illumina sequencing were generated using a TruSeq Stranded mRNA Sample Prep kit (Illumina) according to the manufacturer’s protocol. RNA sequencing was performed on the Illumina HiSeq 2500 platform using single-end 50-bp sequencing. Sequence data for the reference genome were retrieved from the NCBI database. Quality-filtered reads were aligned to the reference genome sequence using Bowtie2.

Transcript abundance was measured as Relative Log Expression (RLE). To screen for mRNAs whose levels differed by more than 2-fold versus wild-type cells, we filtered for mRNAs with EdgeR p-values < 0.05. For GO analyses, the 171 genes and 55 genes found to be up- or downregulated in the exponential phase and stationary phase, respectively, by the sdsR promoter mutation were sorted according to their GO categories (http://amigo.geneontology.org)[48].

LacZ assay

Three colonies for each strain were cultured overnight in LB medium with/without ampicillin (100 μg/ml), after which overnight cultures were diluted 1:100 and cultured in fresh medium containing 0.02% arabinose and 1 mM IPTG. Cultures were incubated for 2 h for exponential phase and 10 h for stationary phase. LacZ activity was assayed as described previously[49].

Semi-quantitative RT-PCR and qRT-PCR

RNA extraction and DNase treatment were performed as described above for RNA-seq. cDNA was synthesized using M-MLV reverse transcriptase (Enzynomics) with specific primers for semi-quantitative RT-PCR. qRT-PCR was performed on an Exicycler 96 system (Bioneer) using Prime Q-master mix (Genet Bio). Expression levels of each mRNA of interest were normalized to that of the gapA gene[50]. All experiments were performed according to the manufacturer’s instructions.

Supplementary information