Literature DB >> 31201145

LINC00184 silencing inhibits glycolysis and restores mitochondrial oxidative phosphorylation in esophageal cancer through demethylation of PTEN.

Weihao Li1, Kai Huang1, Fengbiao Wen1, Guanghui Cui1, Haizhou Guo1, Zhanfeng He1, Song Zhao2.   

Abstract

BACKGROUND: Total lesion glycolysis has been reported to be a satisfactory predictor of survival in patients with locally advanced esophageal cancer (EC). The aim of the present study is to investigate the function of long intergenic non-protein coding RNA 184 (LINC00184) on the EC cell glycolysis and mitochondrial oxidative phosphorylation (OXPHOS).
METHODS: The expression of LINC00184 was determined to be highly expressed and PTEN was poorly expressed in EC tissues and cells by RT-qPCR. In order to evaluate the effects of LINC00184 on cellular process in vitro and in vivo, gain- and loss-of-function approaches were performed to alter the expression of LINC00184 and PTEN in EC cells.
RESULTS: Silencing of LINC00184 was observed to inhibit the proliferation, migration, invasion, colony formation, and glycolysis of EC cells and tumour growth, while the mitochondrial OXPHOS was restored. By recruiting DNMT1, LINC00184 enhanced the promoter methylation of PTEN. Inhibition of PTEN promoter methylation suppressed EC glycolysis, whereas, improved mitochondrial OXPHOS. Mechanically, LINC00184 modulated glycolysis and mitochondrial OXPHOS in EC cells through induction of the Akt phosphorylation. After blockage of Akt signaling pathway by an Akt inhibitor, LY294002, the regulatory effects of LINC00184 on the glycolysis and mitochondrial OXPHOS of EC cells were reversed.
CONCLUSION: Taken together, the LINC00184/PTEN/Akt axis mediates glycolysis and mitochondrial OXPHOS in EC cells. This study highlighted a potential intervention target for treating EC.
Copyright © 2019. Published by Elsevier B.V.

Entities:  

Keywords:  Esophageal cancer; Glycolysis; Long intergenic non-protein coding RNA 184; Methylation; Mitochondrial oxidative phosphorylation; Phosphatase and tensin homolog

Mesh:

Substances:

Year:  2019        PMID: 31201145      PMCID: PMC6606559          DOI: 10.1016/j.ebiom.2019.05.055

Source DB:  PubMed          Journal:  EBioMedicine        ISSN: 2352-3964            Impact factor:   8.143


Evidence before this study

Esophageal cancer (EC) is one of commonest malignant tumours in the digestive system. The functions of lncRNAs as novel and critical regulators of biological function have been widely reported. This study is conducted to further explore the underlying molecular mechanism of LINC00184 involved in the glycometabolism of EC so as to provide a better understanding for the progression of EC. PTEN is commonly known as a tumour suppressor in many cancers. Our study found that the expression of LINC00184 was negatively correlated with that of PTEN. Thus, a series of experiments were conducted to analyse whether LINC00184 could mediate PTEN to exert its function.

Added value of this study

Our study identified the modulatory role of LINC00184 in the glycolysis and mitochondrial OXPHOS in EC cells through inducing PTEN methylation.

Implications of all the available evidence

Taken together, targeting LINC00184 might be a promising therapeutic strategy for EC. Alt-text: Unlabelled Box

Introduction

Esophageal cancer (EC), one of commonest malignant tumours in the digestive system, is estimated to have approximately 17,290 newly diagnosed cases and 15,850 cases died from this cancer in the worldwide in 2018 [1]. As seen from the Cancer Statistics in China, 2015, a dramatically decreasing trend in incidence and mortality was observed for EC in China [2]. Surgery is deemed as the standard treatment regimen for patients with surgically resectable localised tumours, while patients with metastatic EC may undergo different options of palliative treatment based on the clinical situations [3]. A better understanding of implicated molecular mechanisms would aid to the advancement of new diagnostic technologies and treatment. Metabolic reprogramming has been reported to induce tumourigenesis of EC cells and targeting the glycolytic element or additional glucose consumption for EC may help to prevent the tumour progression induced by different genomic changes [4]. It has been previously reported that the capacity to maintain high rates of glycolysis under aerobic conditions may be a significant factor of rapidly increasing tumours, and reduced mitochondrial oxidative function appears to be a feature in augmented glucose utilization of tumour cells [5]. Strikingly, long noncoding RNAs (lncRNAs), a set of transcripts in length longer than 200 nucleotides, are able to control glucose metabolism in cancer cells [6]. In recent years, lncRNAs have drawn extensive attention as potentially novel and critical regulators of biological functions [7]. Accumulating lncRNAs, such as LINC POU3F3, LINC uc003opf.1, AFAP1-AS1 and etc. have been implicated to play vital roles in biological processes, such as proliferation, apoptosis and metastasis [8]. LncRNAs involve in biological, developmental and pathological processes and function through mechanisms such as chromatin reprogramming and posttranscriptional modulation of mRNA processing [9]. PTEN is recently demonstrated as a suppressor gene in cancers [10]. High methylation level of PTEN observed in esophageal squamous cell carcinoma (ESCC), a major subtype of EC, is characterised by common PTEN depletion [11]. Moreover, the elevation of PTEN is accompanied by reduction of glucose uptake and induction of a tumour-suppressive metabolism condition [12]. By bioinformatics analysis on the basis of The Cancer Genome Atlas (TCGA) database, we found long intergenic non-protein coding RNA 184 (LINC00184), as a member of lncRNA family, is highly expressed in EC. Whether LINC00184 could affect the glucose metabolism, even development of EC remains to be explored. Therefore, the study was designed to investigate the possibility and regulatory mechanism how LINC00184 functions in the modulation of glycolysis and mitochondrial OXPHOS in EC.

Material and methods

Ethics statement

Written consents were obtained from all patients prior to surgery and the study protocol was approved by the Ethics Committee and Experimental Animal Ethic Committee of the First Affiliated Hospital of Zhengzhou University. All experiments involving human tissue were performed according to the principles of the “Helsinki declaration”. The animal experiment strictly adhered to the principle to minimise the pain, suffering, and discomfort to experimental animals.

Microarray-based gene expression profiling analysis

The gene expression profile of EC was downloaded from TCGA (http://cancergenome.nih.gov/) database, and the statistical analysis was performed by the R software. Differential analysis of transcriptome profiling data was carried out using edgeR package from the R software [13]. False positive discovery (FDR) correction was applied on p-value with the multi-test package. FDR < 0.05 and |log2 (fold change) | > 2 were set as the threshold to screen out differentially expressed lncRNAs in EC.

Study subjects

EC tissues and adjacent normal tissues were surgically obtained from 84 patients who underwent surgery at the First Affiliated Hospital of Zhengzhou University between January 2016 and May 2018. The patient population included 49 males and 35 females, aged from 37 to 75 years with an average age of 58.2 ± 10.9 years. The cases were all confirmed with pathological examination. No patient had received any other radiotherapy, chemotherapy and immunotherapy before surgery. All enrolled patients had complete medical records.

Cell transfection and treatment

A normal esophageal epithelial cell line HEEC and four EC cell lines (Eca-109, SHEEC1, EC9706 and KYSE450) were purchased from American Type Culture Collection (Manassas, VA, USA). Cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum (FBS) supplemented with 100 U/mL penicillin and streptomycin and incubated with 5% CO2 at 37 °C. The cells were detached with 0.25% trypsin and sub-cultured at a ratio of 1: 3. The cells were inoculated in 6-well plates at the density of 3 × 105 cells/well, and harvested when the confluence reached 70% - 80%. The cell lines with the highest LINC00184 expression were screened by RNA isolation and quantification for further experiments. For transfection, cells in logarithmic growth phase were seeded into 6-well culture plates at the density of 4 × 105 cells/well. The shRNA targeting LINC00184 (sh-LINC00184), LINC00184 over-expression plasmid (oe-LINC00184), PTEN over-expression plasmid (oe-PTEN), or their negative controls (sh-NC and oe-NC) were purchased from Dharmacon (Lafayette, CO, USA). An Akt inhibitor, LY294002 (L9908; Sigma-Aldrich) and a DNA methyltransferase inhibitor, 5-aza-2’deoxycytidine (5-Aza-dC; A3656; Sigma-Aldrich) were applied to block the Akt signaling pathway and inhibit DNA methylation, respectively, and dimethylsulfoxide (DMSO) worked as the control.

Wound healing assay

Serum-starved EC cells were inoculated into a 24-well plate. Once reaching approximately 60% confluence, the cells were mechanically scratched across the centre of the well gently using a sterile pipette tip. Cells were washed with serum-free medium to remove the debris and cultured for an additional 24 h, after which images were captured under an inverted microscope (TE2000, Nikon, China) (40 ×). The relative distance of the cells migrating from the injured line was measured, based on which the actual migration distance was calculated. The experiments were repeated three times.

Transwell assay

The Transwell chambers were placed in the 24-well plate. The basement membrane of apical chamber was pre-coated with diluted Matrigel (1: 8, Qcbio Science and Technologies Co., Ltd., Shanghai, China) and dried in the air at room temperature. The cells were detached, washed with phosphate buffered saline (PBS) twice, and resuspended with culture medium with the cell density adjusted to 1 × 105 cells/mL. A total of 200 μL cell suspension was added to the apical chamber and 600 μL RPMI 1640 medium was added to the basolateral chamber. After 24 h, the cells on the inner side of the apical chamber were wiped off using the cotton swabs. The cells were fixed with 4% paraformaldehyde (Beijing leagene biotech. co., ltd, Beijing, China) at room temperature for 10 min, washed with PBS twice, stained with 0.5% crystal violet solution (Beijing solarbio science & technology co. ltd., Beijing, China) for 15 min, and washed with PBS three times. With 5 visual fields (200 ×) randomly selected from each group, the number of cells invaded through the membrane was counted, and images were captured under the inverted microscope.

Colony formation assay

After that, 2 mL freshly prepared 0.7% agarose solution consisting of 0.7% agarose and fresh Dulbecco's modified eagle's medium (DMEM) was added to pave the bottom of a 100 mm culture dish. Next, 1 mL cell suspension and 0.7% agarose solution were diluted into 0.35% agarose-cell complex. Cells (11 × 104 cells/1002 cm) were seeded and 3 duplicates were set in each group. When the upper-layer agar solidified, 2–3 mL culture medium was added to the surface of the agar gently and cultured at 37 °C with 5% CO2 for 1 month with the medium renewed every 2–3 days. The number of cell colonies was counted under the inverted microscope. A cell colony should contain ≥50 cell masses.

5-Ethynyl-2′-deoxyuridine (EdU) assay

The EC cells were inoculated into a 24-well plate, and incubated with medium containing EdU (the final concentration was 10 μmol/L) for 2 h. Triplicate wells were set up in each group. The cells were then fixed with 4% paraformaldehyde in PBS at room temperature for 15 min, and then washed two times with 3% bovine serum albumin (BSA) in PBS. After permeabilization with 0.5% Triton-100 PBS at room temperature for 20 min, cells were incubated with 100 μL of Apollo® 567 (Guangzhou RiboBio Co., Ltd., Guangzhou, Guangdong, China) at room temperature for 30 min in the dark. The cells were then stained with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min for nuclear staining and observed under a fluorescence microscope (FM-600, Shanghai Pudan Optical Chemical instrument Co., Ltd., Shanghai, China). Under the microscope, the numbers of blue-fluorescent cells (DAPI-stained, total cells) and red-fluorescent cells (EdU positive cells) in each filed were recorded. Three visual fields were randomly selected in each well, and the proportion of EdU-stained positive cells was calculated. EdU positive rate = (EdU positive cells/total cells) × 100%.

Hexokinase assay

EC cells were cultured with fresh culture medium. According to the instructions of Hexokinase Assay kit (BC0740, Beijing Solabio Life Sciences Co., Ltd., Beijing, China), glucose and lactic acid content were detected. Subsequently, glucose consumption and lactic acid production were analysed.

Cellular adenosine triphosphate (ATP) detection

EC cells were resuspended in PBS at 1 × 106 cells/mL. Cells were harvested using ATP lysis buffer and incubated for 30 min on ice. The cell lysate was centrifuged at 12000 r/min for 10 min. The ATP level in the supernatant was tested using an ATP assay kit (Beyotime Biotechnology Co., Shanghai, China). Bioluminescence was determined on a Pi-102 fluorescence luminometer (Hygiena, Camarillo, CA, USA). Cellular ATP release was calculated based on an ATP standard, and normalised using a bicinchoninic acid (BCA) protein assay kit.

RNA isolation and quantification

Total RNA in EC tissues and cells was extracted by TRIzol reagent (Invitrogen, Calsbad, CA, USA). The total RNA concentration and purity were determined by a nanodrop2000 ultraviolet spectrophotometer (1011 U; NanoDrop Technologies, Wilmington, DE, USA). According to the instructions of the TaqMan MicroRNA Assays (4427975, Applied Biosystems, Inc., Foster City, CA, USA), the RNA was reversely transcribed into cDNA. The primers of LINC00184 and PTEN were designed and syntheised by Takara Biotechnology Ltd. (Dalian, Liaoning, China) (Table 1). Real time-PCR experiment was carried out using an ABI7500 quantitative PCR instrument (ABI Company, Oyster Bay, N.Y., USA). Reaction conditions: pre-denaturation at 95 °C for 10 min; denaturation at 95 °C for 10 s, annealing at 60 °C for 20 s, and extension at 72 °C for 34 s, a total of 40 cycles. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal reference. The relative transcription level of target gene was calculated by using relative quantitative method (2-ΔΔCt method) [14].
Table 1

Primer sequences for RT-qPCR.

GenePrimer sequence (5′- 3′)
LINC00184F: GGACCACCTATGGGGAAAGG
R: GATGCCTTGCTTGACCCAAC
PTENF:5'-GAGGGATAAA ACACCATG -3'
R:5'-AGGGGTAGGATGTGAACCAGTA -3'
GAPDHF:5'-GCACCGTCAAGGCTGAGAAC-3'
R:5'-TGGTGAAGACGCCAGTGGA-3'

Note: RT-qPCR, reverse transcription quantitative polymerase chain reaction; F, forward; R, reverse; LINC00184, long intergenic noncoding RNA 184; PTEN, phosphatase and tensin homolog; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Primer sequences for RT-qPCR. Note: RT-qPCR, reverse transcription quantitative polymerase chain reaction; F, forward; R, reverse; LINC00184, long intergenic noncoding RNA 184; PTEN, phosphatase and tensin homolog; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Western blot analysis

The total protein in EC tissues and cells was lysed with radio-immunoprecipitation assay (RIPA) lysis buffer (Pierce, Rockford, IL, USA) containing phenylmethanesulfonyl fluoride (PMSF) on ice for 30 min. The protein concentration was determined as described in the instructions of the BCA kit. The protein (50 μg) was separated by SDS-polyacrylamide gel electrophoresis (PAGE) then transferred onto a polyvinylidene fluoride (PVDF) membrane. The membranes were blocked with 5% skim milk for 1 h at room temperature and then incubated with diluted primary antibodies of rabbit antibody to PTEN (1:10000, ab32199), DNMT1 (1:1000, ab19905), Akt (1:500, ab8805), p-Akt (1:700, ab38449), COMPLEXII-SDHB (1:1000, ab84622), COHPLEXIII-UQCRC2 (1:2000, ab203832), COMPLEXIV-COXII (1:5000, ab79393), COMPLEXV-ATP5A (1:2000, ab176569), and GAPDH (internal reference, 1:2500, ab9485) at 4 °C overnight. After three times washing, the membranes were then incubated with secondary antibody, horseradish peroxidase (HRP)-conjugated goat anti-rabbit to IgG (1:2000, ab97051) for 1 h. All antibodies used were purchased from Abcam Inc. (Cambridge, MA, USA). The solution A and solution B from a chemiluminescence (ECL) fluorescent detection kit (BB-3501, Amersham Pharmacia, Piscataway, NJ, USA) was mixed in the dark, then dripped onto the membranes and exposed in the gel imager. The images were captured using a Bio-Rad image analysis system (Bio-Rad Laboratories, Hercules, CA, USA). The relative protein expression was expressed by the gray value of the target protein band to that of the GAPDH protein band using the Quantity One v4.6.2 software.

Fluorescence in situ hybridization (FISH)

The subcellular localization of LINC00184 was predicted in LncATLAS database available at http://lncatlas.crg.eu/. FISH was employed to identify the subcellular of LINC00184 in KYSE450 cells based on the instructions of Ribo™ lncRNA FISH probe Mix (Red) (Guangzhou RiboBio Co., Ltd., Guangzhou, Guangdong China). In details, KYSE450 cells seeded into 6-well culture plate. After 1 day of culture, when cell confluence reached about 80%, the cells were washed with PBS, and fixed with 1 mL 4% paraformaldehyde at room temperature. Subsequently, the cells were treated with protease K (2 μg/mL), glycine and acetylation, and then incubated with 250 μL prehybridization solution at 42 °C for 1 h. After the removal of prehybridization solution, the cells were hybridised overnight with 250 μL hybridization solution containing LINC00184 specific probe (300 ng/mL) at 42 °C and washed 3 times with phosphate-Buffered Saline/Tween (PBST). The nucleus was stained with PBST-diluted DAPI (1: 800) solution in a 24-well plate for 5 min, followed by PBST washing and mounting. Five visual fields were selected under the fluorescence microscope (Olympus Optical Co., Ltd., Tokyo, Japan) and the images were obtained.

Fractionation of nuclear/cytoplasmic RNA

The nuclear and cytoplasmic RNA fractions were isolated according to PARIS™ Kit (Life Technologies, Inc., Gaithersburg, MD, USA). Briefly, the EC cells were collected and washed with PBS. After trypsinization, the cells were centrifuged at 500 g for 5 min. The pellets were resuspended in 500 μL cell fractionation buffer and incubated on ice for 5–10 min. The nuclei were collected by centrifugation at 500 g for 5 min at 4 °C. The supernatant (cytoplasmic fraction) was transferred into a new 2 mL sterile enzyme-free tube, followed by centrifugation at 500 g for 5 min at 4 °C. The precipitation (nuclear fraction) was resuspended in 500 μL cell fractionation buffer. The cytoplasmic fraction and nuclear fraction were separately rinsed in 500 μL 2 × Lysis/binding solution. After centrifugation, pellet was resuspended in pre-cooled 500 μL cell fractionation buffer, and 500 μL absolute ethanol and transferred into the adsorption column, which was subsequently placed into the collection tube. After centrifugation and washing, pure nucleus RNA was harvested by elution. The expression of LINC00184 was determined by RT-qPCR, with 45S rRNA used as the internal control for nuclear RNA expression and 12S rRNA for cytoplasmic RNA expression. The primers are shown in Table 2.
Table 2

Primer sequences of internal controls for real-time qPCR.

GenePrimer sequence
45S rRNAF: 5’-GTGCCCTCACGTGTTTCACTTT-3’
R: 5’-TAGGAGACAAACCTGGAACGCT-3’
12S rRNAF: 5’-TCGATAAACCCCGCTCTACCT-3’
R: 5’-TGGCTACACCTTGACCTAACGTT-3’

Note: qPCR, quantitative polymerase chain reaction; F, forward; R, reverse.

Primer sequences of internal controls for real-time qPCR. Note: qPCR, quantitative polymerase chain reaction; F, forward; R, reverse.

Methylation specific PCR (MS-PCR)

The methylation status of PTEN promoter was assessed by MS-PCR. The genomic DNA was extracted according to the instructions of genomic DNA extraction kit (Beijing Tiangen Biotech Co., Ltd., Beijing, China). The concentration and purity of DNA were determined by ultraviolet spectrophotometry and stored in a − 80 °C refrigerator. The DNA Methylation-Gold™ kit (D5005, Zymo Research, Irvine, CA, USA) was adopted to detect the methylation level of PTEN promoter. Briefly, DNA (1 μg) was modified with bisulfite and preserved at −80 °C for no more than one month. The desulfated and purified DNA was used for the subsequent PCR reaction. PCR reaction conditions were as follows: pre-denaturation at 95 °C for 10 min, a total of 35 cycles including denaturation at 95 °C for 45 s, 58 °C (methylated)/57 °C (unmethylated), and annealing at 72 °C for 45 s, followed by a final extension at 72 °C for 10 min. The reaction products were treated with agarose gel electrophoresis, visualised and analysed by an image analysis system. Five pairs of methylated and unmethylated primers of PTEN gene are listed in Table 3. The experiments were repeated three times. If the Cytosine-phosphate-guanine (CpG) island of the promoter of PTEN gene was completely methylated, only the target band can be amplified by the methylated primer, and the target band can only be amplified by the non-methylated primer if the promoter was completely unmethylated. In the case of partial methylation which was deemed as methylation, two pairs of primers could amplify the target bands.
Table 3

Primer sequences for MS-PCR.

GenePrimer sequence (5′- 3′)
PTEN-MF: GTATTTCGAGTAAAGGAAGAAGACG
R: GATAAAAAACTACAACCCAACGAA
PTEN-UF: TATTTTGAGTAAAGGAAGAAGATGA
R: CAATAAAAAACTACAACCCAACAAA
PTEN-MF: TATTTCGAGTAAAGGAAGAAGACGA
R: GATAAAAAACTACAACCCAACGAA
PTEN-UF: TATTTTGAGTAAAGGAAGAAGATGA
R: CAATAAAAAACTACAACCCAACAAA
PTEN-MF: TATTTCGAGTAAAGGAAGAAGACGA
R: CGATAAAAAACTACAACCCAACG
PTEN-UF: TATTTTGAGTAAAGGAAGAAGATGA
R: CAATAAAAAACTACAACCCAACAAA
PTEN-MF: GTATTTCGAGTAAAGGAAGAAGACG
R: GATAAAAAACTACAACCCAACGAA
PTEN-UF: ATTTTGAGTAAAGGAAGAAGATGA
R: CAATAAAAAACTACAACCCAACAAA
PTEN-MF: GTATTTCGAGTAAAGGAAGAAGACG
R: GATAAAAAACTACAACCCAACGAA
PTEN-UF: TATTTTGAGTAAAGGAAGAAGATGA
R: AATAAAAAACTACAACCCAACAAA

Note: MS-PCR, Methylation specific PCR; F, forward; R, reverse; PTEN, phosphatase and tensin homolog; U, unmethylated; M, methylated.

Primer sequences for MS-PCR. Note: MS-PCR, Methylation specific PCR; F, forward; R, reverse; PTEN, phosphatase and tensin homolog; U, unmethylated; M, methylated.

Chromatin immunoprecipitation (CHIP)

The EC cells reaching 70–80% confluence was cross-linked with 1% formaldehyde for 10 min at room temperature. After crosslinking, the DNA was sheared with a sonicator. After centrifugation, cross-linked chromatin was incubated overnight 4 °C with specific antibody, mouse anti-DNMT1 (1:100, ab13537, Abcam), positive control RNA polymerase II, and negative control anti-IgG (1:100, ab109489, Abcam) respectively. The endogenous DNA-protein complex was precipitated by protein agarose/sepharose, and the supernatant was removed after centrifugation. The nonspecific complex was washed, and the crosslinking was reversed overnight at 65 °C. The DNA fragment was purified and extracted by phenol/chloroform. PTEN promoter fragment specific primers were used to detect the binding of PTEN to DNMT1 [15].

RNA-binding protein immunoprecipitation (RIP) assay

The binding relationship between LINC00184 and DNMT1 was determined by RIP kit (Millipore Corp, Billerica, MA, USA) according to previous study [16]. The cells were lysed with RIPA lysis buffer (P0013B, Beyotime Biotechnology Co., Shanghai, China) for 5 min on ice. The lysate (100 μL) was incubated with magnetic bead coated with antibody overnight at 4 °C. Samples were placed on magnetic pedestals to collect magnetic beads-protein complexes. The immunoprecipitated bead-protein complex was digested by protease K to collect RNA, followed by RT-qPCR. The antibody used in RIP was mouse anti-DNMT1 (1:100, ab13537, Abcam) NC IgG (1:100, ab109489, Abcam).

RNA pull-down assay

LINC00184 RNA was synthesised in vitro by T7 RNA polymerase (Ambion, Company, Austin, TX, USA), and then purified with a RNeasy Mini kit (Qiagen company, Hilden, Germany) and DNase I (Qiagen company, Hilden, Germany). The purified RNA 3’terminal was labeled with biotin RNA-labeled mixture (Ambion). The cells (3 μg) were lysed with the cell lysis buffer (Sigma-Aldrich) for 1 h at 4 °C. The supernatant was acquired by centrifugation at 12000 ×g for 10 min at 4 °C, collected and transferred to a RNase-free centrifuge tube. The biotinylated RNA (400 ng) was added with 500 μL of RIP buffer and subsequently incubated with cell lysate at room temperature for 1 h followed by addition of streptavidin beads. After another 1 h incubation at room temperature, 5 × loading buffer was added and incubated at 95 °C for 5 min. Finally, Western blot analysis was conducted to detect the eluted DNMT1 protein.

Xenograft tumour in nude mice

Athymic female nude mice aged 5–6 weeks were purchased from and reared by the Fourth Military Medical University. The mice were accumulated under the conditions of constant temperature (25–27 °C) and constant humidity (45% - 50%). When cells grew into 80% - 90%, the cells transfected with oe-NC, sh-NC, oe-LINC00184, or sh-LINC00184 were washed with PBS, resuspended, and counted with the concentration adjusted to 1 × 107 cells/mL. A total of 20 μL cell suspension was subcutaneously inoculated into the axilla of nude mice (6 mice/group). After 6 weeks, the nude mice were euthanized by exposure to CO2. The tumour volume was calculated using the formula: tumour volume = a × b2/2 (a, the maximum diametre of the tumour; b, the minimum diametre of the tumour).

Statistical analysis

Statistical analyses were conducted by using SPSS 21.0 (IBM Corp. Armonk, NY, USA). The data were expressed as mean ± standard deviation. The statistical significance of data with normal distribution and equal variance was analysed using paired t-test or unpaired Student's t-test. Data from multiple groups were compared by one-way analysis of variance with Tukey's post hoc test. Correlation of LINC00184 and PTEN expression in EC was analysed by Pearson's correlation analysis. Differences were considered to be statistically significant at p < .05.

Results

LINC00184 was up-regulated in EC tissues and cell lines

By analyzing the expression profile of EC in the TCGA database, LINC00184 expression was shown to be noticeably higher in either esophageal adenocarcinoma samples or ESCC samples than that in normal controls (p < .001). The LINC00184 expression in esophageal adenocarcinoma samples was similar to that in ESCC samples (Fig. 1A-B). We then selected 84 EC patients to determine the expression of LINC00184 in EC and adjacent normal tissues. The results of RT-qPCR showed that LINC00184 expression was dramatically elevated in EC tissues relative to adjacent normal tissues (Fig. 1B). Moreover, LINC00184 expression was characterised in normal esophageal epithelial cell line HEEC and several EC cell lines. The expression of LINC00184 in Eca-109, SHEEC1, EC9706, and KYSE450 cells was dramatically higher than in HEEC cells. Among four EC cell lines, KYSE450 cells exhibited the highest level of LINC00184 and Eca-109 cells displayed the lowest level of LINC00184 (Fig. 1C); therefore the EC cell lines KYSE450 and Eca-109 were selected for the subsequent experiments.
Fig. 1

LINC00184 was up-regulated in EC tissues and cell lines. (A) LINC00184 expression in EC patients and normal controls revealed by the TCGA database (p = 3.611e-7). (B) LINC00184 expression in ESCC samples and normal controls revealed by the TCGA database (p = 2.517e-09). (C) LINC00184 expression in EC and adjacent normal tissues determined by RT-qPCR. ⁎p < .05 vs. adjacent normal tissues. n = 84. (D) LINC00184 expression in HEEC cell line and EC cell lines measured by RT-qPCR. ⁎p < .05 vs. the HEEC cell line. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The paired t-test was conducted for comparison between two groups (in panel A and B). The one-way analysis of variance was adopted for comparison among multiple groups, followed by Tukey's post hoc test (in panel C). EC, esophageal cancer; LINC00184, long intergenic non-protein coding RNA 184; TCGA, The Cancer Genome Atlas; RT-qPCR, reverse transcription quantitative polymerase chain reaction.

LINC00184 was up-regulated in EC tissues and cell lines. (A) LINC00184 expression in EC patients and normal controls revealed by the TCGA database (p = 3.611e-7). (B) LINC00184 expression in ESCC samples and normal controls revealed by the TCGA database (p = 2.517e-09). (C) LINC00184 expression in EC and adjacent normal tissues determined by RT-qPCR. ⁎p < .05 vs. adjacent normal tissues. n = 84. (D) LINC00184 expression in HEEC cell line and EC cell lines measured by RT-qPCR. ⁎p < .05 vs. the HEEC cell line. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The paired t-test was conducted for comparison between two groups (in panel A and B). The one-way analysis of variance was adopted for comparison among multiple groups, followed by Tukey's post hoc test (in panel C). EC, esophageal cancer; LINC00184, long intergenic non-protein coding RNA 184; TCGA, The Cancer Genome Atlas; RT-qPCR, reverse transcription quantitative polymerase chain reaction.

LINC00184 silencing contributes to repressed proliferation, migration, invasion and colony formation of EC cells and hindered tumour growth

In order to explore the role of LINC00184 in EC cell proliferation, migration, invasion, and colony formation, KYSE450 cells and Eca-109 cells were transfected with oe-LINC00184 or sh-LINC00184 to either over-express or knock down LINC00184. The expression of LINC00184 in KYSE450 cells and Eca-109 cells following transfection was verified by RT-qPCR. The results showed that the expression of LINC00184 was significantly increased after transfection with oe-LINC00184, while it was dramatically decreased by sh-LINC00184 transfection (Fig. 2A, p < .05). In addition, the biological behaviors of cells were tested by EdU assay, would healing assay, Transwell assay, and colony formation assay. The results showed that over-expression of LIN00184 by transfection with oe-LINC00184 dramatically enhanced proliferation, migration, invasion, and colony formation abilities of the cells. In contrast, KYSE450 cells and Eca-109 cells transfected with sh-LINC00184 had relatively attenuated proliferation, migration invasion, and colony formation abilities (Fig. 2B-E, p < .05). Further, in order to investigate the effects of LINC00184 on EC cell in vivo, KYSE450 cells or Eca-109 cells transfected with oe-LINC00184 or sh-LINC00184 were injected into the nude mice to observe the tumour growth. The results revealed that with time went by, the mice injected with oe-LINC00184-transfected KYSE450 cells or Eca-109 cells had lager tumours with increased tumour weight (p < .05) while the mice injected with sh-LINC00184-transfected KYSE450 cells or Eca-109 cells exhibited smaller tumours with decreased tumour weight (p < .05) (Fig. 2F). These results suggest that LINC00184 silencing inhibits the EC progression in vitro and suppresses tumour growth in vivo.
Fig. 2

EC cell proliferation, migration, invasion, and colony formation in vitro as well as tumour growth in vivo are suppressed by LINC00184 depletion. (A) LINC00184 expression in KYSE450 cells and Eca-109 cells after transfection with oe-LINC00184 or sh-LINC00184 evaluated by RT-qPCR. (B) The proliferation ability of KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184 determined by EdU assay (×200). (C) The migration ability of KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184 assessed by wound healing assay. (D) The invasion ability of KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184 evaluated by Transwell assay (×200). (E) The colony formation ability of KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184 tested by colony formation assay. (F) Tumour volume and weight in mice injected with oe-LINC00184 or sh-LINC00184-transfected KYSE450 cells or Eca-109 cells. ⁎p < .05 vs. the KYSE450 or Eca-109 cells transfected with oe-NC. #p < .05 vs. the KYSE450 cells or Eca-109 cells transfected with sh-NC. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The unpaired Student's t-test was conducted for comparison between two groups. EC, esophageal cancer; LINC00184, Long intergenic non-protein coding RNA 184; RT-qPCR, reverse transcription quantitative polymerase chain reaction; EdU, 5-Ethynyl-2′-deoxyuridine; NC, negative control.

EC cell proliferation, migration, invasion, and colony formation in vitro as well as tumour growth in vivo are suppressed by LINC00184 depletion. (A) LINC00184 expression in KYSE450 cells and Eca-109 cells after transfection with oe-LINC00184 or sh-LINC00184 evaluated by RT-qPCR. (B) The proliferation ability of KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184 determined by EdU assay (×200). (C) The migration ability of KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184 assessed by wound healing assay. (D) The invasion ability of KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184 evaluated by Transwell assay (×200). (E) The colony formation ability of KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184 tested by colony formation assay. (F) Tumour volume and weight in mice injected with oe-LINC00184 or sh-LINC00184-transfected KYSE450 cells or Eca-109 cells. ⁎p < .05 vs. the KYSE450 or Eca-109 cells transfected with oe-NC. #p < .05 vs. the KYSE450 cells or Eca-109 cells transfected with sh-NC. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The unpaired Student's t-test was conducted for comparison between two groups. EC, esophageal cancer; LINC00184, Long intergenic non-protein coding RNA 184; RT-qPCR, reverse transcription quantitative polymerase chain reaction; EdU, 5-Ethynyl-2′-deoxyuridine; NC, negative control.

Silencing of LINC00184 inhibits aerobic glycolysis while promotes mitochondrial OXPHOS in EC cells

In the presence of sufficient oxygen, tumour cells mainly dependent on glycolysis for energy production, which is critical for tumour cell growth and proliferation [17]. In order to investigate the effect of LINC00184 on the metabolic state of EC cells, LINC00184 was over-expressed and silenced in EC KYSE450 cells and Eca-109 cells to assess glycolysis and mitochondrial OXPHOS. Lactic acid is the final product of glycolysis pathway. The lactic acid produced by glycolysis pathway does not enter other metabolic pathways in cells, but accumulates in cells or is expelled by specific transporters. Therefore, the content of lactic acid in cells is one of the important biochemical indexes for glycolysis determination [18]. We analysed glucose consumption and lactic acid production. We found that over-expression of LINC00184 noticeably increased glucose consumption and lactic acid production in KYSE450 cells and Eca-109 cells, while silencing of LINC00184 exhibited inhibitory effects on those (Fig. 3A-B, p < .05). These results indicate that silencing of LINC00184 could inhibit the glycolysis in EC cells. The ratio of glucose uptake to lactic acid secretion was 1:2 during the process of glycolysis, so the proportion of glucose for glycolysis in total glucose consumption was calculated on the basis of lactic acid production. It was found that silencing of LINC00184 decreased the proportion of glucose for glycolysis in the total glucose consumption (Fig. 3C, p < .05).
Fig. 3

LINC00184 modulates the glucose metabolism of EC cells. (A) Glucose consumption in KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184. (B) Lactic acid production in KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184. (C) The proportion of consumed glucose for glycolysis in KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184. (D and E) The protein expression of mitochondrial COMPLEX II, III, IV and V subunits in KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184 measured by Western blot analysis. (F) ATP levels in the supernatant of KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184 by ATP kit. ⁎p < .05 vs. the KYSE450 cells or Eca-109 cells transfected with oe-NC. #p < .05 vs. the KYSE450 cells or Eca-109 cells transfected with sh-NC. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The unpaired Student's t-test was conducted for comparison between two groups. EC, esophageal cancer; LINC00184, long intergenic non-protein coding RNA 184; ATP, adenosine triphosphate; NC, negative control.

LINC00184 modulates the glucose metabolism of EC cells. (A) Glucose consumption in KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184. (B) Lactic acid production in KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184. (C) The proportion of consumed glucose for glycolysis in KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184. (D and E) The protein expression of mitochondrial COMPLEX II, III, IV and V subunits in KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184 measured by Western blot analysis. (F) ATP levels in the supernatant of KYSE450 cells and Eca-109 cells after over-expression or silencing of LINC00184 by ATP kit. ⁎p < .05 vs. the KYSE450 cells or Eca-109 cells transfected with oe-NC. #p < .05 vs. the KYSE450 cells or Eca-109 cells transfected with sh-NC. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The unpaired Student's t-test was conducted for comparison between two groups. EC, esophageal cancer; LINC00184, long intergenic non-protein coding RNA 184; ATP, adenosine triphosphate; NC, negative control. These results suggested that the glucose consumption for OXPHOS may increase after silencing LINC00184 and mitochondrial OXPHOS may be partially restored. Moreover, the expression of mitochondrial COMPLEX II, III, IV and V subunits (COMPLEX II-SDHB, COHPLEX III-UQCRC2, COMPLEX IV-COXII and COMPLEX V-ATP5A) was measured by Western blot analysis. The results displayed that expression of the above mitochondrial COMPLEX II, III, IV and V subunits in KYSE450 cells and Eca-109 cells markedly reduced after over-expression of LINC00184. In contrast, silencing of LINC00184 increased the expression of those mitochondrial COMPLEX II, III, IV and V subunits (Fig. 3D-E, p < .05). It was suggested that silencing LINC00184 could restore the expression of the key proteins of mitochondrial complex. Furthermore, ATP level in KYSE450 cells and Eca-109 cells was reduced dramatically after up-regulation of LINC00184, but increased dramatically by silencing of LINC00184 (Fig. 3F, p < .05). Taken together, LINC00184 could mediate the metabolic level of EC cells, and silencing of LINC00184 exerts an inhibitory effect on the abnormal aerobic glycolysis of EC cells and restores mitochondrial OXPHOS function, thus reversing the abnormal glucose metabolism that occurs in the EC cells.

LINC00184 negatively regulates PTEN in EC

PTEN has been recognised as one of the most commonly mutated tumour suppressors in human cancer [19]. RT-qPCR and Western blot assays were adopted to characterise PTEN expression in EC and adjacent normal tissues. It was found that the expression of PTEN in EC tissues was dramatically lower than in the adjacent normal tissues (Fig. 4A-C, p < .05). Pearson's correlation analysis showed that the expression of LINC00184 was negatively correlated with PTEN expression in EC (Fig. 4D, p < .05). In order to further verify the relationship between LINC00184 and PTEN, we over-expressed or silenced LINC00184 in EC cells. It was displayed that the expression of PTEN in EC cells was reduced dramatically after up-regulation of LINC00184 but remarkably elevated by silencing of LINC00184 (Fig. 4E-G, p < .05). The results depict that PTEN is poorly expressed in EC and the expression of LINC00184 was negatively correlated with that of PTEN.
Fig. 4

LINC00184 shares a negative association with PTEN in EC. (A) The mRNA expression of PTEN in EC and adjacent normal tissues determined by RT-qPCR. (B and C) The protein expression of PTEN in EC and adjacent normal tissues assessed by Western blot analysis. &p < .05 vs. adjacent normal tissues. n = 84. (D) Pearson's correlation analysis of LINC00184 and PTEN expression in EC cells. (E) The mRNA expression of PTEN in EC cells after over-expression or silencing of LINC00184 examined by RT-qPCR. (F-G) The protein expression of PTEN in EC cells after over-expression or silencing of LINC00184 measured by Western blot analysis. ⁎p < .05 vs. the KYSE450 cells transfected with oe-NC. #p < .05 vs. the KYSE450 cells transfected with sh-NC. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The paired t-test was used for comparison between two groups (in panel A and C). The unpaired Student's t-test was conducted for comparison between two groups (in panel E and G). EC, esophageal cancer; LINC00184, Long intergenic non-protein coding RNA 184; PTEN, phosphatase and tensin homolog; RT-qPCR, reverse transcription quantitative polymerase chain reaction; NC, negative control.

LINC00184 shares a negative association with PTEN in EC. (A) The mRNA expression of PTEN in EC and adjacent normal tissues determined by RT-qPCR. (B and C) The protein expression of PTEN in EC and adjacent normal tissues assessed by Western blot analysis. &p < .05 vs. adjacent normal tissues. n = 84. (D) Pearson's correlation analysis of LINC00184 and PTEN expression in EC cells. (E) The mRNA expression of PTEN in EC cells after over-expression or silencing of LINC00184 examined by RT-qPCR. (F-G) The protein expression of PTEN in EC cells after over-expression or silencing of LINC00184 measured by Western blot analysis. ⁎p < .05 vs. the KYSE450 cells transfected with oe-NC. #p < .05 vs. the KYSE450 cells transfected with sh-NC. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The paired t-test was used for comparison between two groups (in panel A and C). The unpaired Student's t-test was conducted for comparison between two groups (in panel E and G). EC, esophageal cancer; LINC00184, Long intergenic non-protein coding RNA 184; PTEN, phosphatase and tensin homolog; RT-qPCR, reverse transcription quantitative polymerase chain reaction; NC, negative control.

LINC00184 regulates PTEN expression through DNA methyltransferase 1 (DNMT1)-mediated PTEN promoter methylation

In order to further study the relationship between LINC00184 and PTEN, we detected the subcellular location of LINC00184 in cells and the results showed that LINC00184 was expressed in both the nuclear and the cytoplasm and more deeper-stained fluorescence was observed when transfected with oe-LINC00184 (Fig. 5A). Next, we characterised the nuclear and cytoplasmic expression of LINC00184, which displayed the presence of LINC00184 in both the nuclei and the cytoplasm (Fig. 5B). Additionally, online comparison through BLAST found that LINC00184 may bind to PTEN promoter in RNA-DNA manner (Fig. 5C), revealing that LINC00184 may function as a transcriptional regulator in the nucleus. A recent study has shown that DNMT1 is a major maintenance DNA methyltransferase in animals and regulate the DNA methylation to alter gene expression [20]. CpG islands were observed in the PTEN promoter by bioinformatic analysis using MethPrimer website (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi) (Fig. 5D). Then, MSP assay was performed to evaluate the methylation status of PTEN in EC tissues and EC cells. The results illustrated that the PTEN promoter methylation level in EC tissues was higher than that in adjacent normal tissues, and the EC cells over-expressing LINC00184 exhibited a higher PTEN promoter methylation level than oe-NC-transfected EC cells. In contrast, the PTEN methylation level in EC cells transfected with sh-LINC00184 was lower than that in cells transfected with sh-NC (Fig. 5E). Next, in order to study the enrichment of DNMT1 in the promoter region of PTEN, the CHIP assay was conducted after over-expression and silencing of LINC00184 in EC cells. The results demonstrated that more DNMT1 was enriched in PTEN promoter after over-expression of LINC00184, while the opposite effect was observed after silencing LINC00184 (p < .05) (Fig. 5F). The RNA pull-down assay further verified that LINC00184 could recruit DNMT1 (Fig. 5G). Besides, RIP assay revealed that there is an elevation in the enrichment of LINC00184 by DNMT1 after over-expression of LINC00184, whereas a decline after LINC00184 was silenced (p < .05) (Fig. 5H). These results indicate that LINC00184 promotes the methylation of PTEN promoter by recruiting DNMT1 to PTEN promoter, ultimately suppressing the expression of PTEN.
Fig. 5

By recruiting DNMT1 to PTEN promoter region, LINC00184 up-regulates the methylation of PTEN promoter and ultimately down-regulates its expression. (A) Subcellular localization of LINC00184 in EC cells detected using FISH (× 400). (B) Nuclear/cytoplasmic expression of LINC00184 in EC cells measured by RT-qPCR. (C) The binding relationship between LINC00184 and the PTEN promoter verified using BLAST. (D) prediction of CpG island enrichment in PTEN promoter region by the MethPrimer website. (E) Determination of methylation level in EC tissues and cells by MSP assay. (F) The enrichment of DNMT1 in PTEN promoter region assessed by CHIP assay, and quantified by RT-qPCR. (G) The binding relationship between LINC00184 and DNMT1 examined by RNA pull-down. (H) The enrichment of LINC00184 by DNMT1 assessed by RIP assay, and quantified by RT-qPCR. ⁎p < .05 vs. the KYSE450 cells transfected with oe-NC. #p < .05 vs. the KYSE450 cells transfected with sh-NC. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The unpaired Student's t-test was conducted for comparison between two groups. DNMT1, DNA methyltransferase-1; MSP, methylation specific PCR; RIP, RNA immunoprecipitation; EC, esophageal cancer; LINC00184, long intergenic non-protein coding RNA 184; PTEN, phosphatase and tensin homolog; RT-qPCR, reverse transcription quantitative polymerase chain reaction; NC, negative control; FISH, fluorescence in situ hybridization.

By recruiting DNMT1 to PTEN promoter region, LINC00184 up-regulates the methylation of PTEN promoter and ultimately down-regulates its expression. (A) Subcellular localization of LINC00184 in EC cells detected using FISH (× 400). (B) Nuclear/cytoplasmic expression of LINC00184 in EC cells measured by RT-qPCR. (C) The binding relationship between LINC00184 and the PTEN promoter verified using BLAST. (D) prediction of CpG island enrichment in PTEN promoter region by the MethPrimer website. (E) Determination of methylation level in EC tissues and cells by MSP assay. (F) The enrichment of DNMT1 in PTEN promoter region assessed by CHIP assay, and quantified by RT-qPCR. (G) The binding relationship between LINC00184 and DNMT1 examined by RNA pull-down. (H) The enrichment of LINC00184 by DNMT1 assessed by RIP assay, and quantified by RT-qPCR. ⁎p < .05 vs. the KYSE450 cells transfected with oe-NC. #p < .05 vs. the KYSE450 cells transfected with sh-NC. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The unpaired Student's t-test was conducted for comparison between two groups. DNMT1, DNA methyltransferase-1; MSP, methylation specific PCR; RIP, RNA immunoprecipitation; EC, esophageal cancer; LINC00184, long intergenic non-protein coding RNA 184; PTEN, phosphatase and tensin homolog; RT-qPCR, reverse transcription quantitative polymerase chain reaction; NC, negative control; FISH, fluorescence in situ hybridization.

Inhibition of PTEN methylation suppresses proliferation, migration, glycolysis and recovers mitochondrial OXPHOS in EC cells

To investigate whether PTEN methylation involved in the regulation of LINC00184 in aerobic glycolysis and the mitochondrial OXPHOS capacity in EC cells, PTEN was demethylated by treatment with a DNMT inhibitor, 5-aza-dc. The data revealed that the methylation level of PTEN in EC cells decreased and the expression of PTEN increased noticeably after treatment with 5-aza-dc. The PTEN promoter methylation level increased and PTEN expression decreased noticeably after over-expression of LINC00184, the effect of LINC00184 over-expression on PTEN promoter methylation and PTEN expression was reversed by 5-aza-dc treatment (Fig. 6A-B). Additionally, we investigated the effects of PTEN methylation on proliferation, migration, glycolysis and mitochondrial OXPHOS of EC cells. When treated with 5-aza-dc, the proliferation and migration of EC cells slowed down dramatically, abnormal aerobic glycolysis was inhibited, and mitochondrial OXPHOS capacity was recovered. Meanwhile, similar effects were achieved by over-expression of PTEN in EC cells. However, 5-aza-dc treatment reversed the roles of LINC00184 over-expression in promoting proliferation and migration of EC cells and abnormal glycolysis in EC, and in turns restored the mitochondrial OXPHOS capacity (Fig. 6C-J). All these results indicate that over-expression of LINC00184 induced PTEN promoter methylation, while inhibition of PTEN methylation suppresses proliferation, migration and abnormal aerobic glycolysis of EC cells and promotes mitochondrial OXPHOS recovery.
Fig. 6

Inhibition of PTEN methylation leads to repressed proliferation, migration, glycolysis and elevated mitochondrial OXPHOS capacity of EC cells. (A) Determination of methylation level in EC cells treated with DNMT inhibitor and oe-LINC00184 or either alone by MSP assay. (B) The PTEN expression in EC cells treated with DNMT inhibitor and oe-LINC00184 or either alone measured by RT-qPCR and Western blot assay. (C)The proliferation ability of EC cells treated with oe-PTEN, oe-LINC00184 and/or 5-aza-dc assessed by EdU assay (×200). (D) The migration ability of EC cells treated with oe-PTEN, oe-LINC00184 and/or 5-aza-dc, evaluated by wound healing assay. (E) Glucose consumption in EC cells treated with oe-PTEN, oe-LINC00184 and/or 5-aza-dc, quantified by hexokinase assay. (F)The lactic acid production in EC cells treated with oe-PTEN, oe-LINC00184 and/or 5-aza-dc. (G) Proportion of consumed glucose for glycolysis in glucose metabolism in response to the treatment of oe-PTEN, oe-LINC00184 and/or 5-aza-dc. (H and I) The protein expression of key proteins of mitochondrial complex in EC cells treated with oe-PTEN, oe-LINC00184 and/or 5-aza-dc determined by Western blot analysis. (J) ATP levels in the supernatant of EC cells treated with oe-PTEN, oe-LINC00184 and/or 5-aza-dc by ATP kit. ⁎p < .05 vs. the KYSE450 cells treated with DMSO. #p < .05 vs. the KYSE450 cells introduced with oe-NC. &p < .05 vs. the KYSE450 cells introduced with oe-LINC00184. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The unpaired Student's t-test was conducted for comparison between two groups. DNMT1, DNA methyltransferase-1; OXPHOS, oxidative phosphorylation; EC, esophageal cancer; LINC00184, long intergenic non-protein coding RNA 184; PTEN, phosphatase and tensin homolog; RT-qPCR, reverse transcription quantitative polymerase chain reaction; NC, negative control; ATP, adenosine triphosphate; DMSO, dimethylsulfoxide; EdU, 5-Ethynyl-2′-deoxyuridine.

Inhibition of PTEN methylation leads to repressed proliferation, migration, glycolysis and elevated mitochondrial OXPHOS capacity of EC cells. (A) Determination of methylation level in EC cells treated with DNMT inhibitor and oe-LINC00184 or either alone by MSP assay. (B) The PTEN expression in EC cells treated with DNMT inhibitor and oe-LINC00184 or either alone measured by RT-qPCR and Western blot assay. (C)The proliferation ability of EC cells treated with oe-PTEN, oe-LINC00184 and/or 5-aza-dc assessed by EdU assay (×200). (D) The migration ability of EC cells treated with oe-PTEN, oe-LINC00184 and/or 5-aza-dc, evaluated by wound healing assay. (E) Glucose consumption in EC cells treated with oe-PTEN, oe-LINC00184 and/or 5-aza-dc, quantified by hexokinase assay. (F)The lactic acid production in EC cells treated with oe-PTEN, oe-LINC00184 and/or 5-aza-dc. (G) Proportion of consumed glucose for glycolysis in glucose metabolism in response to the treatment of oe-PTEN, oe-LINC00184 and/or 5-aza-dc. (H and I) The protein expression of key proteins of mitochondrial complex in EC cells treated with oe-PTEN, oe-LINC00184 and/or 5-aza-dc determined by Western blot analysis. (J) ATP levels in the supernatant of EC cells treated with oe-PTEN, oe-LINC00184 and/or 5-aza-dc by ATP kit. ⁎p < .05 vs. the KYSE450 cells treated with DMSO. #p < .05 vs. the KYSE450 cells introduced with oe-NC. &p < .05 vs. the KYSE450 cells introduced with oe-LINC00184. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The unpaired Student's t-test was conducted for comparison between two groups. DNMT1, DNA methyltransferase-1; OXPHOS, oxidative phosphorylation; EC, esophageal cancer; LINC00184, long intergenic non-protein coding RNA 184; PTEN, phosphatase and tensin homolog; RT-qPCR, reverse transcription quantitative polymerase chain reaction; NC, negative control; ATP, adenosine triphosphate; DMSO, dimethylsulfoxide; EdU, 5-Ethynyl-2′-deoxyuridine.

The LINC00184/PTEN/Akt axis modulates proliferation, migration, glycolysis and mitochondrial OXPHOS in EC cells

In order to study the effect of LINC00184/PTEN on Akt phosphorylation, either LINC00184 or PTEN was over-expressed in EC cells. The extent of Akt phosphorylation in EC cells enhanced noticeably after over-expression of LINC00184, and decreased remarkably after over-expression of PTEN. Silencing of LINC00184 reduced the extent of Akt phosphorylation in EC cells. It was found that over-expression of PTEN could reverse the promoting effect of LINC00184 on Akt phosphorylation in EC cells (Fig. 7A-B). To investigate whether Akt phosphorylation involved in the proliferation, migration, glycolysis and mitochondrial OXPHOS of EC cells, EC cells over-expressing LINC00184 were treated with Akt phosphorylation inhibitor, LY294002 to block Akt signaling pathway. The results showed that additional treatment of LY294002 inhibited noticeably the proliferation and migration of EC cells over-expressing LINC00184 (Fig. 7C-D), suppressed abnormal aerobic glycolysis (Fig. 7E-G), restored mitochondrial OXPHOS capacity (Fig. 7H-J). These results confirm that the LINC00184/PTEN axis modulates the proliferation, migration, glycolysis and mitochondrial OXPHOS of EC cells through regulating Akt phosphorylation.
Fig. 7

Cell proliferation, migration, glycolysis and mitochondrial OXPHOS in EC is regulated LINC00184/PTEN/Akt axis. (A and B) The protein expression of Akt and the extent of Akt phosphorylation in EC cells determined by Western blot analysis. (C) The proliferation ability of EC cells transfected with oe-LINC00184 in addition to DMSO or LY294002 treatment evaluated by EdU assay (×200). (D) The migration ability of EC cells transfected with oe-LINC00184 in addition to DMSO or LY294002 treatment assessed by wound healing assay. (E) Determination of glucose consumption in EC cells transfected with oe-LINC00184 in addition to DMSO or LY294002 treatment quantified by hexokinase assay. (F) The lactic acid production in EC cells transfected with oe-LINC00184 with or without LY294002 treatment. (G) Proportion of glycolysis flux in glucose metabolism in response to the combined treatment of DMSO or LY294002 with oe-LINC00184. (H and I) The protein expression of key proteins of mitochondrial complex in EC cells transfected with oe-LINC00184 with or without LY294002 treatment determined by Western blot analysis. (J) ATP levels in the supernatant of EC cells transfected with oe-LINC00184 with or without LY294002 treatment. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The one-way analysis of variance was used for comparison among multiple groups, followed by Tukey's post hoc test (in panel B). The unpaired Student t-test was used for comparison between two groups (in panel C-J). ⁎p < .05 vs. the KYSE450 cells transfected with oe-NC. #p < .05 vs. the KYSE450 cells transfected with oe-LINC00184. &p < .05 vs. the KYSE450 cells transfected with oe-LINC00184 + DMSO. OXPHOS, oxidative phosphorylation; EC, esophageal cancer; LINC00184, long intergenic non-protein coding RNA 184; PTEN, phosphatase and tensin homolog; RT-qPCR, reverse transcription quantitative polymerase chain reaction; NC, negative control; ATP, adenosine triphosphate; DMSO, dimethylsulfoxide; EdU, 5-Ethynyl-2′-deoxyuridine.

Cell proliferation, migration, glycolysis and mitochondrial OXPHOS in EC is regulated LINC00184/PTEN/Akt axis. (A and B) The protein expression of Akt and the extent of Akt phosphorylation in EC cells determined by Western blot analysis. (C) The proliferation ability of EC cells transfected with oe-LINC00184 in addition to DMSO or LY294002 treatment evaluated by EdU assay (×200). (D) The migration ability of EC cells transfected with oe-LINC00184 in addition to DMSO or LY294002 treatment assessed by wound healing assay. (E) Determination of glucose consumption in EC cells transfected with oe-LINC00184 in addition to DMSO or LY294002 treatment quantified by hexokinase assay. (F) The lactic acid production in EC cells transfected with oe-LINC00184 with or without LY294002 treatment. (G) Proportion of glycolysis flux in glucose metabolism in response to the combined treatment of DMSO or LY294002 with oe-LINC00184. (H and I) The protein expression of key proteins of mitochondrial complex in EC cells transfected with oe-LINC00184 with or without LY294002 treatment determined by Western blot analysis. (J) ATP levels in the supernatant of EC cells transfected with oe-LINC00184 with or without LY294002 treatment. The experiment was repeated 3 times independently. Statistical data were measurement data, and described as mean ± standard deviation. The one-way analysis of variance was used for comparison among multiple groups, followed by Tukey's post hoc test (in panel B). The unpaired Student t-test was used for comparison between two groups (in panel C-J). ⁎p < .05 vs. the KYSE450 cells transfected with oe-NC. #p < .05 vs. the KYSE450 cells transfected with oe-LINC00184. &p < .05 vs. the KYSE450 cells transfected with oe-LINC00184 + DMSO. OXPHOS, oxidative phosphorylation; EC, esophageal cancer; LINC00184, long intergenic non-protein coding RNA 184; PTEN, phosphatase and tensin homolog; RT-qPCR, reverse transcription quantitative polymerase chain reaction; NC, negative control; ATP, adenosine triphosphate; DMSO, dimethylsulfoxide; EdU, 5-Ethynyl-2′-deoxyuridine.

Discussion

Capable of serving as promising diagnostic or prognostic biomarkers for EC, lncRNAs are reported to emerge as new targets for clinical therapy of EC [21]. We demonstrated that knockdown of LINC00184 decreased glycolysis, cell proliferation and migration, while restored mitochondrial OXPHOS capacity by up-regulating DNMT1-mediated PTEN expression. In this study, the loss of LINC00184 was found to increase COMPLEX II-SDHB, COHPLEX III-UQCRC2, COMPLEX IV-COXII, and COMPLEX V-ATP5A as well as ATP, suggesting LINC00184 regulated the glycometabolism in EC. Impaired mitochondrial OXPHOS capacity, along with elevated glycolysis, is a crucial metabolic feature of cancer cells, but molecular mechanisms remain undefined [22]. A study conducted by Zhang et al. suggested that lncRNA MIF exerts its suppressive role by modulating c-Myc-regulated glycolysis and tumourigenesis [23]. In gynecological cancer cells, lncRNA SNHG3 was also involved in these energy metabolism [24]. Moreover, lncRNA H19 was able to promote cell proliferation and glucose metabolism in melanoma [25]. Similarly, the present study provides evidence that LINC00184 silencing contributed to improve OXPHOS and repressed aerobic glycolysis in EC cells. Mechanically, there was a study highlighted the important roles lncRNAs played in the development and progression of EC via epigenetic modification, transcriptional regulation, as well as post-transcriptional regulation [26]. For instance, the qPCR analysis conducted by Li et al. showed that LINCPOU3F3 facilitates ESCC progression through DNA methylation [27]. Our results revealed that LINC00184 promoted the methylation of PTEN and inhibits its expression by recruiting DNMT1 to PTEN promoter region. PTEN was demonstrated as a tumour suppressor in diverse human cancers, such as kidney cancer, melanoma, and endometrial carcinomas [[28], [29], [30]]. Consistently, epigenetic silencing of PTEN gene by promoter hypermethylation is frequently demonstrated as a significant mechanism of PTEN deletion in ESCC [11]. Moreover, DNMT1, a member of the DNA methyltransferase family and a regulator of DNA methylation, is responsible for maintaining self-renewal maintenance of EC stem cells [31,32]. Specifically, it has been postulated that loss of DNMTs, particularly DNMT1, may contribute to a decline of promoter hypermethylation, which leads to restoration of PTEN in activated hepatic stellate cells [33]. In coincident with a previous study that PTEN was observed to be hypermethylated in clinical tissues of ESCC [11], our results indicated that PTEN down-regulation in EC due to the high methylation level of its promoter region. And the expression of PTEN increased dramatically in EC cells treated with the DNMT inhibitor (5-aza-dc), suggesting that DNMT was involved in PTEN methylation. Moreover, Li et al. also presented that the treatment of 5-aza-dc decreased the expression of DNMT1, but increased the expression of lncRNA MEG3 and PTEN [34]. Finally, we observed that the down-regulation of PTEN suppressed Akt phosphorylation in EC cells, while the effect was reversed following 5-aza-dc treatment. PTEN deletion status has been found to be closely correlated with activation of Akt phosphorylation in prostate cancer [35]. Zhu et al. showed that elevated expression of PTEN was associated with reduced level of phosphorylated Akt in ESCC [36]. Furthermore, PTEN improved the sensitivity of ESCC cells to rapamycin through regulating phosphorylation of Akt [37]. Since insulin-stimulated metabolic responses are principally accomplished through PI3K, PTEN exerts a critical function over regulating glucose uptake [38]. It has been demonstrated that phenolic grifolin, a natural DNMT inhibitor, was capable of attenuating glycolytic flux and restoring OXPHOS via the demethylation of the PTEN gene and impeded activation of Akt signaling pathway in nasopharyngeal carcinoma cells [39]. Our study provided evidence that LINC00184 positively regulated PTEN methylation through activation of Akt phosphorylation, which was proposed to be a possible mechanism underlying its function in glycometabolism of EC. As a previous research demonstrated, PTEN was found to play its role in glucose metabolism and mitochondrial function modulation [40]. It was also suggested that loss of PTEN function and activation of Akt signaling pathway result in elevated mitochondrial respiratory capacity and mitochondrial volume [41]. Consistently, our study suggested that inhibition of PTEN methylation or suppression of Akt phosphorylation rescued the abnormal glucose metabolism regulated by LINC00184. However, future studies to understand the conception that LINC00184 regulating glycometabolism associates with the tumourigenesis of EC cells are necessary for the EC treatment. In summary, the data from the present study suggest that LINC00184 promotes glycolysis and impedes mitochondrial OXPHOS in EC cells by up-regulating DNMT1-induced the methylation of PTEN promoter (Fig. 8). LINC00184 knockdown reversed abnormal glycometabolism in EC, thus suggesting a promise target for therapies protecting against EC. Understanding the regulatory mechanism of LINC00184 in EC leads to the identification of new potential therapeutic for EC.
Fig. 8

The proposed regulatory mechanism of LINC00184/DNMT/PTEN/Akt axis in the glucose metabolism of EC. LINC00184 could increase the methylation level of PTEN promoter, decrease PTEN expression, which resulted in Akt phosphorylation, ultimately, glycolysis of EC cells was induced, and mitochondrial OXPHOS capacity was suppressed. OXPHOS, oxidative phosphorylation; EC, esophageal cancer; LINC00184, long intergenic non-protein coding RNA 184; PTEN, phosphatase and tensin homolog; DNMT, DNA methyltransferase-1.

The proposed regulatory mechanism of LINC00184/DNMT/PTEN/Akt axis in the glucose metabolism of EC. LINC00184 could increase the methylation level of PTEN promoter, decrease PTEN expression, which resulted in Akt phosphorylation, ultimately, glycolysis of EC cells was induced, and mitochondrial OXPHOS capacity was suppressed. OXPHOS, oxidative phosphorylation; EC, esophageal cancer; LINC00184, long intergenic non-protein coding RNA 184; PTEN, phosphatase and tensin homolog; DNMT, DNA methyltransferase-1.

Funding

None.

Authors' contributions

Weihao Li and Kai Huang designed the study. Guanghui Cui, Fengbiao Wen, and Haizhou Guo collated the data, carried out data analyses and produced the initial draft of the manuscript. Song Zhao and Zhanfeng He contributed to drafting the manuscript. All authors have read and approved the final submitted manuscript.

Competing interests

None.
  16 in total

Review 1.  Long non-coding RNA-based glycolysis-targeted cancer therapy: feasibility, progression and limitations.

Authors:  Xiaman Wang; Ying Shen; Rui Liu; Aili He
Journal:  Mol Biol Rep       Date:  2021-03-11       Impact factor: 2.316

Review 2.  The biochemical and clinical implications of phosphatase and tensin homolog deleted on chromosome ten in different cancers.

Authors:  Qinyi Wang; Junmin Wang; Hongjiao Xiang; Peilun Ding; Tao Wu; Guang Ji
Journal:  Am J Cancer Res       Date:  2021-12-15       Impact factor: 6.166

3.  Serine 727 phosphorylation is necessary to induce the STAT3-mediated transcription of LINC00184 in oesophageal squamous cell carcinoma.

Authors:  Chengling Jin; Hong Qi; Yue Xu; Shenglei Li
Journal:  Mol Cell Biochem       Date:  2022-03-21       Impact factor: 3.396

4.  Long non-coding RNA G23Rik attenuates fasting-induced lipid accumulation in mouse liver.

Authors:  Donghwan Kim; Bora Kim; Chad N Brocker; Kritika Karri; David J Waxman; Frank J Gonzalez
Journal:  Mol Cell Endocrinol       Date:  2022-07-30       Impact factor: 4.369

Review 5.  The Emerging Role of Long Non-Coding RNAs in Esophageal Cancer: Functions in Tumorigenesis and Clinical Implications.

Authors:  Yali Han; Guo Zhao; Xinhang Shi; Yushan Wang; Xin Wen; Lu Zhang; Xiangqian Guo
Journal:  Front Pharmacol       Date:  2022-05-13       Impact factor: 5.988

Review 6.  Roles of PTEN inactivation and PD-1/PD-L1 activation in esophageal squamous cell carcinoma.

Authors:  Rong Qiu; Wenxi Wang; Juan Li; Yuxiang Wang
Journal:  Mol Biol Rep       Date:  2022-03-17       Impact factor: 2.742

7.  Circular RNA circKIF2A Contributes to the Progression of Neuroblastoma Through Regulating PRPS1 Expression by Sponging miR-377-3p.

Authors:  Quan Jin; Jianmu Li; Fan Yang; Lingling Feng; Xin Du
Journal:  Biochem Genet       Date:  2022-01-18       Impact factor: 2.220

8.  LINC00184 Promotes Ovarian Cancer Cells Proliferation and Cisplatin Resistance by Elevating CNTN1 Expression via Sponging miR-1305.

Authors:  Yuwen Han; Jun You; Yun Han; Yinglei Liu; Menghui Huang; Xiaoyan Lu; Jingjing Chen; Yanli Zheng
Journal:  Onco Targets Ther       Date:  2021-04-19       Impact factor: 4.147

Review 9.  Regulation of Glucose and Lipid Metabolism by Long Non-coding RNAs: Facts and Research Progress.

Authors:  Tie-Ning Zhang; Wei Wang; Ni Yang; Xin-Mei Huang; Chun-Feng Liu
Journal:  Front Endocrinol (Lausanne)       Date:  2020-07-16       Impact factor: 5.555

Review 10.  LncRNA-mediated posttranslational modifications and reprogramming of energy metabolism in cancer.

Authors:  Yue-Tao Tan; Jin-Fei Lin; Ting Li; Jia-Jun Li; Rui-Hua Xu; Huai-Qiang Ju
Journal:  Cancer Commun (Lond)       Date:  2020-10-29
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.