Literature DB >> 31171774

The alteration of RhoA geranylgeranylation and Ras farnesylation breaks the integrity of the blood-testis barrier and results in hypospermatogenesis.

Ruilou Zhu1,2, Jiangnan Wang1, Tianxiang Feng1,2, Xuechun Hu3, Chen Jiang1, Xiuxing Wang1, Kang Li1,2, Yongjuan Sang1,2, Yue Hua1,2, Haixiang Sun4,5, Bing Yao6,7, Chaojun Li8,9.   

Abstract

Non-obstructive azoospermia (NOA) severely affects male infertility, however, the deep mechanisms of this disease are rarely interpreted. In this study, we find that undifferentiated spermatogonial stem cells (SSCs) still exist in the basal compartment of the seminiferous tubules and the blood-testis barrier (BTB) formed by the interaction of neighbor Sertoli cells (SCs) is incomplete in NOA patients with spermatogenic maturation arrest. The adhesions between SCs and germ cells (GCs) are also broken in NOA patients. Meanwhile, the expression level of geranylgeranyl diphosphate synthase (Ggpps), a key enzyme in mevalonate metabolic pathway, is lower in NOA patients than that in obstructive azoospermia (OA) patients. After Ggpps deletion specifically in SCs, the mice are infertile and the phenotype of the SC-Ggpps-/- mice is similar to the NOA patients, where the BTB and the SC-GC adhesions are severely destroyed. Although SSCs are still found in the basal compartment of the seminiferous tubules, fewer mature spermatocyte and spermatid are found in SC-Ggpps-/- mice. Further examination suggests that the defect is mediated by the aberrant protein isoprenylation of RhoA and Ras family after Ggpps deletion. The exciting finding is that when the knockout mice are injected with berberine, the abnormal cell adhesions are ameliorated and spermatogenesis is partially restored. Our data suggest that the reconstruction of disrupted BTB is an effective treatment strategy for NOA patients with spermatogenic maturation arrest and hypospermatogenesis.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 31171774      PMCID: PMC6554403          DOI: 10.1038/s41419-019-1688-9

Source DB:  PubMed          Journal:  Cell Death Dis            Impact factor:   8.469


Introduction

Spermatogenesis is a well-regulated and hierarchical process to ensure prolonged male reproductive capability[1,2]. Sertoli cells (SCs) extend their thin cytoplasm arms around all the germ cells (GCs) to nurture their development and these intercellular associations are maintained throughout the process of spermatogenesis. Mature SCs form three types of intercellular junctions: cadherin-based adherens junctions, occludin-based tight junctions, and connexin-based gap junctions. These junctions are involved in forming the blood–testis barrier (BTB)[3]. The BTB divides seminiferous epithelium into the basal and apical (adluminal) compartments, where the different stages of spermatogenesis take place: the renewal and differentiation of spermatogonial stem cells (SSCs) and the preleptotene stage spermatocyte in the basal compartment, meiosis and spermiogenesis, and spermiation in the adluminal compartment[4]. In addition to BTB, the developing GCs also interact with SCs to form a number of distinct stage-specific junctions[5]. Thus the integrity and architecture of the SCs are critical for the orderly progression of spermatogenesis[6,7]. In varicocele patients, dysfunction of spermatogenesis may be associated with BTB disruption[8]. Non-obstructive azoospermia (NOA) patients carried the WT1 mutant, and WT1 loss of function in mouse SCs led to BTB structural damage, which in turn resulted in GCs death[9]. According to previous report, undifferentiated spermatogonia was able to survive when the BTB was disrupted, and they were sufficient to restore spermatogenesis theoretically[10]. An in vitro study also demonstrated that SSCs isolated from obstructive azoospermia (OA) and NOA patients had high developmental capacity when supported with extracellular matrix (ECM) components[11]. These findings suggested the possibility that amelioration of disrupted BTB would restore spermatogenesis in NOA patients. Based on our previous study of patients with male infertility who had been infected with the mumps virus before puberty, geranylgeranyl diphosphate synthase (Ggpps) deficiency in the SCs could induce excessive cytokine and chemokine synthesis, and result in the invasion of macrophage into seminiferous tubule during puberty when BTB was not completely formed. The macrophages in the seminiferous tubule would lead to the developing GCs death when they penetrated into the adluminal compartment and subsequently resulted in infertility in adult mice[12]. GGPPS is a branch point enzyme in the mevalonate pathway that catalyzes the synthesis of GGPP from farnesyl diphosphate (FPP)[13], which can prenylate signaling proteins such as Ras family. Herein, we demonstrate that deletion of Ggpps in the SCs results in the destruction of the BTB and SC–GC adhesions through affecting the distribution of adhesion proteins in seminiferous tubules. Studies in Drosophila stem cells have shown that cadherins were indispensable for the stem cell–niche interaction[14] and the downregulation of N-cadherin promoted germline stem cells (GSCs) differentiation by displacing GSCs away from the niche[15], indicating that N-cadherin maintains the GSC pool. We speculated that this kind of regulation may be involved in maintaining the SSC pool in mammal. In this study, we demonstrate that the integrity of BTB is critical for spermatogenesis because the structure not only seals the GCs from the immune system as previous report, but also determines the distinct interactions between the SCs and the GCs at different developmental stages. We also explore the possibility that berberine could restore spermatogenesis via resealing the damaged BTB and propose that amelioration of disrupted BTB may be an effective strategy for the treatment of male infertility.

Materials and methods

Study approval

Mice were housed according to mouse welfare and ethics of Nanjing University in groups with 12-h dark–light cycles and free access to food and water. The experimental animal facility has been accredited by Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC) and all animal protocols used in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of Model Animal Research Center of Nanjing University. We collected 18 NOA patients and 5 OA patients, respectively, to perform immunofluorescence and immunohistochemistry staining and seven NOA patients and three OA patients, respectively, to perform qRT-PCR. We obtained patient consent and approval beforehand for the use of clinical samples, which were from Nanjing General Hospital and used for research purposes only. All the studies abide by the Declaration of Helsinki principles PCR templates and primers used for gene manipulation

Mice and tissues

We generated Sertoli cell-specific Ggpps deletion mice by crossing AMH-Cre transgenic mice[16] with Ggpps mice. No significant difference of fertility and weight were observed among heterozygous and wild-type mice from the same litter. Therefore, we used the heterozygous as controls in the present study. The reproductive capacity was determined by mating one male with three C57BL/6 females as previously published[17]. Genotyping was conducted by using PCR (the primers for the PCR and the qRT-PCR analyses are indicated in Table S1). The sperm production was determined by dissecting epididymis in 1X PBS, then incubating at 37 °C for 0.5 h and counting the number of sperm under a microscope. The protocol for isolating primary SCs was performed as previously reported[18,19]. Testis were fixed in 4% paraformaldehyde and embedded in paraffin, sectioned (5 μm), and placed on slides for immunofluorescence, immunohistochemistry, and Tunel assay (Table 1).
Table 1

PCR templates and primers used for gene manipulation

Gene symbolForward primer (5′–3′)Reverse primer (5′–3′)
Cre GCGGTCTGGCAGTAAAAACTATCAATTGTGTGTGGTAGGGGTA
Loxp GTGAAACAGCATTGCTGTCACTTAACTTGCTTCAGAACTGAGC
mGGPPS TTCACCAACACCTGTAACTCTTATTGACAAGCCCAGAGC
hGGPPS TGGAGAAGACTCAAGAAACAGTCAGCCAATGATTAAATGCC
Cldn11 ATGGTAGCCACTTGCCTTCAGAGTTCGTCCATTTTTCGGCAG
TJP1 ACCACCAACCCGAGAAGACCAGGAGTCATGGACGCACA
Cldn4 GTCCTGGGAATCTCCTTGGCTCTGTGCCGTGACGATGTTG

Histology, immunofluorescence, Tunel assays, and biotin permeability assay

Hematoxylin & eosin (H&E) staining was performed on testis sections of the control and knockout mice as described previously[20]. For immunohistochemistry and immunofluorescence staining, paraffin sections were de-paraffinized, rehydrated, and boiled in citrate buffer (pH 6.0) to retrieve antigens. Then, paraffin sections and frozen sections were permeabilized, blocked, and incubated with the indicated primary antibodies at 4 °C overnight. Subsequently, the sections were incubated with secondary antibodies for 1 h at room temperature. We analyzed the spermatogenesis progression using GC marker MVH[21], SSC marker Plzf[22], spermtocyte marker Sycp3[23], and round spermatid marker acrosin[24]. A biotin assay for BTB integrity was performed as previously described[25].

mRNA and protein expression assays, immunoprecipitation

Total RNA was isolated from the testis and primary Sertoli cells using Trizol reagent (Takara), and the cDNA was synthesized with the PrimeScriptTM RT Master Mix (Takara) according to the manufacturer’s protocol. Quantitative PCR was performed with the SYBRTM Select Master Mix (Applied Biosystems) using the Applied Biosystems 7300 Real-Time PCR system. The relative mRNA level values were normalized to β-actin to calculate fold-changes in expression. To analyze protein expression, the cells or testis were washed in ice-cold PBS and harvested using RIPA buffer supplemented with protease inhibitors. The resulting supernatant fraction was homogenized in 1x SDS–PAGE sample buffer and boiled for 5 min at 99 °C. For the immunoblotting, proteins were separated on an SDS–PAGE gel and transferred to a polyvinylidene difluoride (PVDF) membrane. Membranes were blocked and incubated with the indicated primary antibody overnight at 4 °C. Bound primary antibodies were detected by HRP-conjugated secondary antibodies and a chemiluminescent substrate. For immunoprecipitation, testis were extracted using IP buffer and the lysates were centrifuged at 12,000 × g for 15 min. The supernatant was incubated with the primary antibody RhoA and Cdc42 overnight at 4 °C. The immune complexes were immunoprecipitated using protein A/G agarose beads. After several washes, the samples were boiled and analyzed using western blot. The RhoA activity was determined by using the appropriate activation Assay Kit purchased from NewEast Biosciences.

Cell culture

The isolation of the primary SCs was performed as previously described. SCs were cultured in DMEM/F12 medium containing 10% FBS with penicillin (100 U/ml) and streptomycin (100 mg/ml). The cells were maintained in a humidified atmosphere that contained 5% CO2 at 37 °C for 24 h. After incubation, the cells were treated with a hypotonic solution (20 mM Tris, pH 7.4) for 1 min to remove the spermatogenic cells adhered to the Sertoli cells. After a 24-h culture, the SCs were collected for RNA and protein extraction.

Triton X-114 extraction of hydrophobic proteins

Hydrophobic and hydrophilic proteins were purified using Triton X-114 extraction to determine the membrane localization of the small GTPase. In brief, testis or primary Sertoli cell were homogenized in Triton X-114 lysis buffer and the lysates were centrifuged at 12,000 × g for 15 min at 4 °C. The supernatant was incubated at 37 °C for 5 min until the lysate became turbid and was centrifuged at 12,000 × g for 5 min at room temperature. The upper phase was an aqueous phase containing hydrophilic proteins (water-soluble small G protein), and the lower phase was a detergent phase containing hydrophobic proteins (lipid-soluble small G protein). The ratio of hydrophobic/hydrophilic proteins shows the altered membrane association of small G proteins.

Statistical analysis

All data were presented as the mean ± s.e.m. Statistical comparisons were performed with unpaired two-tailed Student’s t-test. ANOVA and Student’s t tests were carried out in GraphPad Prism5. In all cases, statistical significance was indicated as *p < 0.05 or **p < 0.01.

Results

The BTB structure and the cell–cell adhesion are disrupted in the NOA patients

There are different types of NOA: Sertoli cell only, maturation arrest, and hypospermatogenesis[26], whose spermatogenesis is impeded and sperm production is largely disturbed (Fig. S1). We identified that the positive staining of GC marker MVH were able to be found in the basal compartment of NOA samples with both maturation arrest and hypospermatogenesis, but the number of the positive staining in NOA patients was decreased compared to the OA patients (Figs. 1a and S2A). These Plzf-positive staining cells in the basal compartment of the seminiferous epithelium in both the OA and NOA patients were undifferentiated spermatogonia, and the number of the Plzf-positive staining was similar in OA and NOA patients (Figs. 1b and S2B). To determine how the cellular junctions in the OA and NOA patients were situated, we investigated the distribution of ZO-1, a component of the BTB, and the distribution of N-cadherin responsible for adhesion between the SCs and GCs. We found that the structure of the BTB was incomplete in the seminiferous tubule of the NOA patients, while it was intact in the OA patients (Fig. 1c). The N-cadherin distribution in the OA patients was orderly on the cell surface of GCs but in the NOA patients was disorganized (Fig. 1d). Our studies suggested that the BTB and the SC–GC adhesions were disrupted, which might lead to spermatogenesis arrest in the NOA patients.
Fig. 1

Disruption of the blood–testis barrier leads to spermatogenesis arrest in NOA patients.

a, b Immunofluorescence of GC marker MVH and undifferentiated SSC marker Plzf in OA and NOA patients. The arrows indicate the positive staining. c, d Immunofluorescence staining of TJ-associated protein ZO-1 and adherens junction protein N-cadherin in OA and NOA patients. e Immunohistochemistry and density of the positive staining of GGPPS in OA and NOA patients. f Relative mRNA level of GGPPS in OA and NOA patients. n = 18 of NOA patients and n = 5 of OA patients to be performed for immunofluorescence and immunohistochemistry, respectively. n = 7 of NOA patients and n = 3 of OA patients to be performed for qRT-PCR, respectively. Data are presented as the mean ± SEM. *p < 0.05; **p < 0.01, n ≥ 3. Scale bar: 100 μm

Disruption of the blood–testis barrier leads to spermatogenesis arrest in NOA patients.

a, b Immunofluorescence of GC marker MVH and undifferentiated SSC marker Plzf in OA and NOA patients. The arrows indicate the positive staining. c, d Immunofluorescence staining of TJ-associated protein ZO-1 and adherens junction protein N-cadherin in OA and NOA patients. e Immunohistochemistry and density of the positive staining of GGPPS in OA and NOA patients. f Relative mRNA level of GGPPS in OA and NOA patients. n = 18 of NOA patients and n = 5 of OA patients to be performed for immunofluorescence and immunohistochemistry, respectively. n = 7 of NOA patients and n = 3 of OA patients to be performed for qRT-PCR, respectively. Data are presented as the mean ± SEM. *p < 0.05; **p < 0.01, n ≥ 3. Scale bar: 100 μm We previously reported that the oocyte-granulosa communication was blocked after Ggpps deletion in oocyte and the membrane location of cell junction proteins in oocyte was destroyed in knockout mice[27]. Thus, we determined the expression of GGPPS in testicular biopsy specimens of the NOA patients and found that mRNA level of GGPPS was decreased in the biopsy of NOA patients with maturation arrest and hypospermatogenesis. In addition, the immunohistochemistry staining showed that the GGPPS-positive staining was deceased in NOA patients compared to that in OA patients (Fig. 1e, f). So, we hypothesized that the decreased GGPPS in the SCs might be responsible for spermatogenesis arrest in the NOA patients with maturation arrest and hypospermatogenesis via disrupting the cell–cell junction, especially the BTB.

Ggpps deletion in SCs results in spermatocyte loss in the adluminal compartment and does not affect spermatogonia in the basal compartment

We deleted Ggpps in SCs by crossing the Ggpps-floxed mice with Amh-Cre transgenic mice[28], which expressed Cre recombinase from E13.5 day specifically in SCs. We chose the 2 and 3 weeks old mice during the first wave of spermatogenesis for experiments to exclude other complicated reasons causing the phenotype after 4 weeks old. H&E staining showed most of seminiferous tubules had few spermatocytes in the SC-Ggpps−/− mice, whereas multilayered spermatogenic cells filled the seminiferous tubules in the WT mice (Fig. 2a). The GC marker MVH staining indicated that Ggpps deletion resulted in a striking loss of spermatocytes (Fig. 2b). The double staining of the BTB-associated protein ZO-1 and spermatocyte marker Sycp3 further showed that the spermatocyte number was largely decreased in the adluminal compartment above the BTB (Figs. 2c and S3A). Meanwhile, surviving SSCs were observed close to the basal compartment in SC-Ggpps−/− mice (Fig. 2b). The GCs retained in the basal compartment were undifferentiated SSCs, which were confirmed by the immunostaining of the SSC marker Plzf (Figs. 2d and S3B). Furthermore, double staining of Plzf and proliferation marker Ki67 suggested that SSCs were still capable of self-renewal (Figs. 2d and S3C). Other than the 3-week-old mice, in older mice, such as 16-week-old knockout mice, we also found that the number of germ cells was less than that in WT mice (Fig. S3D). Furthermore, the Tunel assay also indicated that the spermatocyte underwent apoptosis in the adluminal compartment (Figs. 2e and S3E). These data suggested that the spermatogenesis was blocked and spermatocytes ceased development. N-cadherin staining showed that the organization of the SC–GC adhesions was disrupted and N-cadherin was accumulated in the apical cytoplasm of SCs in SC-Ggpps−/− mice testis (Fig. 2f). The results disclosed that Ggpps deletion in SCs resulted in spermatogenesis arrest and loss of spermatocyte just like the NOA patients with maturation arrest and hypospermatogenesis did, which was also associated with cell adhesion disorganization (Fig. 1c, d).
Fig. 2

Ggpps deletion results in GC loss in the adluminal compartment while not in the basal compartment.

a H&E staining of mice testis in CTL and KO mice at 3 weeks old. b Immunofluorescence of GC marker MVH in CTL and KO mice testis at 3 weeks old. c Co-immunofluorescence of spermatocyte marker Sycp3 and TJ-associated protein ZO-1 at 2 weeks old. d Co-immunofluorescence of the undifferentiated SSC marker Plzf and proliferation marker Ki67 at 2 weeks old. The white arrow indicates the co-staining of Plzf and Ki67. e Tunel assay in CTL and KO mice testis. The red arrow indicates the Tunel-positive staining. f Immunofluorescence of adherens junction protein n-cadherin in CTL and KO mice testis. The asterisk indicates the distribution of N-cadherin in apical cytoplasm of SCs. n ≥ 3

Ggpps deletion results in GC loss in the adluminal compartment while not in the basal compartment.

a H&E staining of mice testis in CTL and KO mice at 3 weeks old. b Immunofluorescence of GC marker MVH in CTL and KO mice testis at 3 weeks old. c Co-immunofluorescence of spermatocyte marker Sycp3 and TJ-associated protein ZO-1 at 2 weeks old. d Co-immunofluorescence of the undifferentiated SSC marker Plzf and proliferation marker Ki67 at 2 weeks old. The white arrow indicates the co-staining of Plzf and Ki67. e Tunel assay in CTL and KO mice testis. The red arrow indicates the Tunel-positive staining. f Immunofluorescence of adherens junction protein n-cadherin in CTL and KO mice testis. The asterisk indicates the distribution of N-cadherin in apical cytoplasm of SCs. n ≥ 3

Ggpps deletion in SC leads to the destruction of the BTB and spermatocyte–SC adhesion

In our previous report, we noted that Ggpps deletion in SCs resulted in macrophage invasion into seminiferous tubules, and the infertile phenotype of the SC-Ggpps−/− mice was similar to the characterization of azoospermia[12]. BTB was established from 2-week old and accomplished at nearly 4 weeks old, which was formed by the interaction of adjacent SCs[29]. When mice testis were injected with fluorescent-labeled biotin, the biotin was able to permeate into seminiferous tubule in SC-Ggpps−/− mice due to the degenerated BTB (Fig. 3a). We had isolated SCs from 3-day-old mice testis and analyzed the gene expression with microarray (GSE35755)[12]. The data showed that the cell junction-associated protein expression was decreased in Ggpps−/− mice (Fig. S4). This decrease was sustained as long as 4 weeks until adulthood (Fig. 3b, c). It is reported that N-cadherin mediates the adhesions between all spermatogenic cells and SCs[30], while E-cadherin only mediates the interaction of SSCs and SCs in mammals[31].
Fig. 3

Ggpps deletion in SC leads to the destruction of BTB and spermatocyte–SC adhesion.

a Biotin distribution in CTL and KO mice testis after biotin injection at 4 weeks old. The asterisk indicates the biotin penetrating into seminiferous tubules. b, c RT-qPCR analysis of tight junction protein: claudin11 and TJP1 during BTB establishment. d, e Immunofluorescence of adherens junction protein E-cadherin and N-cadherin in CTL and KO mice testis. The dashed line indicates the bottom of seminiferous tubules. The white arrow indicates the distribution of E-cadherin and N-cadherin in testis. Data are presented as the mean ± SEM. *p < 0.05, **p < 0.01, n ≥ 3

Ggpps deletion in SC leads to the destruction of BTB and spermatocyte–SC adhesion.

a Biotin distribution in CTL and KO mice testis after biotin injection at 4 weeks old. The asterisk indicates the biotin penetrating into seminiferous tubules. b, c RT-qPCR analysis of tight junction protein: claudin11 and TJP1 during BTB establishment. d, e Immunofluorescence of adherens junction protein E-cadherin and N-cadherin in CTL and KO mice testis. The dashed line indicates the bottom of seminiferous tubules. The white arrow indicates the distribution of E-cadherin and N-cadherin in testis. Data are presented as the mean ± SEM. *p < 0.05, **p < 0.01, n ≥ 3 We found that the E-cadherin was exclusively located in the basal compartment, and was not altered after Ggpps deletion (Fig. 3d). Unlike E-cadherin, N-cadherin was located in the basal compartment and the apical ectoplasmic specialization in the adluminal compartment[32]. Ggpps deletion resulted in the dispersion of N-cadherin into the cytoplasm of SCs (Fig. 3e). Thus, we speculated that the arrested spermatogenesis in SC-Ggpps−/− mice was associated with the defective BTB and spermatocyte–SC adhesions.

Ggpps affects the BTB and cell adhesion via regulating protein isoprenylation of small G-protein

We have found that the balance of protein farnesylation and geranylgeranylation was critical for cell function[12,27,33,34]. Ggpps deletion leads to FPP accumulation and GGPP decline, which enhances protein farnesylation and decreases protein geranylgeranylation. For example, FPP accumulation would increase farnesylation of Ras[12] and GGPP decline would decrease geranylgeranylation of the Rab[33] and Rho family[27]. Cell adhesion and actin cytoskeleton can be regulated by Rho family[35,36]. Then, we isolated the hydrophilic and hydrophobic proteins by tritonX-114 extraction and found that the hydrophobic Cdc42 and RhoA (membrane bound form) was decreased, which suggested that the geranylgeranylation of Cdc42 and RhoA was inhibited after Ggpps deletion (Figs. 4a, b and S5A and B). In addition, RhoA GTP activity was also decreased although without significant difference due to the sample variation (Figs. 4c and S5C). These data suggested that the disrupted SC–GC adhesions after Ggpps deletion was attributed to the defected protein geranylgeranylation of Rho family.
Fig. 4

Ggpps affects the BTB and cell adhesion via the regulation of protein isoprenylation of small G-protein.

a, b Immunoblot with Rho family members Cdc42 and RhoA of hydrophobic proteins (down) and hydrophilic proteins (up) in CTL and KO mice testis. c Immunoblot with the active RhoA form RhoA-GTP in CTL and KO mice testis. d Immunoblot with Pan-Ras, H-Ras, and K-Ras in hydrophobic proteins (down) and hydrophilic (up) proteins of primary SC. e Immunoblot with p-ERK and T-ERK of primary SC in control and KO mice relative to α-tubulin. f Immunoblot with p-ERK and T-ERK after FTI treatment of primary SC in control and KO mice relative to α-tubulin. g–j Relative mRNA level of tight junction proteins after FTI treatment. Data are presented as the mean ± SEM. *p < 0.05; **p < 0.01, n ≥ 3

Ggpps affects the BTB and cell adhesion via the regulation of protein isoprenylation of small G-protein.

a, b Immunoblot with Rho family members Cdc42 and RhoA of hydrophobic proteins (down) and hydrophilic proteins (up) in CTL and KO mice testis. c Immunoblot with the active RhoA form RhoA-GTP in CTL and KO mice testis. d Immunoblot with Pan-Ras, H-Ras, and K-Ras in hydrophobic proteins (down) and hydrophilic (up) proteins of primary SC. e Immunoblot with p-ERK and T-ERK of primary SC in control and KO mice relative to α-tubulin. f Immunoblot with p-ERK and T-ERK after FTI treatment of primary SC in control and KO mice relative to α-tubulin. g–j Relative mRNA level of tight junction proteins after FTI treatment. Data are presented as the mean ± SEM. *p < 0.05; **p < 0.01, n ≥ 3 We also found that the Ggpps deletion largely led to an increase in the farnesylation level of Ras in primary SC (Fig. 4d and S5D). The increased membrane association of Ras in SC-Ggpps−/− mice resulted in the activation of extracellular signal-regulated kinase 1/2 (Erk1/2) signaling (Fig. 4e), which could be blocked by FTI, an inhibitor of farnesyltranferase and the FTI treatment concentration we used was 10 μM[37] (Fig. 4f). As to other mitogen-activated protein kinases (MAPK) family members: p38 and Jnk, we detected their phosphorylation and total level of p38 and Jnk, and the results demonstrated that the phosphorylation level of p38 and Jnk was not changed in KO mice. Previous studies demonstrated that ERK and p38 had diverse biological functions[38] and they could regulate apoptosis in an opposing manner[39], which explained that the different changes between ERK and p38 in our study (Fig. S5E and F). Furthermore, inhibition of protein farnesylation could increase the expression of BTB components, such as claudin 4, claudin 4B, claudin 1, and tight junction protein 1 (TJP1) in SC-Ggpps−/− SCs (Fig. 4g–j). The results indicated that enhancement of Ras farnesylation might be related with the BTB destruction through decreasing the expression of BTB-associated proteins.

Berberine can partially alleviate arrested spermatogenesis in SC-Ggpps−/− mice testis

Our above studies indicated that the destructed BTB and cell adhesions led to spermatogenesis defect in NOA patients, so we tried to seek methods to restore the BTB structure to regenerate spermatogenesis. Berberine, a natural product isolated from Chinese herb, has been used in traditional Eastern medicine for a long time to treat gastroenteritis, abdominal pain, and diarrhea[40-42]. Previous studies of berberine function focused on its regulation of cholesterol-lowering[43], antidiabetic[44], and potential role in restoring broken down barrier in intestinal inflammation[45]. Berberine prevents TNFα-induced claudin-1 disassembly and upregulates claudin-2 at its mRNA level[45]. Here, Ggpps deletion induced an increase in N-cadherin expression (Figs. 5a and S6A), which was accumulated in cytoplasm and could not be assembled into cell adhesion complex on the cell membrane (Fig. 3f). Berberine treatment could effectively reduce the elevated N-cadherin level caused by Ggpps deletion in isolated primary SCs (Figs. 5b and S6B). The results encouraged us to investigate whether berberine could ameliorate the cell adhesions to restore spermatogenesis.
Fig. 5

Berberine treatment could ameliorate the damaged tight junction.

a Immunoblot with n-cadherin in CTL and KO mice testis relative to GAPDH. b Immunoblot with N-cadherin of primary SC in KO mice after berberine treatment relative to α-Tubulin. c Immunoblot with N-cadherin in WT and KO mice testis after berberine treatment relative to α-tubulin. d Immunoblot and statistical analysis of tight junction proteins occludin and ZO-1 in WT and KO mice testis after berberine treatment relative to β-actin. e Immunofluorescence with occludin in WT and KO mice testis after berberine treatment. Data are presented as the mean ± SEM. *p < 0.05; **p < 0.01, n ≥ 3. Scale bar: 100 μm

Berberine treatment could ameliorate the damaged tight junction.

a Immunoblot with n-cadherin in CTL and KO mice testis relative to GAPDH. b Immunoblot with N-cadherin of primary SC in KO mice after berberine treatment relative to α-Tubulin. c Immunoblot with N-cadherin in WT and KO mice testis after berberine treatment relative to α-tubulin. d Immunoblot and statistical analysis of tight junction proteins occludin and ZO-1 in WT and KO mice testis after berberine treatment relative to β-actin. e Immunofluorescence with occludin in WT and KO mice testis after berberine treatment. Data are presented as the mean ± SEM. *p < 0.05; **p < 0.01, n ≥ 3. Scale bar: 100 μm Then we treated the 4 weeks old SC-Ggpps−/− mice with berberine by oral gavage at a dose of 200 mg/kg/day. After 5 weeks, we sacrificed the mice and found that the expression of N-cadherin was decreased significantly (Figs. 5c and S6C), suggesting that berberine treatment may promote spermatogenesis recovery by improving the damaged adhesion junction. Furthermore, we detected the expression level of tight junction proteins and the BTB structure in mice testis after berberine treatment. The expression level of tight junction protein occludin in mice testis was increased after berberine treatment (Fig. 5d). Also the expression level of tight junction associated protein ZO-1 was increased, but there is no significant difference because of the sample variation between different mice testis (Fig. 5d). Occludin in WT mice was located between the SCs along the BTB at the basal compartment, but the distribution of occludin was dispersed into the cytoplasm in SC-Ggpps−/− mice. According to our hypothesis the berberine treatment could ameliorate the disrupted BTB, and also the cytosolic dispersed occludin in SC-Ggpps−/− mice was relocated between the SCs along the BTB at the basal compartment after this treatment (Fig. 5e). These data revealed that berberine could ameliorate the disrupted BTB to some extent. We determined the sperm production and found that the sperm number was elevated after berberine treatment (Fig. S6D). Further analysis showed that berberine treatment could effectively increase the testis weight and restore the degenerated tubules in SC-Ggpps−/− mice (Fig. 6a, b). The thickness of the seminiferous tubule was measured in accordance with the semi-diameter of seminiferous tubule minus the semi-diameter of luminal tubule. The immunofluorescence of the GC marker MVH showed that berberine could increase the seminiferous epithelium thickness (Fig. 6c, d). To figure out whether meiosis was resumed after berberine treatment, we detected the immunofluorescence of spermatocyte marker Sycp3 and found that the positive staining cells were increased in KO mice after berberine treatment (Figs. 6e and S6E). Also, we found that spermatocytes could develope into round spermatids, because the positive staining of the round spermatid marker acrosin were increased in KO mice after berberine treatment (Figs. 6f and S6E). These evidences suggested that meiosis was resumed. In addition, the Tunel assay showed that berberine treatment could decrease the apoptosis in KO mice (Figs. 6g and S6F). Our study indicated that berberine administration would be an effective strategy for NOA therapy.
Fig. 6

Berberine restores spermatogenesis via ameliorating the damaged tight junction.

a, b Analysis of testis weights and degenerated tubules in KO mice testis after berberine treatment relative to WT mice. c, d The epithelium thickness and immunofluorescence with GC marker MVH in WT and KO mice testis after berberine treatment. White double arrow indicates the epithelium thickness. e, f Immunofluorescence with spermatocyte marker Sycp3 and round spermatid marker acrosin in WT and KO mice after berberine treatment. g Tunel assay in WT and KO mice after berberine treatment. Data are presented as the mean ± SEM. *p < 0.05, **p < 0.01, n ≥ 3

Berberine restores spermatogenesis via ameliorating the damaged tight junction.

a, b Analysis of testis weights and degenerated tubules in KO mice testis after berberine treatment relative to WT mice. c, d The epithelium thickness and immunofluorescence with GC marker MVH in WT and KO mice testis after berberine treatment. White double arrow indicates the epithelium thickness. e, f Immunofluorescence with spermatocyte marker Sycp3 and round spermatid marker acrosin in WT and KO mice after berberine treatment. g Tunel assay in WT and KO mice after berberine treatment. Data are presented as the mean ± SEM. *p < 0.05, **p < 0.01, n ≥ 3

Discussion

Currently, there is no effective therapeutic strategy for azoospermia or oligozoospermia, especially for the NOA patients. Our study indicated that BTB and cell adhesions were disrupted in the NOA patients. Recent reports suggest that by resealing the toxicant-disrupted BTB, spermatogenesis can be restored in the mouse model[46]. Here, we showed that the broken BTB blocked spermatocyte development in the adluminal compartment. But the SSCs in the basal compartment under the BTB survived, which made it possible for us to restore spermatogenesis through the SC function recovery, especially BTB reconstruction. We showed that berberine may be an effective therapeutic strategy to reinitiate spermatogenesis in NOA patients with maturation arrest and hypospermatogenesis through ameliorating disrupted BTB, which were demonstrated in a SC-Ggpps−/− mouse model. In this study, we generated a mouse model by deleting Ggpps in SCs, which could result in the disruption of BTB by breaking the balance of protein farnesylation and geranylgeranylation. In addition to the damaged BTB, the SC-Ggpps−/− mice also showed the disruption of SC–GC adhesions, which closely resembled the observation in NOA patients. The similar characteristics of the seminiferous tubules in SC-Ggpps−/− mice and the NOA patients made it convenient to investigate the mechanism of azoospermia or oligozoospermia directly and effectively. Here, we focused on how to restore the spermatogenesis in NOA patients by using this animal model and found that the reconstruction of BTB and cell adhesions was a promising strategy for treating azoospermia or oligozoospermia. In Drosophila testis, the occludin junction and gap junction are of particular importance in maintaining SSC niche homeostasis[47,48]. Occludin junctions shape the signaling environment between the somatic cells and the germ cells to maintain niche homeostasis. SSC niche homeostasis is likely regulated by the occluding junction in mammal in similar manner. The BTB separates the seminiferous tubule into two parts: basal and adluminal compartments. The adhesion proteins on the cell surface of the SC and spermatogenic cell seem to be specified by the BTB[30,31]. E-cadherin is specially distributed on SSC in the basal compartment, whereas N-cadherin is distributed in the basal compartment and the apical ectoplasmic specialization in the adluminal compartments[32]. The different types of SC–GC adhesion are probably engaged in different “physical” niche microenvironment in the basal and adluminal compartments. Therefore, the BTB is an important structure that contributes to the survival of SSC and development of the spermatocytes and spermatids by defining distinct “chemical” and “physical” niches in the basal and adluminal compartments, respectively. When berberine was used to treat the SC-Ggpps−/− mice, the “physical” niche was recovered via regulating N-cadherin expression. Protein prenylation is critical not only for targeting proteins to cellular membranes but also in protein–protein interactions[49,50]. And the functional role of protein prenylation has been investigated for Ras and Rho family. The prenylation of Rho family member RhoA is involved in cytoskeleton organization, which maintains the actin stress fiber content and focal adhesions[51]. Rho GTPases are post-translationally modified by prenylation. In addition, Rho family GTPases are involved in the regulation of cadherin-mediated cell–cell adhesion and cytoskeleton. The GTP-bound active forms of Cdc42 and Rac1 interact with their downstream target IQGAP1 and thereby prohibit IQGAP1 from interacting with β-catenin, leading to the interaction of E-cadherin and β-catenin, which establish the strong adhesion[52,53]. Statin, a cholesterol-lowering agent that inhibit 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase, reduces the membrane localization of K-Ras and down regulates the testosterone level[35,54], which can promote BTB assembly by accelerating the kinetics of endocytosis and recycling of BTB-associated integral membrane proteins, including occludin, junctional adhesion molecule A (JAM-A), and N-cadherin[55]. Statin can also down regulate the inflammation level[56]. The evidence suggested that the regulation of mevalonate metabolic pathway may be a reasonable target for regenerating spermatogenesis. In summary, we found that Ggpps deletion resulted in the BTB destruction in males, and our further investigation determined that berberine could improve the damaged adhesion junction-mediated BTB to reinitiate spermatogenesis. These results suggested that resealing BTB could be an effective therapeutic target for male infertility. Supplementary figures S1-S6 and supplemental tables 1-2
  56 in total

Review 1.  Blood-testis barrier, junctional and transport proteins and spermatogenesis.

Authors:  Brian P Setchell
Journal:  Adv Exp Med Biol       Date:  2008       Impact factor: 2.622

2.  Sertoli cell-initiated testicular innate immune response through toll-like receptor-3 activation is negatively regulated by Tyro3, Axl, and mer receptors.

Authors:  Bing Sun; Nan Qi; Tao Shang; Hui Wu; Tingting Deng; Daishu Han
Journal:  Endocrinology       Date:  2010-04-02       Impact factor: 4.736

3.  Hematoxylin and eosin staining of tissue and cell sections.

Authors:  Andrew H Fischer; Kenneth A Jacobson; Jack Rose; Rolf Zeller
Journal:  CSH Protoc       Date:  2008-05-01

4.  Blockade of the Ras/MEK/ERK and Ras/PI3K/Akt pathways by statins reduces the expression of bFGF, HGF, and TGF-β as angiogenic factors in mouse osteosarcoma.

Authors:  Masanobu Tsubaki; Yuzuru Yamazoe; Masashi Yanae; Takao Satou; Tatsuki Itoh; Junichi Kaneko; Yasuhiro Kidera; Kenzo Moriyama; Shozo Nishida
Journal:  Cytokine       Date:  2011-02-02       Impact factor: 3.861

5.  Berberine prevents nitric oxide-induced rat chondrocyte apoptosis and cartilage degeneration in a rat osteoarthritis model via AMPK and p38 MAPK signaling.

Authors:  Yan Zhou; Shi-Qing Liu; Ling Yu; Bin He; Shi-Hao Wu; Qi Zhao; Shao-Qiang Xia; Hong-Jun Mei
Journal:  Apoptosis       Date:  2015-09       Impact factor: 4.677

6.  The mouse homolog of Drosophila Vasa is required for the development of male germ cells.

Authors:  S S Tanaka; Y Toyooka; R Akasu; Y Katoh-Fukui; Y Nakahara; R Suzuki; M Yokoyama; T Noce
Journal:  Genes Dev       Date:  2000-04-01       Impact factor: 11.361

Review 7.  Acrosin, the peculiar sperm-specific serine protease.

Authors:  U Klemm; W Müller-Esterl; W Engel
Journal:  Hum Genet       Date:  1991-10       Impact factor: 4.132

8.  Regulation of the small GTP-binding protein Rho by cell adhesion and the cytoskeleton.

Authors:  X D Ren; W B Kiosses; M A Schwartz
Journal:  EMBO J       Date:  1999-02-01       Impact factor: 11.598

9.  Androgen receptor function is required in Sertoli cells for the terminal differentiation of haploid spermatids.

Authors:  Robert W Holdcraft; Robert E Braun
Journal:  Development       Date:  2004-01       Impact factor: 6.868

10.  Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis.

Authors:  Z Xia; M Dickens; J Raingeaud; R J Davis; M E Greenberg
Journal:  Science       Date:  1995-11-24       Impact factor: 47.728

View more
  4 in total

1.  Exploring dysregulated miRNAs in cryptorchidism: a systematic review.

Authors:  Hongshuai Jia; Chunsheng Hao
Journal:  J Int Med Res       Date:  2021-03       Impact factor: 1.671

2.  Protein palmitoylation-mediated palmitic acid sensing causes blood-testis barrier damage via inducing ER stress.

Authors:  Xie Ge; Zhaowanyue He; Chun Cao; Tongmin Xue; Jun Jing; Rujun Ma; Wei Zhao; Ling Liu; Kadiliya Jueraitetibaike; Jinzhao Ma; Yuming Feng; Zhang Qian; Zhichuan Zou; Li Chen; Chuanhai Fu; Ninghong Song; Bing Yao
Journal:  Redox Biol       Date:  2022-07-02       Impact factor: 10.787

3.  Bibliometric and visual analysis of blood-testis barrier research.

Authors:  Yifeng Shen; Yaodong You; Kun Zhu; Chunyan Fang; Xujun Yu; Degui Chang
Journal:  Front Pharmacol       Date:  2022-08-22       Impact factor: 5.988

4.  Leukocytospermia in late adolescents: possible clinical interpretations.

Authors:  S La Vignera; R Cannarella; A Aversa; R Rago; R A Condorelli; A E Calogero
Journal:  J Endocrinol Invest       Date:  2020-11-23       Impact factor: 4.256

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.