Literature DB >> 31135337

Phosphorylation-mediated interactions with TOPBP1 couple 53BP1 and 9-1-1 to control the G1 DNA damage checkpoint.

Nicolas Bigot1, Matthew Day1, Robert A Baldock2, Felicity Z Watts2, Antony W Oliver1, Laurence H Pearl1.   

Abstract

Coordination of the cellular response to DNA damage is organised by multi-domain 'scaffold' proteins, including 53BP1 and TOPBP1, which recognise post-translational modifications such as phosphorylation, methylation and ubiquitylation on other proteins, and are themselves carriers of such regulatory signals. Here we show that the DNA damage checkpoint regulating S-phase entry is controlled by a phosphorylation-dependent interaction of 53BP1 and TOPBP1. BRCT domains of TOPBP1 selectively bind conserved phosphorylation sites in the N-terminus of 53BP1. Mutation of these sites does not affect formation of 53BP1 or ATM foci following DNA damage, but abolishes recruitment of TOPBP1, ATR and CHK1 to 53BP1 damage foci, abrogating cell cycle arrest and permitting progression into S-phase. TOPBP1 interaction with 53BP1 is structurally complimentary to its interaction with RAD9-RAD1-HUS1, allowing these damage recognition factors to bind simultaneously to the same TOPBP1 molecule and cooperate in ATR activation in the G1 DNA damage checkpoint.
© 2019, Bigot et al.

Entities:  

Keywords:  BRCT domains; DNA damage response; cell biology; human; molecular biophysics; multiprotein complexes; post-translational modifications; structural biology

Mesh:

Substances:

Year:  2019        PMID: 31135337      PMCID: PMC6561707          DOI: 10.7554/eLife.44353

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

53BP1 and TOPBP1 are multi-domain scaffold proteins that individually contribute to the genome stability functions of mammalian cells (Sokka et al., 2010; Panier and Boulton, 2014; Wardlaw et al., 2014; Zimmermann and de Lange, 2014). 53BP1 is recruited to sites of DNA damage through interaction with post-translationally modified histones (Botuyan et al., 2006; Fradet-Turcotte et al., 2013; Baldock et al., 2015; Kleiner et al., 2015) and is strongly implicated in the process of choice between the non-homologous end joining and homologous recombination pathways of double-strand break (DSB) repair (Leung and Glover, 2011; Aparicio et al., 2014; Daley and Sung, 2014), as well as the localisation of activated ATM that is required for DSB repair in heterochromatin (Lee et al., 2010; Noon et al., 2010; Baldock et al., 2015). Amongst other roles, TOPBP1 is involved in replication initiation through its interaction with TICCR/Treslin (Kumagai et al., 2010; Boos et al., 2011); the DNA damage checkpoint through interactions with 9-1-1, RHNO1/RHINO and ATR (Kumagai et al., 2006; Delacroix et al., 2007; Lee et al., 2007; Cotta-Ramusino et al., 2011; Lindsey-Boltz and Sancar, 2011); and sister chromatid de-catenation and suppression of sister chromatid exchange via interactions with TOP2A and BLM (Blackford et al., 2015; Broderick et al., 2015). Genetic studies indicate that the fission yeast orthologues of 53BP1 and TOPBP1Crb2 and Rad4 (also known as Cut5) respectively – interact directly with each other, and play important roles in the DNA damage response (Saka et al., 1997). Subsequent studies have shown that physical association of Crb2 and Rad4 is mediated by the interaction of a pattern of cyclin-dependent kinase phosphorylation sites on Crb2, with the BRCT domains of Rad4 (Du et al., 2006; Qu et al., 2013). A functionally important physical interaction of mammalian 53BP1 and TOPBP1 has also been observed (Cescutti et al., 2010), and found to depend upon the functionality of specific TOPBP1 BRCT domains, suggesting that this interaction might also mediated by phosphorylation. However, the nature and identity of the sites that might be involved were not determined. Using a structurally-derived consensus pattern for phospho-ligand binding to the N-terminal regions of TOPBP1 and Rad4 (Day et al., 2018), we have now identified conserved phosphorylation sites in human 53BP1, and have biochemically and structurally characterised their interaction with BRCT domains of TOPBP1. Mutation of these sites abrogates functional interaction of 53BP1 and TOPBP1 in G1, showing them to be both necessary and sufficient for the association of the two proteins. Mutation also disrupts co-localisation of 53BP1 with the TOPBP1-associated ATR kinase, and causes defects in a G1/S checkpoint response due to disruption of downstream CHK1 signalling. The binding sites of the 53BP1 phosphorylation sites on TOPBP1 are complementary to that of the phosphorylated tail of RAD9 in the 9-1-1 checkpoint clamp. Our results delineate a key scaffold role of TOPBP1 in bringing together 53BP1 and 9-1-1 to control S-phase entry in the presence of DNA damage.

Results

Identification of TOPBP1-interacting phosphorylation sites in 53BP1

Previous studies demonstrated a biologically important interaction between TOPBP1 and 53BP1 – the putative metazoan homologue of Crb2 – involving BRCT1,2 and BRCT4,5 of TOPBP1 (Cescutti et al., 2010), although the molecular basis of this interaction was not fully determined. Although 53BP1 has many roles in mammalian cells that are distinct from those attributed to Crb2 in fission yeast, there is an emerging picture that many of the functional interactions made by these proteins are conserved. Thus, both Crb2 and 53BP1 have now been shown to interact through their C-terminal tandem BRCT2 domains, with the common post-translational histone mark of DNA damage, γH2AX (Kilkenny et al., 2008; Baldock et al., 2015; Kleiner et al., 2015). We therefore hypothesised that phosphorylation-dependent interactions we had previously characterised between Crb2 and Rad4 might also be involved in the putative functional interaction of their mammalian homologues 53BP1 and TOPBP1. Using a consensus motif for selective phosphopeptide-binding to BRCT domains of TOPBP1/Rad4 (Day et al., 2018), we searched for potential phosphorylation sites in 53BP1 that might be involved in mediating phosphorylation-dependent interactions with TOPBP1. Four matches were identified, focused on Thr334, Ser366, Ser380 and Thr670, all of which have been previously documented as phosphorylated in phospho-proteomic analyses (Hornbeck et al., 2004; Sharma et al., 2014) (Figure 1A). While Ser380 has previously been implicated in binding the pro-homology repair factor SCAI (Isobe et al., 2017), no function has been assigned to the other sites we identified. To determine whether any of these sites bound to the N-terminal segment of TOPBP1, we synthesised fluorescently labelled phospho-peptides spanning the putatively modified residues and measured their affinity for human TOPBP1 BRCT0,1,2 and BRCT4,5 constructs using fluorescence polarisation (FP) as previously described (Rappas et al., 2011; Qu et al., 2013).
Figure 1.

Identification and in vitro characterisation of TOPBP1 binding phosphorylation sites in 53BP1.

(A) The TOPBP1/Rad4-binding motif matches only four potential sites out of over two hundred phosphorylation sites documented for 53BP1 (Hornbeck et al., 2004; Sharma et al., 2014). (B) Fluorescence polarisation (FP) analysis shows no substantial interaction of fluorescently-labelled phospho-peptides derived from the putative phosphorylation sites centred on 53BP1-Thr344, Ser366 or Ser380 with the BRCT0,1,2 segment of TOPBP1. (C) A fluorescently-labelled phospho-peptide centred on 53BP1-Thr670 binds to the BRCT0,1,2 segment of TOPBP1 with high affinity in FP assays. Treatment with λ-phosphatase abolishes binding, confirming that the interaction is specific for the phosphorylated peptide. (D) Charge-reversal mutation of Lys155, which is implicated in phospho-binding in BRCT1 has little effect on binding of the pThr670 peptide to BRCT0,1,2, whereas mutation of the equivalent residue, Lys250 in BRCT2 substantially decreases the affinity. Mutation of both sites completely abolishes the interaction. (E) No binding of 53BP1-derived phospho-peptides centred on Thr670 or Thr334 was detected with the BRCT4,5 segment of TOPBP1. (F) Fluorescently-labelled phospho-peptides centred on 53BP1-Ser366 and Ser380 bind with modest affinity to the TOPBP1 BRCT4,5 segment. (G) Treatment of the 53BP1-Ser366 phosphopeptide with λ-phosphatase or charge-reversal mutation of Lys704, which is implicated in phospho-binding in BRCT5, abolishes interaction of the phosphopeptide to BRCT4,5.

Identification and in vitro characterisation of TOPBP1 binding phosphorylation sites in 53BP1.

(A) The TOPBP1/Rad4-binding motif matches only four potential sites out of over two hundred phosphorylation sites documented for 53BP1 (Hornbeck et al., 2004; Sharma et al., 2014). (B) Fluorescence polarisation (FP) analysis shows no substantial interaction of fluorescently-labelled phospho-peptides derived from the putative phosphorylation sites centred on 53BP1-Thr344, Ser366 or Ser380 with the BRCT0,1,2 segment of TOPBP1. (C) A fluorescently-labelled phospho-peptide centred on 53BP1-Thr670 binds to the BRCT0,1,2 segment of TOPBP1 with high affinity in FP assays. Treatment with λ-phosphatase abolishes binding, confirming that the interaction is specific for the phosphorylated peptide. (D) Charge-reversal mutation of Lys155, which is implicated in phospho-binding in BRCT1 has little effect on binding of the pThr670 peptide to BRCT0,1,2, whereas mutation of the equivalent residue, Lys250 in BRCT2 substantially decreases the affinity. Mutation of both sites completely abolishes the interaction. (E) No binding of 53BP1-derived phospho-peptides centred on Thr670 or Thr334 was detected with the BRCT4,5 segment of TOPBP1. (F) Fluorescently-labelled phospho-peptides centred on 53BP1-Ser366 and Ser380 bind with modest affinity to the TOPBP1 BRCT4,5 segment. (G) Treatment of the 53BP1-Ser366 phosphopeptide with λ-phosphatase or charge-reversal mutation of Lys704, which is implicated in phospho-binding in BRCT5, abolishes interaction of the phosphopeptide to BRCT4,5. Of the four peptides, only the one centred on 53BP1-pThr670 bound tightly to TOPBP1-BRCT0,1,2 (K = 1.5 ± 0.2 μM) (Figure 1B). Treatment with λ-phosphatase eliminated binding, confirming that phosphorylation of the 53BP1 sequence is required (Figure 1C). To define which of the two BRCT domains within the TOPBP1-BRCT0,1,2 segment is primarily responsible for the interaction, we measured binding of the 53BP1-pThr670 peptide to TOPBP1-BRCT0,1,2 harbouring mutations in BRCT1 and BRCT2 that have previously been shown to eliminate binding of other specific phospho-peptides (Boos et al., 2011; Rappas et al., 2011). A high affinity interaction (K = 1.0 ± 0.2 μM) was still observed with TOPBP1-BRCT0,1,2-K155E, in which the phospho-binding site in the BRCT1 domain is mutationally disabled, but binding was ~10 fold weaker (K = 13.5 ± 6.2 μM) with TOPBP1-BRCT0,1,2-K250E, in which BRCT2 is mutated. These data implicate BRCT2 as the primary binding site, consistent with the presence of a hydrophilic residue −4 to the phosphothreonine (Day et al., 2018), but with BRCT1 potentially providing a weaker alternative site. Mutation of both BRCT phospho-binding sites eliminated interaction (Figure 1D). Given the previous implication of a role for BRCT4,5 in mediating the interaction of TOPBP1 and 53BP1 (Cescutti et al., 2010), we also looked at the ability of this segment of TOPBP1 to bind these 53BP1-derived phosphopeptides. In contrast to its tight interaction with TOPBP1-BRCT0,1,2, the 53BP1-pThr670 peptide showed little binding to TOPBP1-BRCT4,5, nor did the 53BP1-pThr334 peptide (Figure 1E). However, the 53BP1-pSer366 peptide did show a clear interaction with TOPBP1-BRCT4,5, albeit with a more modest affinity (K = 20.6 ± 1.9 μM). 53BP1-pSer380 also bound TOPBP1-BRCT4,5 but with still lower affinity (K = 29.6 ± 2.6 μM) (Figure 1F). Treatment of the phosphopeptide with λ-phosphatase or mutation of Lys704, which is implicated in phosphate recognition in TOPBP1-BRCT4,5 eliminated binding, confirming the phospho-specificity of the interaction (Figure 1G).

Structure of TOPBP1 – 53BP1 phospho-peptide complexes

To further characterise the nature of these interactions we sought to obtain crystal structures of the TOPBP1-53BP1 phospho-peptide complexes. Co-crystallisation of TOPBP1-BRCT0,1,2 with the 53BP1-pThr670 phospho-peptide produced a crystal structure with peptide bound to BRCT2, consistent with the specificity it displays for that site in binding assays (Figure 2A). The position and overall conformation of the bound peptide is similar to that previously described for the interaction of Crb2-derived phospho-peptides pThr187 and pThr235 bound to BRCT2 of Rad4 (Qu et al., 2013). The phosphorylated side chain of 53BP1-Thr670 interacts with TOPBP1-Thr208 and TOPBP1-Lys250, which are topologically conserved in all BRCT domains capable of phospho-specific peptide interaction (Leung and Glover, 2011). The phosphate also interacts with the head group of TOPBP1-Arg215 which makes an additional hydrogen bond interaction with the side chain of 53BP1-Glu669. The side chain of the −3 residue of the phospho-peptide motif (see above), 53BP1-Ile667, packs into a hydrophobic pocket formed between the side chains of TOPBP1 residues Leu233, Gln249, Lys250 and Cys253. Additional specificity is provided by polar interactions between 53BP1-Glu669 and TOPBP1-Arg215, 53BP1-Glu666 and TOPBP1-Lys234, and 53BP1-Glu665 and the side chains of Arg256 and Trp257 of TOPBP1 (Figure 2B).
Figure 2.

Crystal structures of TOPBP1 – 53BP1 phosphopeptide complexes.

(A) Structure of TOPBP1 BRCT0,1,2 bound to a 53BP1-pT670 peptide. As predicted from the consensus motif and confirmed by the FP data, this peptide binds to BRCT2. TOPBP1 secondary structure is rainbow-coloured (N-terminus blue - > C terminus red). (B) Interactions of 53BP1-pT670 peptide and TOPBP1-BRCT2. Dashed lines indicate hydrogen bonding interactions. See text for details. (C) Structure of TOPBP1 BRCT4,5 bound to a 53BP1-pS366 peptide. Consistent with the FP data, the peptide binds to BRCT5. (D) Interactions of 53BP1-pS366 peptide and TOPBP1-BRCT5. Dashed lines indicate hydrogen bonding interactions. See text for details.

Crystal structures of TOPBP1 – 53BP1 phosphopeptide complexes.

(A) Structure of TOPBP1 BRCT0,1,2 bound to a 53BP1-pT670 peptide. As predicted from the consensus motif and confirmed by the FP data, this peptide binds to BRCT2. TOPBP1 secondary structure is rainbow-coloured (N-terminus blue - > C terminus red). (B) Interactions of 53BP1-pT670 peptide and TOPBP1-BRCT2. Dashed lines indicate hydrogen bonding interactions. See text for details. (C) Structure of TOPBP1 BRCT4,5 bound to a 53BP1-pS366 peptide. Consistent with the FP data, the peptide binds to BRCT5. (D) Interactions of 53BP1-pS366 peptide and TOPBP1-BRCT5. Dashed lines indicate hydrogen bonding interactions. See text for details. We were also able to obtain co-crystals of the 53BP1-pSer366 peptide bound to TOPBP1-BRCT4,5 (Figure 2C). The 53BP1-pSer366 peptide binds to BRCT5 in a similar position and orientation as previously observed for phospho-peptide binding to TOPBP1-BRCT1 and BRCT2 (see above) and Rad4-BRCT1 and BRCT2 (Qu et al., 2013) (Figure 2D). The phosphoserine side chain engages with the topologically conserved TOPBP1-Ser654 and with the side chain of TOPBP1-Lys704. The −3 residue in the bound peptide, 53BP1-Val363, binds into a hydrophobic pocket lined by the side chains of TOPBP1 residues Phe673, Ser703, Lys704, Ala707 and Trp711. Additional specificity is provided by the hydrophobic packing of the side chains of 53BP1 residues Ala364 and Pro365 around the protruding side chain of TOPBP1-Tyr678, and the packing of 53BP1-Leu362 into a hydrophobic pocket formed by the side chains of TOPBP1-Tyr678, Val680 and Met689. This mode of binding, conserved in Rad4 and N-terminal TOPBP1 BRCT domain interactions, is markedly different from that reported for binding of an MDC1-derived phospho-peptide to TOPBP1-BRCT4,5 (Leung et al., 2013). In that study, the peptide runs perpendicular to the orientation of the 53BP1-peptide observed here, and the phosphorylated residue of the ligand peptide does not appear to interact with the canonical phospho-interacting residues of TOPBP1-BRCT5. Interestingly, TOPBP1-BRCT4,5 has recently been identified as the binding site for a phosphorylated motif in the RECQ-family helicase BLM (Blackford et al., 2015) and a crystal structure of the complex determined (Sun et al., 2017). The identified binding site in BLM - 300-FVPPpSPE-306 shows strong similarity to the 53BP1-motif we have identified - 362-LVAPpSPD-368, and binds to BRCT5 in a very similar manner, but quite differently from the proposed binding mode of the MDC1 SDT motif (Leung et al., 2013), which we have recently shown plays no role in mediating MDC1 interaction with TOPBP1 (Leimbacher et al., 2019). The similarity of the sequences surrounding BLM-pSer304 and 53BP1-pSer366, especially the −1 proline, the small hydrophobic residues at −2 and −3, and the large hydrophobic residue at −4, suggests a binding specificity for BRCT5 that is related to, but subtely distinct from those defined for BRCT1 and BRCT2; further examples will be required to confirm this.

TOPBP1-binding sites on 53BP1 are phosphorylated in vivo

To verify the presence of these TOPBP1-binding phosphorylation sites in cells, we generated independent phospho-specific antibodies to the two sites and looked at the presence of immuno-reacting species in HeLa cell lysates, both before and after DNA damage by ionising radiation (IR). For both α−53BP1-pSer366 and α−53BP1-pThr670 antibodies, clear reactive bands were seen following IR, which were weaker in non-irradiated cells, and considerably diminished by siRNA knockdown of 53BP1 (Figure 3A). We also performed immunofluorescence with these antibodies in irradiated U2OS cells (Figure 3B) and observed strong co-localisation of foci formed by the phospho-specific antibodies with those formed by antibodies to total 53BP1, consistent with the endogenous protein being phosphorylated on Ser366 and Thr670. To confirm the specificity of the antibodies for the phosphorylated state of their target sites, we knocked-down endogenous 53BP1 in siRNA-resistant wild-type eYFP-53BP1 U2OS cells harbouring either the WT 53BP1 or the S366A or T670A 53BP1 mutants. While we saw strong coincidence of the eYFP signal with immunofluorescent foci to total 53BP1 in the wild-type constructs, this was lost for both of the phospho-specific antibodies in cells transfected with 53BP1 mutated in their respective phosphorylation site epitope (Figure 3C).
Figure 3.

TOPBP1-binding sites on 53BP1 are phosphorylated in vivo.

(A) Western blot of cell lysate from HeLa cells, showing induction of phosphorylation of 53BP1-Ser366 (top) and 53BP1-Thr670 (bottom) following irradiation. siRNA knockdown of 53BP1 eliminates the reactive bands in both cases, confirming the specificity of the antibody for 53BP1. (B) Imaging of irradiated eYFP-53BP1 WT U2OS cells with siRNA knockdown of endogenous 53BP1. 53BP1-pSer366 and 53BP1-pThr670 immunofluorescence signals co-localise in discrete foci with eYFP-53BP1 after IR (9Gy). Scale bar, 10 µm. (C) 53BP1-pSer366 and 53BP1-pThr670 immunofluorescent foci coincident with eYFP-53BP1 WT are lost in irradiated 53BP1 siRNA knocked-down stable eYFP-53BP1 U2OS cells expressing the S366A and T670A mutants, respectively. The α−53BP1-pThr670 antiserum has some additional low-affinity off-target reactivity unrelated to 53BP1 which is not evident when 53BP1 is present. The CDT1-RFP signal in nuclei indicates cells in G1. Scale bar, 5 µm.

TOPBP1-binding sites on 53BP1 are phosphorylated in vivo.

(A) Western blot of cell lysate from HeLa cells, showing induction of phosphorylation of 53BP1-Ser366 (top) and 53BP1-Thr670 (bottom) following irradiation. siRNA knockdown of 53BP1 eliminates the reactive bands in both cases, confirming the specificity of the antibody for 53BP1. (B) Imaging of irradiated eYFP-53BP1 WT U2OS cells with siRNA knockdown of endogenous 53BP1. 53BP1-pSer366 and 53BP1-pThr670 immunofluorescence signals co-localise in discrete foci with eYFP-53BP1 after IR (9Gy). Scale bar, 10 µm. (C) 53BP1-pSer366 and 53BP1-pThr670 immunofluorescent foci coincident with eYFP-53BP1 WT are lost in irradiated 53BP1 siRNA knocked-down stable eYFP-53BP1 U2OS cells expressing the S366A and T670A mutants, respectively. The α−53BP1-pThr670 antiserum has some additional low-affinity off-target reactivity unrelated to 53BP1 which is not evident when 53BP1 is present. The CDT1-RFP signal in nuclei indicates cells in G1. Scale bar, 5 µm.

pSer366 and pThr670 mediate 53BP11 interactions with TOPBP1 in vivo

To determine whether the interactions of 53BP1-pSer366 and 53BP1-pThr670 with the BRCT domains of TOPBP1 that we characterised in vitro, are important for functional interactions of TOPBP and 53BP1 in vivo, we knocked-down 53BP1 by siRNA in U2OS and RPE1 cells (Figure 3—figure supplement 1), and transfected them with vectors expressing siRNA-resistant eYFP-53BP1 constructs. In both cell types expressing tagged wild-type eYFP-53BP1 constructs, TOPBP1 and eYFP-53BP1 co-localised into damage foci in G1 (Cyclin A negative) cells following irradiation, reflecting the direct interactions we observed in vitro. However, while irradiated U2OS cells expressing the 53BP1-S366A and/or T670A mutants, still formed eYFP-53BP1 foci, formation of TOPBP1 foci coincident with these was significantly reduced (Figure 4A,B). A very similar effect was seen in RPE1 cells (Figure 4—figure supplement 1A). These data suggest that both of these phosphorylation sites are required for maintaining the interaction between 53BP1 and TOPBP1 and for recruiting TOPBP1 into 53BP1 damage foci in G1 cells negative for cyclin A.
Figure 3—figure supplement 1.

Validation of 53BP1 siRNA western blots demonstrating depletion of 53BP1 protein in U2OS and RPE1 cells treated with siRNA targeted to 53BP1.

Figure 4.

53BP1 phosphorylation sites mediate interaction with TOPBP1 in vivo.

(A) Four hours after 9Gy IR, TOPBP1 foci co-localise with eYFP-53BP1 WT in stably transfected U2OS cells depleted for endogenous 53BP1. Formation of co-localising TOPBP1 foci is greatly reduced in cells expressing eYFP-53BP1 S366A and T670A mutations, and the general distribution of TOPBP1 is more diffuse. The absence of substantial cyclin A immunofluorescence marks the nuclei of cells in G1. Scale bar, 10 µm. Comparable data for RPE1 cells is shown in Figure 4—figure supplement 1. (B) Statistical analysis of TOPBP1 and eYFP-53BP1 foci co-localisation per nucleus in irradiated G1 U2OS cells exemplified in A). Cells expressing S366A or T670A mutant eYFP-53BP1 show significantly lower levels of coincidence between TOPBP1 and eYFP-53BP1. More than 200 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutants relative to wild-type were calculated by a Kruskal-Wallis test corrected by Dunn’s multiple comparison test. (C) Effect of siRNA depletion of 53BP1 on S phase entry by incorporation of BrdU (green) following damage in U2OS cells. Cells that were already in S-phase prior to DNA damage incorporate EdU (yellow) and are not further analysed. Wild-type G1 cells (EdU-) show a robust G1/S checkpoint following irradiation, do not progress into S-phase and do not incorporate BrdU. G1 cells (EdU-) in which 53BP1 is knocked-down fail to checkpoint and progress into S-phase BrdU. EdU-/BrdU+ cells are indicated with arrowheads. Scale bars indicate 10 μm. Comparable data for RPE1 cells is shown in Figure 4—figure supplement 1. (D) 53BP1 siRNA knocked-down cells transfected with wild-type siRNA resistant HA-53BP1 show a G1/S checkpoint following irradiation, while those transfected with 53BP1 in which one or both TOPBP1-binding phosphorylation sites Ser 366 and Thr 670 are mutated, fail to checkpoint and progress into S-phase, incorporating BrdU. Cells that were in S-phase prior to irradiation incorporate EdU (yellow) and are not further analysed. Scale bars indicate 10 µm. Comparable data for RPE1 cells is shown in Figure 4—figure supplement 1. (E) Histogram of U2OS cells depleted of endogenous 53BP1 by siRNA, and transfected with either wild-type HA-53BP1 (WT) or HA-53BP1 with phosphorylation site mutants. The cell cycle phase distributions in the cells expressing mutant 53BP1 are significantly different (Chi-squared test) from that of the wild-type, with a shorter S-phase, and more cells in G2, consistent with a defective G1/S DNA damage checkpoint allowing progression into DNA replication in the presence of unrepaired damage.

(A) Four hours after 9Gy IR, TOPBP1 foci co-localise with eYFP-53BP1 WT in stably transfected RPE1 cells depleted for endogenous 53BP1. Formation of co-localising TOPBP1 foci is greatly reduced in cells expressing eYFP-53BP1 S366A and T670A mutations, and the general distribution of TOPBP1 is more diffuse. The absence of substantial cyclin A immunofluorescence marks the nuclei of cells in G1. Scale bar, 10 µm. (B) G1/S checkpoint analysis. Incorporation of BrdU (green) in EdU negative RPE1 cells (yellow) indicates their S phase entry. Control irradiated cells (2Gy) show a robust G1/S checkpoint arrest, with no progress into S-phase (no BrdU incorporation, see white arrows). Progress into S-phase is not inhibited in 53BP1 knocked-down cells following IR (red arrows). Images were acquired with an IX70 Core DeltaVision microscope. (C) Statistical analysis of data of observed as in A. Bars represent the means of percentage of BrdU+/EdU- cells from more than 2000 cells per case with error bars as standard error of the mean. (D) 53BP1 knocked-down cells transfected with eYFP-53BP1 show a G1/S checkpoint following irradiation, while those transfected with 53BP1 in which one or both TOPBP1-binding phosphorylation sites Ser 366 and/or Thr 670 are mutated, progress into S-phase and incorporate BrdU. (E) As B, bars represent means of percentage of BrdU+/EdU- cells from more than 500 eYFP-53BP1 transfected cells per case with error bars as standard errors of the mean. Kruskal-Wallis test corrected with a Dunn’s multiple comparison was done. Adjusted p values are displayed when significant differences are observed.

(A) Data underlying Figure 4C, but shown as separate channels. (B) Data underlying Figure 4D, but shown as separate channels.

Figure 4—figure supplement 1.

TOPBP1-53BP1 co-localization and G1/S Checkpoint defects in RPE1 cells.

(A) Four hours after 9Gy IR, TOPBP1 foci co-localise with eYFP-53BP1 WT in stably transfected RPE1 cells depleted for endogenous 53BP1. Formation of co-localising TOPBP1 foci is greatly reduced in cells expressing eYFP-53BP1 S366A and T670A mutations, and the general distribution of TOPBP1 is more diffuse. The absence of substantial cyclin A immunofluorescence marks the nuclei of cells in G1. Scale bar, 10 µm. (B) G1/S checkpoint analysis. Incorporation of BrdU (green) in EdU negative RPE1 cells (yellow) indicates their S phase entry. Control irradiated cells (2Gy) show a robust G1/S checkpoint arrest, with no progress into S-phase (no BrdU incorporation, see white arrows). Progress into S-phase is not inhibited in 53BP1 knocked-down cells following IR (red arrows). Images were acquired with an IX70 Core DeltaVision microscope. (C) Statistical analysis of data of observed as in A. Bars represent the means of percentage of BrdU+/EdU- cells from more than 2000 cells per case with error bars as standard error of the mean. (D) 53BP1 knocked-down cells transfected with eYFP-53BP1 show a G1/S checkpoint following irradiation, while those transfected with 53BP1 in which one or both TOPBP1-binding phosphorylation sites Ser 366 and/or Thr 670 are mutated, progress into S-phase and incorporate BrdU. (E) As B, bars represent means of percentage of BrdU+/EdU- cells from more than 500 eYFP-53BP1 transfected cells per case with error bars as standard errors of the mean. Kruskal-Wallis test corrected with a Dunn’s multiple comparison was done. Adjusted p values are displayed when significant differences are observed.

53BP1 phosphorylation sites mediate interaction with TOPBP1 in vivo.

(A) Four hours after 9Gy IR, TOPBP1 foci co-localise with eYFP-53BP1 WT in stably transfected U2OS cells depleted for endogenous 53BP1. Formation of co-localising TOPBP1 foci is greatly reduced in cells expressing eYFP-53BP1 S366A and T670A mutations, and the general distribution of TOPBP1 is more diffuse. The absence of substantial cyclin A immunofluorescence marks the nuclei of cells in G1. Scale bar, 10 µm. Comparable data for RPE1 cells is shown in Figure 4—figure supplement 1. (B) Statistical analysis of TOPBP1 and eYFP-53BP1 foci co-localisation per nucleus in irradiated G1 U2OS cells exemplified in A). Cells expressing S366A or T670A mutant eYFP-53BP1 show significantly lower levels of coincidence between TOPBP1 and eYFP-53BP1. More than 200 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutants relative to wild-type were calculated by a Kruskal-Wallis test corrected by Dunn’s multiple comparison test. (C) Effect of siRNA depletion of 53BP1 on S phase entry by incorporation of BrdU (green) following damage in U2OS cells. Cells that were already in S-phase prior to DNA damage incorporate EdU (yellow) and are not further analysed. Wild-type G1 cells (EdU-) show a robust G1/S checkpoint following irradiation, do not progress into S-phase and do not incorporate BrdU. G1 cells (EdU-) in which 53BP1 is knocked-down fail to checkpoint and progress into S-phase BrdU. EdU-/BrdU+ cells are indicated with arrowheads. Scale bars indicate 10 μm. Comparable data for RPE1 cells is shown in Figure 4—figure supplement 1. (D) 53BP1 siRNA knocked-down cells transfected with wild-type siRNA resistant HA-53BP1 show a G1/S checkpoint following irradiation, while those transfected with 53BP1 in which one or both TOPBP1-binding phosphorylation sites Ser 366 and Thr 670 are mutated, fail to checkpoint and progress into S-phase, incorporating BrdU. Cells that were in S-phase prior to irradiation incorporate EdU (yellow) and are not further analysed. Scale bars indicate 10 µm. Comparable data for RPE1 cells is shown in Figure 4—figure supplement 1. (E) Histogram of U2OS cells depleted of endogenous 53BP1 by siRNA, and transfected with either wild-type HA-53BP1 (WT) or HA-53BP1 with phosphorylation site mutants. The cell cycle phase distributions in the cells expressing mutant 53BP1 are significantly different (Chi-squared test) from that of the wild-type, with a shorter S-phase, and more cells in G2, consistent with a defective G1/S DNA damage checkpoint allowing progression into DNA replication in the presence of unrepaired damage.

TOPBP1-53BP1 co-localization and G1/S Checkpoint defects in RPE1 cells.

(A) Four hours after 9Gy IR, TOPBP1 foci co-localise with eYFP-53BP1 WT in stably transfected RPE1 cells depleted for endogenous 53BP1. Formation of co-localising TOPBP1 foci is greatly reduced in cells expressing eYFP-53BP1 S366A and T670A mutations, and the general distribution of TOPBP1 is more diffuse. The absence of substantial cyclin A immunofluorescence marks the nuclei of cells in G1. Scale bar, 10 µm. (B) G1/S checkpoint analysis. Incorporation of BrdU (green) in EdU negative RPE1 cells (yellow) indicates their S phase entry. Control irradiated cells (2Gy) show a robust G1/S checkpoint arrest, with no progress into S-phase (no BrdU incorporation, see white arrows). Progress into S-phase is not inhibited in 53BP1 knocked-down cells following IR (red arrows). Images were acquired with an IX70 Core DeltaVision microscope. (C) Statistical analysis of data of observed as in A. Bars represent the means of percentage of BrdU+/EdU- cells from more than 2000 cells per case with error bars as standard error of the mean. (D) 53BP1 knocked-down cells transfected with eYFP-53BP1 show a G1/S checkpoint following irradiation, while those transfected with 53BP1 in which one or both TOPBP1-binding phosphorylation sites Ser 366 and/or Thr 670 are mutated, progress into S-phase and incorporate BrdU. (E) As B, bars represent means of percentage of BrdU+/EdU- cells from more than 500 eYFP-53BP1 transfected cells per case with error bars as standard errors of the mean. Kruskal-Wallis test corrected with a Dunn’s multiple comparison was done. Adjusted p values are displayed when significant differences are observed.

TOPBP1-53BP1 co-localization and G1/S Checkpoint defects in U2OS cells.

(A) Data underlying Figure 4C, but shown as separate channels. (B) Data underlying Figure 4D, but shown as separate channels.

pSer366 and pThr670 facilitate activation of the ATR checkpoint kinase cascade

As interaction of 53BP1 and TOPBP1 has previously been suggested to play a role in G1 checkpoint function, we established a dual EdU/BrdU labelling checkpoint assay (Cescutti et al., 2010) in U2OS and RPE1 cells, which allows measurement of DNA synthesis in cells moving from G1 into S-phase in the presence/absence of DNA damage. We then used this to test the role, if any, of the 53BP1 phosphorylation sites we have identified, in the G1 checkpoint response. Wild-type U2OS and RPE1 cells both showed a G1/S checkpoint in response to ionising radiation (IR), with few cells moving into DNA synthesis (visualised by BrdU incorporation) as compared to untreated cells. However, this G1/S checkpoint was greatly reduced in cells of either type in which 53BP1 protein levels were knocked down by siRNA, confirming a critical role for 53BP1 (Figure 4C, Figure 4—figure supplement 1B,C, Figure 4—figure supplement 2A). The checkpoint response to IR in both cell types was largely restored in the 53BP1 knockdown cells by expression of an siRNA-resistant 53BP1 construct, but not by 53BP1 constructs with S366A and/or T670A mutations (Figure 4D, Figure 4—figure supplement 1D,E, Figure 4—figure supplement 2B). Consistent with this, we found that the cell cycle distribution of irradiated U2OS cells expressing the mutants were significantly perturbed compared with wild-type, with the mutants displaying fewer cells in G1 or S phases and a higher proportion in G2 (Figure 4E).
Figure 4—figure supplement 2.

TOPBP1-53BP1 co-localization and G1/S Checkpoint defects in U2OS cells.

(A) Data underlying Figure 4C, but shown as separate channels. (B) Data underlying Figure 4D, but shown as separate channels.

Conditional cell-cycle progression into S-phase is controlled by a G1/S checkpoint phosphorylation cascade coupled to p53 activation and p21 up-regulation, triggered by activation of CHK2 and/or CHK1 downstream of the primary DNA damage-sensing kinases ATM and/or ATR. As multiple components of this network are known to interact with 53BP1 and/or TOPBP1, that disruption of the phosphorylation-mediated 53BP1-TOPBP1 interaction permits progression into S-phase in the presence of DNA damage, suggests that it plays an important role in the activation of this system. ATM and ATR have both been previously shown to form nuclear foci in G1 cells following irradiation (for example Adams et al., 2006; Noon et al., 2010; Gamper et al., 2013; Averbeck et al., 2014; Baldock et al., 2015). Using validated phospho-specific antibodies to the activated states of the proteins (Noon et al., 2010 and Figure 5—figure supplements 1 and 2) we found that both pATM and pATR display distinct immunofluorescent foci that co-localise with 53BP1 and TOPBP1 in irradiated G1 U2OS cells expressing wild-type eYFP-53BP1. Unlike 53BP1 knockdown or point mutations in the C-terminal tandem BRCT domain of 53BP1 that affect its interaction with γH2AX (Baldock et al., 2015) mutation of Ser366 and/or Thr670 had no significant effect on pATM focus formation and co-localisation with 53BP1 in U2OS or RPE1 cells in G1 (Figure 5—figure supplement 1). This suggests that TOPBP1, which no longer co-localises with 53BP1 bearing S366A and/or T670A mutations, plays no significant role in ATM activation or localisation.
Figure 5—figure supplement 1.

pATM focus colocalisation with 53BP1 is unaffected by mutations in Ser366 or Thr670.

(A) Representative pictures of pATM foci formation 2 hr post IR (9Gy) in RPE1 cells after a 72 hr knockdown period with a 3’UTR 53BP1 siRNA. Wide field pictures are taken with an IX70 Core DeltaVision microscope (scale bar, 40 µm) and magnifications display absence of foci in knocked-down cells (scale bar, 5 µm). Boxplots (right) represent the pATM foci counts per nucleus following 53BP1 depletion in RPE1 cells 2 hr post IR (9Gy). The median, mean (+), 10–90 percentiles and outliers are presented. The pATM foci formation decrease after knockdown is considered significant (p<0.0001) by a a Mann-Whitney test. More than 700 nuclei were counted for each case. (B) pATM foci co-localise with 53BP1 in irradiated U2OS cells with siRNA knockdown of endogenous 53BP1 and transfected with siRNA-resistant eYFP-53BP1. co-localisation is not substantially disrupted by the presence of S366A or T670A mutations in 53BP1. Scale bar, 10 µm. Boxplots (right) statistical analysis of images exemplified in B. More than 200 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutants relative to wild-type were calculated by a Kruskal-Wallis test corrected by Dunn’s multiple comparison test. (C) as B. but for RPE1 cells. More than 300 cells per case were counted. Scale bar, 10 µm.

Figure 5—figure supplement 2.

Validation of pATR antibody in U2OS cells.

(A) Western blot demonstrating the specificity of the pATR-pT1989 phospho-specific antibody used for immunofluorescence. The strong band observed in irradiated U2OS cells treated with a control siRNA is not present in irradiated cells treated with a specific siRNA to ATR. (B) Immunofluorescent foci of pATR are evident in irradiated U2OS cells treated with a scrambled control siRNA and to a lesser extent in similarly treated unirradiated cells. Transfection with an siRNA targeting ATR significantly diminishes the observation of pATR foci in both irradiated and non-irradiated cells. Scale bar, 2 µm. (C) Statistical analysis of images exemplified in B. Boxplots (right) represent the pATR foci counts per nucleus. The median, mean (+), 10–90 percentiles and outliers are presented. The pATR foci formation decrease after knockdown is considered significant (p<0.0001) by a Mann-Whitney test. More than 100 nuclei were counted for each case.

In marked contrast, co-localisation of pATR foci with 53BP1 was significantly disrupted (Figure 5A,B) by the S366A and/or T670A mutations of 53BP1. CHK1, which is activated by ATR in the DNA damage checkpoint response, has also been previously shown to form nuclear foci following irradiation (Peddibhotla et al., 2011; Burdak-Rothkamm et al., 2015; Antonczak et al., 2016). Using antibodies to total CHK1, we also observed distinct CHK1 foci co-incident with wild-type eYFP-53BP1 in 53BP1-knockdown G1 RPE1 cells following irradiation, but not in irradiated cells in which 53BP1 was knocked down by siRNA, where CHK1 displayed a diffuse pan-nuclear distribution (Figure 5C). CHK1 foci were restored in 53BP1 knockdown cells expressing siRNA-resistant wild-type eYFP-53BP1, but not in cells expressing eYFP-53BP1 with S366A and/or T670A mutations, which displayed the same diffuse distribution of CHK1 as the 53BP1 knockdown cells (Figure 5D). While CHK1, unlike ATR, is not a direct ligand of TOPBP1, these data suggest that its recruitment to sites of DNA damage in G1 and its activating interaction with ATR, most likely mediated by claspin (Liu et al., 2006), is dependent on the 53BP1-TOPBP1 interaction. Consistent with this functional disruption of ATR and CHK1, we observed significant decreases in DNA damage induced TP53-Ser15 phosphorylation (Shieh et al., 2000; Helt et al., 2005) and total TP53 and p21 levels, in 53BP1 knockdown G1 U2OS cells expressing S366A or T670A eYFP-53BP1, compared to wild-type (Figure 5E,F,G,H).
Figure 5.

Damage checkpoint signalling through ATR is perturbed in 53BP1 phosphorylation site mutants.

(A) ATR activated by phosphorylation on Thr1989 (pATR) forms immunofluorescent foci that co-localise with transfected eYFP-53BP1 in irradiated G1 U2OS cells with siRNA knockdown of endogenous 53BP1. However, co-localisation of ATR foci with eYFP-53BP1 foci is lost in cells expressing eYFP-53BP1 constructs with S366A and T670A mutations. The absence of substantial cyclin A immunofluorescence marks the nuclei of cells in G1. Scale bar, 5 µm. (B) Statistical analysis of pATR and eYFP-53BP1 foci co-localisation per nucleus in irradiated G1 U2OS cells exemplified in (A) More than 100 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutants relative to wild-type were calculated by a Kruskal-Wallis test corrected by Dunn’s multiple comparison test. (C) CHK1 forms distinct immunofluorescent foci in irradiated G1 RPE1 cells transfected with a control scrambled siRNA (SCR). On siRNA knockdown of 53BP1, CHK1 no longer forms discrete foci, but takes on a diffuse pan nuclear distribution. The absence of substantial cyclin A immunofluorescence marks the nuclei of cells in G1. Scale bar, 5 µm. (D) CHK1 focus formation in irradiated G1 RPE1 cells with siRNA knockdown of endogenous 53BP1, is rescued by expression of siRNA-resistant wild-type eYFP-53BP1 but not by eYFP-53BP1 constructs with S366A and T670A mutations. Scale bar, 5 µm. (E) Phosphorylation of the ATR/CHK1 target site, TP53-Ser15, is evident in the nuclei of irradiated U2OS cells stably expressing the wild-type eYFP-53BP1 and depleted for endogenous 53BP1. This signal is significantly diminished in cells expressing eYFP-53BP1 constructs with S366A or T670A mutations. Scale bar, 10 µm. (F) Statistical analysis of mean α-TP53-Ser15 immunfluorescence per nucleus in irradiated G1 U2OS cells exemplified in (E) More than 100 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutants relative to wild-type were calculated by a Kruskal-Wallis test corrected by Dunn’s multiple comparison test. (G) p21/CDKN1A and TP53 nuclear signals are decreased after irradiation in U2OS cells expressing eYFP-53BP1 S366A and T670A mutants and depleted of endogenous 53BP1 compared to a wild-type eYFP-53BP1 control. Neither the TP53-pSer15 (E) nor total TP53 immunofluorescence signals show any pattern of co-localisation with 53BP1, confirming that direct interaction of the two proteins is not significant in the context of DNA damage signalling (Cuella-Martin et al., 2016). Scale bar, 10 µm. (H) Statistical analyses of mean α-p21/CDKN1A (left) and α-TP53 (right) immunfluorescence per nucleus in irradiated G1 U2OS cells exemplified in G) More than 100 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutants relative to wild-type were calculated by a Kruskal-Wallis test corrected by Dunn’s multiple comparison test.

(A) Representative pictures of pATM foci formation 2 hr post IR (9Gy) in RPE1 cells after a 72 hr knockdown period with a 3’UTR 53BP1 siRNA. Wide field pictures are taken with an IX70 Core DeltaVision microscope (scale bar, 40 µm) and magnifications display absence of foci in knocked-down cells (scale bar, 5 µm). Boxplots (right) represent the pATM foci counts per nucleus following 53BP1 depletion in RPE1 cells 2 hr post IR (9Gy). The median, mean (+), 10–90 percentiles and outliers are presented. The pATM foci formation decrease after knockdown is considered significant (p<0.0001) by a a Mann-Whitney test. More than 700 nuclei were counted for each case. (B) pATM foci co-localise with 53BP1 in irradiated U2OS cells with siRNA knockdown of endogenous 53BP1 and transfected with siRNA-resistant eYFP-53BP1. co-localisation is not substantially disrupted by the presence of S366A or T670A mutations in 53BP1. Scale bar, 10 µm. Boxplots (right) statistical analysis of images exemplified in B. More than 200 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutants relative to wild-type were calculated by a Kruskal-Wallis test corrected by Dunn’s multiple comparison test. (C) as B. but for RPE1 cells. More than 300 cells per case were counted. Scale bar, 10 µm.

(A) Western blot demonstrating the specificity of the pATR-pT1989 phospho-specific antibody used for immunofluorescence. The strong band observed in irradiated U2OS cells treated with a control siRNA is not present in irradiated cells treated with a specific siRNA to ATR. (B) Immunofluorescent foci of pATR are evident in irradiated U2OS cells treated with a scrambled control siRNA and to a lesser extent in similarly treated unirradiated cells. Transfection with an siRNA targeting ATR significantly diminishes the observation of pATR foci in both irradiated and non-irradiated cells. Scale bar, 2 µm. (C) Statistical analysis of images exemplified in B. Boxplots (right) represent the pATR foci counts per nucleus. The median, mean (+), 10–90 percentiles and outliers are presented. The pATR foci formation decrease after knockdown is considered significant (p<0.0001) by a Mann-Whitney test. More than 100 nuclei were counted for each case.

Damage checkpoint signalling through ATR is perturbed in 53BP1 phosphorylation site mutants.

(A) ATR activated by phosphorylation on Thr1989 (pATR) forms immunofluorescent foci that co-localise with transfected eYFP-53BP1 in irradiated G1 U2OS cells with siRNA knockdown of endogenous 53BP1. However, co-localisation of ATR foci with eYFP-53BP1 foci is lost in cells expressing eYFP-53BP1 constructs with S366A and T670A mutations. The absence of substantial cyclin A immunofluorescence marks the nuclei of cells in G1. Scale bar, 5 µm. (B) Statistical analysis of pATR and eYFP-53BP1 foci co-localisation per nucleus in irradiated G1 U2OS cells exemplified in (A) More than 100 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutants relative to wild-type were calculated by a Kruskal-Wallis test corrected by Dunn’s multiple comparison test. (C) CHK1 forms distinct immunofluorescent foci in irradiated G1 RPE1 cells transfected with a control scrambled siRNA (SCR). On siRNA knockdown of 53BP1, CHK1 no longer forms discrete foci, but takes on a diffuse pan nuclear distribution. The absence of substantial cyclin A immunofluorescence marks the nuclei of cells in G1. Scale bar, 5 µm. (D) CHK1 focus formation in irradiated G1 RPE1 cells with siRNA knockdown of endogenous 53BP1, is rescued by expression of siRNA-resistant wild-type eYFP-53BP1 but not by eYFP-53BP1 constructs with S366A and T670A mutations. Scale bar, 5 µm. (E) Phosphorylation of the ATR/CHK1 target site, TP53-Ser15, is evident in the nuclei of irradiated U2OS cells stably expressing the wild-type eYFP-53BP1 and depleted for endogenous 53BP1. This signal is significantly diminished in cells expressing eYFP-53BP1 constructs with S366A or T670A mutations. Scale bar, 10 µm. (F) Statistical analysis of mean α-TP53-Ser15 immunfluorescence per nucleus in irradiated G1 U2OS cells exemplified in (E) More than 100 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutants relative to wild-type were calculated by a Kruskal-Wallis test corrected by Dunn’s multiple comparison test. (G) p21/CDKN1A and TP53 nuclear signals are decreased after irradiation in U2OS cells expressing eYFP-53BP1 S366A and T670A mutants and depleted of endogenous 53BP1 compared to a wild-type eYFP-53BP1 control. Neither the TP53-pSer15 (E) nor total TP53 immunofluorescence signals show any pattern of co-localisation with 53BP1, confirming that direct interaction of the two proteins is not significant in the context of DNA damage signalling (Cuella-Martin et al., 2016). Scale bar, 10 µm. (H) Statistical analyses of mean α-p21/CDKN1A (left) and α-TP53 (right) immunfluorescence per nucleus in irradiated G1 U2OS cells exemplified in G) More than 100 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutants relative to wild-type were calculated by a Kruskal-Wallis test corrected by Dunn’s multiple comparison test.

pATM focus colocalisation with 53BP1 is unaffected by mutations in Ser366 or Thr670.

(A) Representative pictures of pATM foci formation 2 hr post IR (9Gy) in RPE1 cells after a 72 hr knockdown period with a 3’UTR 53BP1 siRNA. Wide field pictures are taken with an IX70 Core DeltaVision microscope (scale bar, 40 µm) and magnifications display absence of foci in knocked-down cells (scale bar, 5 µm). Boxplots (right) represent the pATM foci counts per nucleus following 53BP1 depletion in RPE1 cells 2 hr post IR (9Gy). The median, mean (+), 10–90 percentiles and outliers are presented. The pATM foci formation decrease after knockdown is considered significant (p<0.0001) by a a Mann-Whitney test. More than 700 nuclei were counted for each case. (B) pATM foci co-localise with 53BP1 in irradiated U2OS cells with siRNA knockdown of endogenous 53BP1 and transfected with siRNA-resistant eYFP-53BP1. co-localisation is not substantially disrupted by the presence of S366A or T670A mutations in 53BP1. Scale bar, 10 µm. Boxplots (right) statistical analysis of images exemplified in B. More than 200 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutants relative to wild-type were calculated by a Kruskal-Wallis test corrected by Dunn’s multiple comparison test. (C) as B. but for RPE1 cells. More than 300 cells per case were counted. Scale bar, 10 µm.

Validation of pATR antibody in U2OS cells.

(A) Western blot demonstrating the specificity of the pATR-pT1989 phospho-specific antibody used for immunofluorescence. The strong band observed in irradiated U2OS cells treated with a control siRNA is not present in irradiated cells treated with a specific siRNA to ATR. (B) Immunofluorescent foci of pATR are evident in irradiated U2OS cells treated with a scrambled control siRNA and to a lesser extent in similarly treated unirradiated cells. Transfection with an siRNA targeting ATR significantly diminishes the observation of pATR foci in both irradiated and non-irradiated cells. Scale bar, 2 µm. (C) Statistical analysis of images exemplified in B. Boxplots (right) represent the pATR foci counts per nucleus. The median, mean (+), 10–90 percentiles and outliers are presented. The pATR foci formation decrease after knockdown is considered significant (p<0.0001) by a Mann-Whitney test. More than 100 nuclei were counted for each case.

53BP1 and 9-1-1 co-localise in G1 damage foci

ATR localisation to DNA damage sites in S and G2 phases, requires interaction of its constitutive partner, ATRIP, with RPA-bound segments of ssDNA, arising through replication fork collapse, or resection of DSBs by MRN as a prelude to repair by HR (Maréchal and Zou, 2015). Activation of ATR additionally requires interaction with the AAD-domain of TOPBP1, which is recruited to damage sites via interaction with the phosphorylated C-terminus of RAD9 (Lee et al., 2007), within the toroidal RAD9-RAD1-HUS1 (9-1-1) checkpoint clamp (Doré et al., 2009), itself loaded at the inner margin of the ssDNA segment by the RAD17-RFC clamp loader complex (Ohashi and Tsurimoto, 2017). As our biochemical and structural analysis shows that the critical phosphorylation sites on 53BP1 selectively interact with BRCT domains 2 and 5 of TOPBP1, binding of 53BP1 to a TOPBP1 molecule would not in principle preclude simultaneous binding of the RAD9-tail, which is strongly selective for BRCT1 (Rappas et al., 2011; Day et al., 2018). We therefore considered the possibility that TOPBP1 might be able to interact simultaneously with 53BP1 and RAD9 (Figure 6A).
Figure 6.

TOPBP1 physically couples 9-1-1 and 53BP1 complexes.

(A) Schematic of domain architecture of TOPBP1 and interactions. The selective phosphorylation-dependent interactions of 9-1-1 and 53BP1 with different BRCT domains allow for the possibility of their simultaneous interaction with a single TOPBP1 molecule and their collaborative participation in ATR interaction. (B) 53BP1 and RAD9 immunofluorescence foci partially co-localise in irradiated RPE1 cells. Scale bar, 5 µm. (C) Proximity ligation assay (PLA) events (red) for RAD9 and 53BP1 demonstrating the occurrence of RAD9 and 53BP1 molecules within 30–40 nM of each other within the nuclei of irradiated RPE1 cells. Scale bar representing 50 µm and 5 µm are indicated. (D) Scatter plot of PLA events per nucleus for RAD9 – 53BP1 proximity as a function of nuclear Hoechst signal for irradiated (top) and non-irradiated (bottom) RPE1 cells. The PLA signal is predominantly seen in G1 cells (lower Hoechst staining) and is significantly increased by irradiation of the cells. (E) Statistical analysis of PLA events per nucleus in irradiated RPE1 cells shown in D,) showing a significant increase in PLA signals on irradiation. More than 500 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the irradiated versus non-irradiated cells were calculated by a Mann-Whitney test. (F) Statistical analysis of PLA events per nucleus in irradiated RPE1 cells transfected either with a control scrambled siRNA (SCR) or an siRNA directed against TOPBP1 (Figure 6—figure supplement 1C). A very significant decrease in PLA signal between 53BP1 and RAD9 when TOPBP1 is knocked down. More than 200 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the irradiated versus non-irradiated cells were calculated by a Mann-Whitney test. Comparable data for U2OS cells is presented in Figure 6—figure supplement 1B. (G) Statistical analysis of PLA events per nucleus between RAD9 and eYFP, in irradiated U2OS cells with siRNA knockdown of endogenous 53BP1, transfected with either wild-type eYFP-53BP1 or eYFP-53BP1 with S366A and/or T670A mutations. More than 200 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutant versus wild-type eYFP-53BP1 constructs were calculated by a Mann-Whitney test.

(A) Scatter plot of PLA events per nucleus for RAD9 – 53BP1 proximity as a function of nuclear Hoechst signal for irradiated U2OS cells in the presence of either a control scrambled siRNA (top) or an siRNA directed against TOPBP1 (bottom). The PLA signal in the control is predominantly seen in G1 cells (lower Hoechst staining). (B) Statistical analysis of PLA events in A., showing a very significant decrease in PLA signal between 53BP1 and RAD9 when TOPBP1 is knocked down compared to the control siRNA treated cells. More than 150 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the irradiated versus non-irradiated cells were calculated by a Mann-Whitney test. (C) Western blots demonstrating depletion of TOPBP1 protein in U2OS and RPE1 cells treated with siRNA targeted to TOPBP1. (D) Analysis of 53BP1 (left) and RAD9 (centre) foci counts per nucleus in the presence of siRNA knockdown of TOPBP1, and a non-targeting scrambled siRNA control. No significant difference in 53BP1 focus formation is seen between the targeted and non-targeted siRNA treatments. RAD9 foci numbers are decreased in the presence of siTOPBP1, but still present. Consistent with the PLA data, co-localisation of those RAD9 foci with 53BP1 is diminished. More than 200 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the targeting versus scrtambled siRNA were calculated by a Mann-Whitney test.

TOPBP1 physically couples 9-1-1 and 53BP1 complexes.

(A) Schematic of domain architecture of TOPBP1 and interactions. The selective phosphorylation-dependent interactions of 9-1-1 and 53BP1 with different BRCT domains allow for the possibility of their simultaneous interaction with a single TOPBP1 molecule and their collaborative participation in ATR interaction. (B) 53BP1 and RAD9 immunofluorescence foci partially co-localise in irradiated RPE1 cells. Scale bar, 5 µm. (C) Proximity ligation assay (PLA) events (red) for RAD9 and 53BP1 demonstrating the occurrence of RAD9 and 53BP1 molecules within 30–40 nM of each other within the nuclei of irradiated RPE1 cells. Scale bar representing 50 µm and 5 µm are indicated. (D) Scatter plot of PLA events per nucleus for RAD953BP1 proximity as a function of nuclear Hoechst signal for irradiated (top) and non-irradiated (bottom) RPE1 cells. The PLA signal is predominantly seen in G1 cells (lower Hoechst staining) and is significantly increased by irradiation of the cells. (E) Statistical analysis of PLA events per nucleus in irradiated RPE1 cells shown in D,) showing a significant increase in PLA signals on irradiation. More than 500 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the irradiated versus non-irradiated cells were calculated by a Mann-Whitney test. (F) Statistical analysis of PLA events per nucleus in irradiated RPE1 cells transfected either with a control scrambled siRNA (SCR) or an siRNA directed against TOPBP1 (Figure 6—figure supplement 1C). A very significant decrease in PLA signal between 53BP1 and RAD9 when TOPBP1 is knocked down. More than 200 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the irradiated versus non-irradiated cells were calculated by a Mann-Whitney test. Comparable data for U2OS cells is presented in Figure 6—figure supplement 1B. (G) Statistical analysis of PLA events per nucleus between RAD9 and eYFP, in irradiated U2OS cells with siRNA knockdown of endogenous 53BP1, transfected with either wild-type eYFP-53BP1 or eYFP-53BP1 with S366A and/or T670A mutations. More than 200 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the mutant versus wild-type eYFP-53BP1 constructs were calculated by a Mann-Whitney test.
Figure 6—figure supplement 1.

RAD9 - 53BP1 Proximity Ligation Assay in U2OS Cells.

(A) Scatter plot of PLA events per nucleus for RAD9 – 53BP1 proximity as a function of nuclear Hoechst signal for irradiated U2OS cells in the presence of either a control scrambled siRNA (top) or an siRNA directed against TOPBP1 (bottom). The PLA signal in the control is predominantly seen in G1 cells (lower Hoechst staining). (B) Statistical analysis of PLA events in A., showing a very significant decrease in PLA signal between 53BP1 and RAD9 when TOPBP1 is knocked down compared to the control siRNA treated cells. More than 150 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the irradiated versus non-irradiated cells were calculated by a Mann-Whitney test. (C) Western blots demonstrating depletion of TOPBP1 protein in U2OS and RPE1 cells treated with siRNA targeted to TOPBP1. (D) Analysis of 53BP1 (left) and RAD9 (centre) foci counts per nucleus in the presence of siRNA knockdown of TOPBP1, and a non-targeting scrambled siRNA control. No significant difference in 53BP1 focus formation is seen between the targeted and non-targeted siRNA treatments. RAD9 foci numbers are decreased in the presence of siTOPBP1, but still present. Consistent with the PLA data, co-localisation of those RAD9 foci with 53BP1 is diminished. More than 200 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the targeting versus scrtambled siRNA were calculated by a Mann-Whitney test.

RAD9 - 53BP1 Proximity Ligation Assay in U2OS Cells.

(A) Scatter plot of PLA events per nucleus for RAD953BP1 proximity as a function of nuclear Hoechst signal for irradiated U2OS cells in the presence of either a control scrambled siRNA (top) or an siRNA directed against TOPBP1 (bottom). The PLA signal in the control is predominantly seen in G1 cells (lower Hoechst staining). (B) Statistical analysis of PLA events in A., showing a very significant decrease in PLA signal between 53BP1 and RAD9 when TOPBP1 is knocked down compared to the control siRNA treated cells. More than 150 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the irradiated versus non-irradiated cells were calculated by a Mann-Whitney test. (C) Western blots demonstrating depletion of TOPBP1 protein in U2OS and RPE1 cells treated with siRNA targeted to TOPBP1. (D) Analysis of 53BP1 (left) and RAD9 (centre) foci counts per nucleus in the presence of siRNA knockdown of TOPBP1, and a non-targeting scrambled siRNA control. No significant difference in 53BP1 focus formation is seen between the targeted and non-targeted siRNA treatments. RAD9 foci numbers are decreased in the presence of siTOPBP1, but still present. Consistent with the PLA data, co-localisation of those RAD9 foci with 53BP1 is diminished. More than 200 nuclei were counted per case. Median, mean (+), 10–90 percentiles and outliers are represented in boxplots. p values for the targeting versus scrtambled siRNA were calculated by a Mann-Whitney test. To explore this, we looked at the distributions of 53BP1 and 9-1-1 (via RAD9) in the nuclei of irradiated G1 RPE1 cells, and observed substantial coincidence of 53BP1 and RAD9 foci (Figure 6B). To determine whether this co-localisation reflects 53BP1 and 9-1-1 being in physical proximity within a site of DNA damage, we utilised a cellular proximity ligation assay (PLA) (Duolink, Sigma-Aldrich UK – see Materials and methods), which generates a fluorescent focus when two target proteins are within 30–40 nm of each other. We observed a strong PLA signal between RAD9 and 53BP1 in irradiated cells (Figure 6C), which increased significantly on exposure to IR (Figure 6D,E), with the major effect occurring in cells featuring the lowest Hoechst intensity typical of G1 cells with low DNA content. When TOPBP1 levels were knocked down by siRNA, we observed a significant loss of the proximity signal between RAD9 and 53BP1 in irradiated cells (Figure 6F), consistent with TOPBP1 playing a pivotal role in bringing these two damage recognition proteins into proximity. Similar results were obtained with U2OS cells (Figure 6—figure supplement 1). We were also able to detect PLA signals between RAD9 and eYFP in U2OS cells with 53BP1 siRNA knockdown in which eYFP-53BP1 was transiently transfected. However, consistent with the role of pSer366 and pThr670 in mediating recruitment of the eYFP-53BP1 to TOPBP1 and thereby bringing it into close proximity to RAD9, the RAD9-eYFP PLA signal was significantly diminished when the cells were transfected with eYFP-53BP1 constructs with S366A and T670A mutations (Figure 6G).

Discussion

53BP1 is a highly post-translationally modified protein, with more than 200 phosphorylation sites documented in the human protein (Hornbeck et al., 2004), of which only a handful have been associated with any biological function (Panier and Boulton, 2014). This presents a truly enormous challenge to understanding which of these phosphorylations are significant in which aspect of the complex biology of this protein, and what interactions or allosteric changes they mediate. Here we have identified a set of experimentally observed phosphorylation sites that mediate interaction of 53BP1 with TOPBP1 and thereby facilitate important aspects of the DNA damage response, mirroring the behaviour of their fission and budding yeast homologues Crb2 and Rad9p, and Rad4 and Dpb11. The major interacting sites, Ser366 and Thr670, are strongly conserved in metazoa, and found to be phosphorylated in human, mouse and rat cells (Hornbeck et al., 2004). Although these SP/TP sites resemble typical CDK substrates, we find that their phosphorylation is enhanced in response to DNA damage, and is not prevented by a broad range of CDK kinase inhibitors (data not shown) suggesting that they are not under cell cycle control. This contrasts with fission and budding yeasts, where phosphorylation of the sites mediating Crb2 and Rad9p interaction with Rad4 and Dpb11p are under CDK-dependent cell cycle regulation (Du et al., 2006; Pfander and Diffley, 2011; Qu et al., 2013). However, a recent study also identifies a DNA damage-dependent and cell cycle-independent pathway for phosphorylation of the sites mediating interaction of budding yeast Rad9p with Dpb11p (di Cicco et al., 2017), which may be comparable to that we describe here for the human proteins. Although mutation of either Ser366 or Thr670 impacts on the DNA damage response, the strongest effects are seen when neither site can be phosphorylated. This suggests that the affinity of TOPBP1 for 53BP1 is enhanced by cooperative binding of BRCT1,2 and BRCT4,5 of TOPBP1 to a single pS366-pS670-53BP1 molecule, and may explain the failure of isolated TOPBP1-BRCT0,1,2 and BRCT4,5 constructs to co-localise with 53BP1 at sites of DNA damage (Cescutti et al., 2010). While disruption of the TOPBP1-53BP1 interaction had no effect on co-localisation of pATM with 53BP1 in G1, it severely disrupts co-localisation of ATR with 53BP1, downstream activation of CHK1 and TP53, and consequent G1/S checkpoint. This is fully consistent with observations of the importance of ATR for repair of IR-induced damage in G1 (Gamper et al., 2013), as well as its well-described role in S and G2. The prevailing model for ATR checkpoint activation in late S and G2 phases, depends on the presence of extended segments of ssDNA and is usually associated with repair by homologous recombination (HR). DNA double-strand breaks (DSB) occurring in G1, where homologous sister chromatids are not available, are preferentially repaired via NHEJ rather than HR. However, recent evidence suggests that a limited amount of resection nonetheless occurs at G1 DSBs as a prelude to canonical NHEJ repair (Averbeck et al., 2014; Biehs et al., 2017) and generates sufficient ssDNA to bind at least a few molecules of RPA, providing a platform for recruiting ATR-ATRIP. In these circumstances, rather than RAD17-RFC and 9-1-1 then being sufficient for bringing in TOPBP1 to fully anchor and activate ATR-ATRIP, our data strongly suggest that it is instead 53BP1 that plays this critical role in G1, through interaction of DNA damage responsive phosphorylation sites at Ser366 and Thr670, with the BRCT-domain clusters in the N-terminus of TOPBP1 (Figure 7).
Figure 7.

A model for ATR activation through phospho-dependent interaction of 53BP1 and TOPBP1.

(A) Following irradiation, the Mre11-Rad50-Nbs1 (MRN) complex is recruited to broken ends of a DNA double-strand break, and facilitates recruitment and activation of ATM, which phosphorylates H2AX-Ser139 to generate the γ-H2AX signal. (B) Limited resection of the broken ends by MRN and CtIP (not shown), provides binding sites for the ssDNA-binding RPA complex, and for loading of the RAD9-RAD1-HUS1 checkpoint clamp (9-1-1) at the dsDNA-ssDNA junction by the RAD-RFC clamp loader. The γ-H2AX signal leads to recruitment of MDC1 and RNF168 (not shown) resulting in H2A ubiquitylation and consequent recruitment of 53BP1, which interacts with multiple post-translational modifications on nucleosomes in the vicinity of the break. (C) Phosphorylation of 53BP1-Ser366 and Thr670 by an as yet unidentified kinase, facilitates 53BP1 interaction with TOPBP1, which can simultaneously bind 9-1-1 via the phosphorylated C-terminus of RAD9, leading to recruitment and activation of ATR and CHK1. Whether the 53BP1 and ATR-ATRIP complexes bridged by TOPBP1 are on the same side of a break, or on opposite sides of a break as shown here, remains to be determined.

A model for ATR activation through phospho-dependent interaction of 53BP1 and TOPBP1.

(A) Following irradiation, the Mre11-Rad50-Nbs1 (MRN) complex is recruited to broken ends of a DNA double-strand break, and facilitates recruitment and activation of ATM, which phosphorylates H2AX-Ser139 to generate the γ-H2AX signal. (B) Limited resection of the broken ends by MRN and CtIP (not shown), provides binding sites for the ssDNA-binding RPA complex, and for loading of the RAD9-RAD1-HUS1 checkpoint clamp (9-1-1) at the dsDNA-ssDNA junction by the RAD-RFC clamp loader. The γ-H2AX signal leads to recruitment of MDC1 and RNF168 (not shown) resulting in H2A ubiquitylation and consequent recruitment of 53BP1, which interacts with multiple post-translational modifications on nucleosomes in the vicinity of the break. (C) Phosphorylation of 53BP1-Ser366 and Thr670 by an as yet unidentified kinase, facilitates 53BP1 interaction with TOPBP1, which can simultaneously bind 9-1-1 via the phosphorylated C-terminus of RAD9, leading to recruitment and activation of ATR and CHK1. Whether the 53BP1 and ATR-ATRIP complexes bridged by TOPBP1 are on the same side of a break, or on opposite sides of a break as shown here, remains to be determined. We previously showed that TOPBP1-BRCT1 provides the highest affinity binding-site for pRAD9 (Rappas et al., 2011; Day et al., 2018), and the data presented here implicate BRCT2 and BRCT5 as the primary binding sites for phosphorylated 53BP1. Thus, a single TOPBP1 molecule could in principle bind 53BP1 and 9-1-1 in concert. In support of this idea we found that DNA damage causes both of these TOPBP1 ligands to localise not more than 30–40 nm from each other in DNA damage foci – a distance comparable to ~100 bp of linear DNA or the predicted length of the unstructured tail of RAD9 in a random-coil conformation – making it highly likely that the 53BP1 and RAD9 proteins generating the PLA signals are bound to the same TOPBP1 molecule. Regardless of this involvement of 9-1-1, our data clearly show that it is the interaction of TOPBP1 with 53BP1 that is critical for ATR localisation and activation in G1. These results reveal a consistent role for TOPBP1 in localising and activating ATR at sites of DNA damage, but show that this depends on phosphorylation-mediated interactions with different recruitment factors at different stages of the cell cycle.

Materials and methods

Contact for reagent sharing

Further information and requests for reagents should be directed to and will be fulfilled by the Lead Contact, Laurence Pearl (laurence.pearl@sussex.ac.uk).

Experimental model and subject details

See Key Resources Table for information on bacterial strains used as sources of material in this study.

Generation of pEYFP-53BP1

Two separate fragments of 53BP1 cDNA were amplified by PCR from the pCMH6K HA-53BP1 plasmid harbouring three silent mutations that confer siRNA resistance (Noon et al., 2010). The two amplicons were inserted into the BglII/BamHI sites of peYFP-C1a by In-Fusion cloning (Clontech). Ser366Ala (S366A), Thr670Ala (T670A) and Ser366Ala/Thr670Ala (S366A/T670A) mutations were created by site-directed mutagenesis. All constructs were verified by Sanger sequencing.

Cell culture and transfection

HeLa, U2OS and RPE1 cells used in this study derive from central stocks in the Genome Damage and Stability Center at the University of Sussex (http://www.sussex.ac.uk/gdsc/facilities) and are STR-validated and determined as mycoplasma free by MycoAlert (Lonza). HeLa and U2OS cells were cultured in DMEM supplemented with 10% (v/v) fetal calf serum (FCS), 1% (v/v) penicillin/streptomycin mix, and 1% (v/v) L-glutamine. RPE1 active hTert cells were cultured in DMEM F12 supplemented with 10% (v/v) FCS and 1% (v/v) penicillin/streptomycin mix. Transfections with siRNA were carried out with Lipofectamine RNAiMAX Transfection Reagent (ThermoFisher Scientific). Briefly, 0.25 × 106 cells were seeded in 35 mm wells. The next day, according to the manufacturer’s instructions, 7.5 µL per well of RNAiMAX were used to transfect cells, obtaining a final concentration of 20 nM for the added siRNA (53BP1, ATR, TOPBP1, see Key Resources Table for sequences). Knockdown efficiencies were confirmed either by western blot or immunofluorescence. All experiments requiring prior siRNA transfection, involved an 72 hr period of exposure to siRNA treatment. Complementation experiments were performed by transiently transfecting siRNA-resistant 53BP1 constructs (pCMH6K HA-53BP1 or pEYFP-53BP1 depending on the experiment). For each 35 mm well containing HeLa cells, 1.5 µg of plasmid was transfected with NanoJuice Core Transfection Reagent and Booster at a ratio of 3:1 (Reagent:DNA). U2OS and RPE1 cells were transfected using Cell Line Nucleofector Kit V and a Nucleofector electroporator (Lonza) according to the manufacturer’s instructions. Briefly, 1 × 106 cells were electroporated with 1.5 µg of plasmid, then allowed to recover for a period of 6 hr in their respective 20% FCS media. The media was then refreshed (10% FCS), and cells cultured for a further 14 hr to allow protein expression from the transfected plasmids.

Generation of stable U2OS cell lines

Stably transfected U2OS cells were generated using using Cell Line Nucleofector Kit V and a Nucleofector electroporator (Lonza). After 24 hr, cells that had integrated plasmid were selected in media supplemented with G418 (400 µg mL−1 Sigma-Aldrich) for 10 days. Surviving colonies were used to seed subsequent experiments.

Method details

Protein expression and purification

TOPBP1 constructs for biochemical and structural analysis were expressed in E. coli and purified by conventional chromatography, as previously described (Rappas et al., 2011; Qu et al., 2013; Day et al., 2018).

Fluorescence polarization experiments

Binding to TOPBP1-BRCT0,1,2, and -BRCT4,5 domains were determined using fluorescein-labelled peptides and BRCT fusion proteins as previously described (Rappas et al., 2011; Qu et al., 2013; Day et al., 2018).

X-ray crystallography

Co-crystals of the TOPBP1-BRCT0,1,2–53BP1-pT670 complex and TOPBP1-BRCT4,5–53BP1-pS366 complex were grown by vapour diffusion from conditions optimised from initial hits in E1 (10% w/v PEG 20 000, 20% v/v PEG MME 550 0.03 M of each ethylene glycol 0.1 M MES/imidazole pH 6.5) and G7 (10% w/v PEG 4000, 20% v/v glycerol 0.02 M of each carboxylic acid 0.1 M MOPS/HEPES-Na pH 7.5) of the MORPHEUS screen (Molecular Dimensions) prior to plunge-freezing in liquid nitrogen. Data were collected on the I04 and I03 beamlines at the Diamond Synchrotron Lightsource and the structures were determined by molecular replacement using PDB models 2XNH and 3UEN. Processing and refinement were carried out using the CCP4 and PHENIX suites of programs. For the final TOPBP1-BRCT4,5–53BP1-pS366 structure refinements with Phenix, NCS was imposed with chains A and C, B and D, and P and R, being paired together. Statistics for data collection and refinement are presented in Supplementary file 1. Coordinates and structure factors have been deposited in the Protein Databank with accession codes 6RML (pT670 complex) and 6RMM (pS366 complex).

DNA damage induction

Unless otherwise stated, DNA damage was produced by exposing cells to a 9 Gy radiation dose using a Gamma-cell 1000 Elite irradiator (Caesium137 gamma source). Post-exposure, cells were allowed to recover for a period of 4 hr at 37°C.

G1/S cell cycle detection

Prior to infection, 1 × 105 eYFP-53BP1 WT Ser366Ala or Thr670Ala U2OS cells were first transfected in 35 mm wells with 53BP1 siRNA. Twenty-four hours later, cells were incubated with ~20 viral particles per cell (20 µL) of Cdt1-RFP Premo FUCCI Cell Cycle Sensor (ThermoFisher Scientific). After a further period of 24 hr, cells were exposed to gamma radiation.

Immunofluorescence and microscopy

Transfected or non-transfected cells were cultured on 10 mm round cover glasses (VWR). Prior to fixation, cells were incubated with Hoechst 33342 (5 µg mL−1 in PBS) for 15 min at 37°C, then washed three times with ice-cold PBS. Cells were fixed with cold methanol for 20 min (−20°C) (unless otherwise stated) and again washed three times with ice-cold PBS. Cells were blocked using a 4% (w/v) bovine serum albumin (BSA) solution in PBS for 15 min on ice. Primary and secondary antibody incubations were carried out at room temperature for 1 hr in BSA/PBS, followed by three sequential washes with PBS and a single wash with 0.1% (v/v) TritonX-100 in PBS. Mounting on glass slides was carried out with ProLong Diamond Antifade Mountant (ThermoFisher Scientific). Images were acquired with either an Olympus-3i spinning disc microscope equipped with a Hamamatsu ORCA-flash4.0lT digital CMOS camera and using an UPLANSAPO 60X/1.35 oil objective in confocal mode, or with an Olympus IX70 Core DeltaVision microscope equipped with a CoolSnap HQ2 camera and an UApo N340 40X/1.35 oil immersion objective. Images were captured sequentially at designated wavelengths at a resolution of 512 × 512 pixels. Scale bars were added to pictures after calculation to convert pixels to micrometres (µm). Images were analysed using CellProfiler (http://cellprofiler.org) (Carpenter et al., 2006). Nuclei were detected as primary objects, with foci detection and mean intensity fluorescence measurement carried out for each object. The quoted correlation coefficient, ranges from −1 (complete inverse correlation) to +1 (complete correlation), and corresponds to the measured normalised covariance (covariance divided by the product of standard deviation of pixels in each image) similar to a Pearson’s coefficient. Montages of representative pictures were created using FIJI (http://fiji.sc) (Preibisch et al., 2009).

Checkpoint analysis

U2OS cells were reverse-transfected with 53BP1 siRNA. Forty-eight hours later, cells were transfected with an siRNA-resistant construct containing either wild-type HA-53BP1 or one of the phosphorylation mutants. Fifteen hours later, cells were incubated for a period of 1 hr with EdU (10 µM) and irradiated with 2 Gy ionising radiation, before the addition of BrdU (10 µM) and nocodazole (0.25 µg mL−1). Cells were incubated for a further period of 7 hr before staining. Fixation of cells was performed using a 4% (v/v) paraformaldehyde in PBS solution at room temperature for 15 min. Fixed cells were then permeabilised with a 0.5% (v/v) TritonX-100 in PBS solution for 20 min at room temperature. The subsequent steps for EdU staining carried out as indicated in the protocol provided with the Click-iT EdU Alexa Fluor 647 Imaging Kit (ThermoFisher Scientific). Detection of BrdU required prior incubation of cells with 2N HCl for 60 min at 37°C in order to denature genomic DNA. After neutralisation of the HCl with boric acid (pH8.5) for a period of 30 min, cells were then blocked with a 4% (w/v) BSA/PBS solution for 1 hr. Antibody-staining for HA and BrdU were performed overnight at 4°C. Treated cells were imaged with a ScanR microscope (Olympus Life Science), with cells staining for EdU incorporation ignored for subsequent analysis. The entry of cells into S-phase, after DNA damage was quantified by counting only cells that had incorporated BrdU, but not EdU (BrdU+/EdU-). To determine the proportion of cells at each cell cycle phase, U2OS cells processed as above, were also analysed on the ScanR microscope, after 4 hr of exposure to 8 Gy of ionising radiation. Only cells expressing either wild-type HA-53BP1 or phosphorylation site mutants (Ser366Ala and Thr670Ala) were compared. Thirty-six images per well were analysed for DAPI intensity and total internal FITC intensity, in order to generate a cell cycle profile of transfected cells.

Western blots

For western blots of damage-induced 53BP1 phosphorylation, HeLa cells were reverse transfected with either siRNA targeting 53BP1 or a non-targeting control, and then incubated for a period of 48 hr at 37 ˚C. Cells were then exposed to 8 Gy of ionising radiation and allowed to recover for 4 hr before being lysed by re-suspension of the frozen cell pellets in 2 mL of RIPA buffer (Sigma-Aldrich) supplemented with EDTA-free protease- and PhosSTOP phosphatase-inhibitor tablets (Roche Diagnostics, Burgess Hill, UK) and 40 μl Benzonase endonuclease (25 Units μL−1, Merck-Millipore), followed by disruption in a Bioruptor Pico with water cooler (Diagenode, Seraing, Belgium). Cell debris and insoluble material were removed by centrifugation at 16,000 x g, for 10 min at 4°C, followed by dilution in 10 mM Tris-HCl pH 7.5, 150 mM NaCl, 0.5 mM EDTA, 0.5 mM TCEP supplemented with protease and phosphatase inhibitor tablets as before. Following separation by SDS-PAGE, samples were transferred to a nitrocellulose membrane and probed for the presence of immuno-reactive species by chemi-luminescent western blot (see Key Resources Tables for details of antibodies and dilutions).

Proximity Ligation Assay (PLA)

For endogenous 53BP1-RAD9 protein proximity ligation assays, U2OS or RPE1 cells were seeded at a density of 2.5 × 105 cells per cm2 on 10 mm round glass coverslips and cultured for 24 hr. Cells were irradiated (9Gy) or not (control), stained in a Hoechst 33342 (5 µg mL−1 in PBS) solution and fixated with methanol for 20 min at −20°C. After three washes in PBS 1X, the ligation experiment was performed according to the manufacturer's instructions using the Duolink In Situ Orange Starter Kit Goat/Rabbit (Sigma-Aldrich). Briefly, cells were blocked for 60 min at 37°C in a heated humidified chamber and subsequently incubated with 53BP1 and Rad9 antibodies (Bethyl Laboratories) for 1 hr. After two washes, coverslips were incubated with a PLUS-MINUS probe solution for another 1 hr at 37°C followed by washes and a 30 min ligation step at 37°C. Eventually, proximity ligation events were amplified for 100 min at 37°C. After washes and mounting of the coverslips, proximity events were observed by fluorescence microscopy and normalised to the number of nuclei. In case of TOPBP1 knockdown experiment, transfections were carried out with Lipofectamine RNAiMAX Transfection Reagent (ThermoFisher Scientific). Briefly, 0.25 × 106 U2OS or RPE1 cells were seeded on 10 mm round glass coverslips in a 35 mm well. The next day, according to the manufacturer’s instructions, 7.5 µL per well of RNAiMAX were used to transfect cells, obtaining a final concentration of 20 nM for the added TOPBP1 siRNA (see Key Resources Table for sequences). After an 72 hr period of exposure to TOPBP1 siRNA, samples were submitted to the PLA. For the transfected eYFP-53BP1RAD9 proximity ligation assays, U2OS cells knocked-down for endogenous 53BP1 were transfected with eYFP-53BP1 WT or the double mutant S366A T670A. Cells were irradiated (9 Gy) and stained with Hoechst 33342 after a 3 hr recovery period. Subsequently cells were fixated at −20°C with methanol for 20 min. A proximity ligation assay (PLA) was performed using the Duolink In Situ Detection Kit (Sigma Aldrich) according to the manufacturer's instructions, using an anti-Rad9 antibody (Rabbit polyclonal, A300-890A-T, Bethyl Laboratories, Inc) and an anti-GFP antibody (Mouse monoclonal [LGB-1], Abcam) to respectively detect the endogenous Rad9 and eYFP-53BP1. Several Z stacks including the depth of nuclei were acquired using an Olympus-3i spinning disc microscope in confocal mode. Images were Z projected and PLA events were analysed with Cell Profiler. More than 200 nuclei were counted per case. Results are represented as boxplots showing the median, the mean and the 10th- 90th percentiles. Statistical significance was determined with a Mann-Whitney test. Scale bar: 10 µm.

Quantification and statistical analysis

All statistical analysis was carried out with Prism six software (GraphPad Software Inc, CA USA). Dissociation constants (K) were determined by non-linear regression to a one site-specific binding model. The statistical significance of changes in cell cycle was determined using a standard χ2-test. When only two variables were compared, significance was assessed by a two-sided Student’s t-test. When more than two variables were compared, significance was assessed by a non-parametric Kruskal-Wallis test, corrected by the Dunn’s multiple comparison test. Graphs show adjusted p-values only when differences are considered to be significant; *p<0.05; **p<0.01; ***p<0.001. Histograms show mean values, with error bars corresponding to one standard deviation. Boxplots show median (bar), mean (cross), 10th and 90th percentiles, with outliers plotted individually.

Data and software availability

Coordinates and structure factors for the TOPBP1-BRCT0,1,2 complex with 53BP1-pThr670 peptide and for the TOPBP1-BRCT4,5 complex with 53BP1-pSer366 peptide, have been deposited in the RCBS Protein Databank with accession codes 6RML and 6RMM. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. [Editors’ note: this article was originally rejected after discussions between the reviewers, but the authors were invited to resubmit after an appeal against the decision.] Thank you for submitting your work entitled "Phosphorylation-mediated interactions with TOPBP1 couple 53BP1 and 9-1-1 to control the G1 DNA damage checkpoint" for consideration by eLife. Your article has been reviewed by three peer reviewers, including Volker Dötsch as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by a Senior Editor. Our decision has been reached after consultation between the reviewers. Based on these discussions and the individual reviews below, we regret to inform you that your work will not be considered further for publication in eLife. As you will see in the individual reviews, all reviewers recognize the importance of investigating the mechanistic details of checkpoint assembly and execution. The overall feeling, however, following discussion among the reviewers, was that significant aspects of this manuscript have been published previously, reducing the level of novelty. Some technical aspects of the checkpoint assays have also been questioned. Reviewer #1: Bigot et al. describe an investigation of the interaction of the two scaffold proteins TOPBP1 and 53BP1 with each other as well as with other proteins. Both proteins are major scaffold proteins that are important for organizing the DNA damage response. While TOPBP1 is involved in activating ATR following single strand breaks while 53BP1 is a key protein important for the decision as to which DNA repair mode of double strand breaks is being activated. In a recent study this group had identified consensus peptide sequences that in a phosphorylated mode are recognized by the different BRCT domains of TOPBP1. Building in these results the authors now show how two phosphorylation sites in 53BP1 are involved in mediating the interaction with TOPBP1 and that this interaction is important for the G1/S phase check point. They show that the activation of ATR is compromised when the 53BP1-TOPBP1 interaction is disrupted resulting in a reduced activation of p53. Overall, this is a nice work that includes structural aspects of the described interactions as well as functional data based on cell culture experiments. These results are important for understanding the selective activation of ATR vs ATM. The study presented is heavily based on co-localization to show interaction. It would be better to show direct interaction by IPs and the use of DNAse to investigate if interactions in coIP experiments are mediated by DNA or are direct. Have the authors tried to use IPs? Reviewer #2: This manuscript describes how phosphorylation at Ser366 and Thr670 of 53BP1 results in a phospho-dependent interaction with BRCT domains in TOPBP1. They determine the crystal structures for TOPBP1 BRCT domains with the two phosphopeptides of 53BP1 and generate phopho-specific antibodies. They then follow the role of this interaction upon DNA damage for recruitment of TOPBP1, ATR and CHK1 to 53BP1 foci, whereas it does not affect ATM recruitment. Loss of 53BP1 phosphorylation leads to a greatly reduced G1/S checkpoint and a perturbed cell cycle distribution. The authors then study the interaction with 9-1-1 complex, and show colocalization. They use a PLA assay to suggest that a single TOPBP1 molecule can bridge between 53BP1 and Rad9 in the 9-1-1 complex. This is an interesting manuscript that goes significantly beyond what was known for the yeast homologs Rad4 and Crb. However, some further analysis is required to firm up the conclusions: Specifically: - It is not clear that the 9-1-1 colocalization is really phosphorylation dependent. This could be tested by a repeat the 9-1-1 colocalizations with the phospho-mutant vs WT 53BP1 in the knockdown context - The PLA assay is interpreted as indicating that a single TOPBP1 molecule bridges between 53BP1 and Rad9. This could be tested in a complementation assay, where a BRCT1 and a BRCT2 mutant of TOPBP1 are simultaneously expressed. - The crystal structures are relatively low resolution and not yet ideally refined. At this resolution (local) NCS restraints would do much to improve the quality of the final structures. The structures need to correct some local errors (e.g. an Arg side chain points out of the available density) Reviewer #3: This manuscript has multiple conceptual and technical weaknesses: The interaction between 53BP1 and TopBP1 and its role in the G1 checkpoint has already been reported (Cescutti et al., 2010). Although this study provides some new details, the overall model is not significantly advanced. Furthermore, TopBP1 also interacts with MDC1 in a phosphorylation-mediated manner, which was also shown to regulate ATR activation (Wang et al. 2011 JCB). The structural details of the TopBP1-MDC1 interaction has been analyzed and reported (Leung et al., 2013). Given that the localization of 53BP1 to DNA damage sites is dependent on MDC1, the function of 53BP1 in ATR regulation must be regulated by MDC1. Overall, the results of this study only add new details to an existing model but do not advance the model significantly. This manuscript also suffers from several significant technical problems. For example, many experiments in this study used Cyclin A- as a marker for G1 cells. Cyclin A is largely a soluble nuclear protein. However, this study apparently used detergent-extracted cells for Cyclin A staining (Figure 4A). I am not sure if they have identified G1 cells correctly. The G1 checkpoint assay used in this study was not properly done. I don't see any BrdU+ EdU- cells in the si53BP1+IR sample in Figure 4C. I am not sure how the authors can conclude that 53BP1 knockdown abolished the G1 checkpoint. In Figure 4D, only BrdU labeling but not EdU/BrdU sequential labeling was done. This is not the proper G1 checkpoint assay. How can the authors be sure that these are G1 cells moving into S phase? In Figure 3C, why did anti-pT670 antibody detect nuclear foci that did not colocalize with eYFP-53BP1? In Figure 5A, pATR formation is not defective in cells expressing the TopBP1 T670A mutant. pATR just did not colocalize with eYFP-53BP1. Where is pATR in these cells? Would this result argue against the requirement of TopBP1 phosphorylation at T640 for ATR activation? In Figure 5C, it is surprising that some many Chk1 foci were detected. Chk1 is mobile protein after DNA damage. In Figure 6F, there are no controls to check the effects of siTopBP1 on 53BP1 and RAD9 foci. Both 53BP1 and RAD9 are known to localize to DNA damage sites through TopBP1-independnet mechanisms. How does TopBP1 affects the 53BP1-RAD9 colocalization? The model in Figure 7 is not supported by data. What is the evidence that 53BP1 recruits TopBP1? If 53BP1 recruits TopBP1 in G1 cells, why are 53BP1 and RAD9 colocalized? What is the evidence that 53BP1 functions independently of RAD9 to regulate ATR? I don't understand the logic of the model proposed. [Editors’ note: the author responses to the first round of peer review follow.] Reviewer #1: […] The study presented is heavily based on co-localization to show interaction. It would be better to show direct interaction by IPs and the use of DNAse to investigate if interactions in coIP experiments are mediated by DNA or are direct. Have the authors tried to use IPs? We have based our study on microscopy techniques because we need to look at the interactions we are interested in as a function of the cell cycle stage, which we can determine in microscopy experiments on a per cell basis using markers such as Cdt1, CyclinA and/or the intensity of DAPI/Hoescht staining. Of course the resolution of standard or even super-resolution fluorescence microscopy does not mean that optically co-localising proteins are actually interacting, but we have extended the approach using the proximity ligation assay (PLA) which does allow us to assign a high probability of direct interaction while retaining the ability to assign the cell cycle stage of the cell in which the PLA signal was observed. To achieve the same in a biochemical approach, even if the IP could be made to work cleanly, would require us either to synchronise the cell cultures, which affects the signalling pathways we are looking at, or to try and sort cells using a FACS approach. This is not something we have any expertise in and we do not know how easy it is to FACS sort the cell types we use, which are quite adherent and better suited for microscopy than free suspension. We have nonetheless performed some pull-down experiments early on in the study to look at the interaction of TOPBP1 and 53BP1 in asynchronous cell cultures, and did obtain some promising results. An example is shown in Author response image 1, in which we could obtain an immunodetectable signal for TOPBP1 co-precipitated from cells transfected with HA-tagged 53BP1 constructs. These data certainly show a lower yield of co-precipitated TOPBP1 from cells transfected with 53BP1 with mutations in the key phosphorylation sites, but the signals are not strong and don’t reliably exceed the likely variation in the transfection efficiency and expressions levels between the different 53BP1 constructs. Furthermore, the experiment was not always reproducible and so we took the decision not to include this data in the manuscript.
Author response image 1.
Large scaffold proteins such as 53BP1 and TOPBP1 make multiple interactions and are very intimately associated with chromatin – and not just with its DNA – so that the harsh treatment required to release them into the soluble fraction will commonly disrupt many of the protein-protein interactions in which we are interested. It would be possible in principle to cross-link the cells as is done in ChIP for example, and then to try and use mass spectrometry to look for cross-linked 53BP1 and TOPBP1 peptides. However, cross-link mass spec of whole cells is a very specialist activity and not something we could access within a reasonable time-scale. Reviewer #2: […] This is an interesting manuscript that goes significantly beyond what was known for the yeast homologs Rad4 and Crb. However, some further analysis is required to firm up the conclusions: Specifically: - It is not clear that the 9-1-1 colocalization is really phosphorylation dependent. This could be tested by a repeat the 9-1-1 colocalizations with the phospho-mutant vs WT 53BP1 in the knockdown context We suggest that the observed co-localisation of 53BP1 and 9-1-1 results from their common and complementary ability to interact with TOPBP1 in a phospho-dependent manner. The phosphorylation-dependency of the 9-1-1 interaction with TOPBP1 is well documented in the literature while that of 53BP1 with TOPBP1 is clearly demonstrated here, but the reviewer is absolutely correct that we have not formally demonstrated that the co-localisation we observe for 53BP1 and 9-1-1 is fully dependent on the phosphorylation-dependent interaction of 53BP1 with TOPBP1, although this is a very reasonable conclusion to draw from the rest of the data, even without the experiment that the reviewer suggests. We have performed this additional experiment, by transfecting wild-type and S366A/T670A eYFP-53BP1 constructs into U2OS cells with siRNA knockdown of endogenous 53BP1, and observe a significant decrease on levels proximity ligation events between RAD9 and the eYFP-53BP1 that are fully consistent with the expectation from our model. This data has been added to Figure 6 in the revised manuscript. We thank the reviewer for their helpful suggestion which strengthens the conclusions of our work. - The PLA assay is interpreted as indicating that a single TOPBP1 molecule bridges between 53BP1 and Rad9. This could be tested in a complementation assay, where a BRCT1 and a BRCT2 mutant of TOPBP1 are simultaneously expressed. The Duolink PLA system we use is well established in the literature as reporting on protein-protein proximities with a maximal separation of 40nm – a distance about 1.5x the diameter of a single ribosome and comparable to the predicted contour length of the unstructured C-terminal tail of RAD9. On the basis of the TOPBP1-dependent PLA signal we observe between 9-1-1 and 53BP1, the simplest and most likely explanation is that they are binding to the same TOPBP1 molecule. However, we haven’t formally eliminated the possibility that TOPBP1 could be interacting with 9-1-1 and 53BP1 as a dimer (or higher oligomer) in which singly-liganded TOPBP1 molecules bring 9-1-1 and 53BP1 into close proximity through self-association. There is a limited literature, all from the same lab, suggesting that mammalian TOPBP1 (but not its yeast homologues) can undergo oligomerisation dependent on phosphorylation of a residue in the ATR-activating domain by AKT, which then binds to the metazoan-specific C-terminal BRCT7,8 module of another TOPBP1 molecule. Significantly these authors show that this apparent oligomerisation switches TOPBP1 into a poorly described function in repression of the E2F1 transcription factor, and away from its role in the DNA damage checkpoint by inhibiting its recruitment to chromatin and ATR binding (Liu et al., 2013, Mol. Cell. Biol., 33:4685-4700). So, the only suggestion of native TOPBP1 oligomerisation that we are aware of in the literature, is explicitly not involved in the DNA damage checkpoint that its interaction with 9-1-1 and 53BP1 mediates. Nonetheless, the elegant complementation experiment the reviewer suggests could certainly eliminate a TOPBP1 self-association model, even if it is unlikely, and would add support to our already very reasonable explanation of the TOPBP1-dependent PLA data. However, while this experiment is straightforward for the reviewer to suggest, it could take us several months to develop and implement. We currently have none of the constructs that would be required, and we would need to develop from scratch a stable ‘knockdown add-back’ U2OS or RPE1 cell line for TOPBP1 (complicated by the fact that TOPBP1 unlike 53BP1 is an essential gene), and simultaneously express similar levels of two different TOPBP1 mutants. Furthermore, TOPBP1 BRCT1 and BRCT2 are implicated in interactions with other proteins such as treslin/Sld3 (responsible for assembling the replicative CMG helicase), so disruption of these sites in vivo could have unpredictable consequences on the G1 DNA damage response that are independent of their interactions with 9-1-1 and 53BP1. While this experiment would certainly add to the manuscript, we would submit that it is not essential for the measured conclusion we make, that 9-1-1 and 53BP1 are brought into very close proximity at sites of DNA damage, and that this is most likely through interaction with the same TOPBP1. - The crystal structures are relatively low resolution and not yet ideally refined. At this resolution (local) NCS restraints would do much to improve the quality of the final structures. The structures need to correct some local errors (e.g. an Arg side chain points out of the available density) These are certainly not the best diffracting crystals in the world – especially those for the BRCT4,5 complex, but they are what we get and we were not able to improve the resolution beyond this. Nonetheless, the key interfaces between the BRCT domains and the bound phosphopeptides are well resolved and unambiguous, and the conclusions we draw from these structures are justified by the data. We did not apply NCS in the original refinement of BRCT45 as not all the copies in the asymmetric unit have bound peptide, and are therefore not strictly equivalent. However, the reviewer’s suggestion is a reasonable one and we have re-refined the structure as suggested using NCS restraints between the related pairs within the four copies in the asymmetric unit, giving a small improvement in Rfree, and have rectified sub-optimal rotamers. Reviewer #3: This manuscript has multiple conceptual and technical weaknesses: The interaction between 53BP1 and TopBP1 and its role in the G1 checkpoint has already been reported (Cescutti et al., 2010). Although this study provides some new details, the overall model is not significantly advanced. It’s inaccurate to say that the whole story of the function of 53BP1 and TOPBP1 was already told in the work from the Hazalonetis laboratory (Cescutti et al., 2010). In that paper they showed that 53BP1 and TOPBP1 somehow collaborate and interact in G1 cells, and if very large chunks of TOPBP1 are deleted, the G1 checkpoint is damaged – it was that observation that originally piqued our interest in the interaction, and as you can imagine we have read it many times in great detail. What they showed was that the two proteins co-localised at DNA damage, probably interacted (although they did not show how), and that this co-localization/interaction was important. However, the downstream ‘work-up’ of that initial observation – now more than 10 years old – was limited. They did not succeed in localising the interaction at all on 53BP1 and only mapped it on TOPBP1 to the extent of seeing a checkpoint defect if BRCT45 was deleted. Whether the interaction was phosphorylation-dependent was not addressed, nor which arm of the main DNA damage signalling pathways (ATM-CHK2 or ATR-CHK1) that drive checkpoint activation was affected when the interaction was impaired in their gross deletions of TOPBP1. This is a key mechanistic detail without which the observation of a functional collaboration remains phenomenological and cannot be rationalised within the general understanding of the DNA damage response. Starting from the baseline observations of Cescutti et al., in this manuscript we have: a) precisely identified two key residues on 53BP1 (a 213kDa protein with more than 200 documented phosphorylation sites) that are required for the interaction with TOPBP1, and shown that this requires their DNA damage-dependent phosphorylation – not in Cescutti et al; b) shown that both the BRCT012 and BRCT45 modules of TOPBP1 are required for the interaction by surgical point mutations – Cescutti et al. only identified BRCT45 and then only by gross domain deletion, where any observed loss of function could have been due to major effects on overall protein stability; c) shown that the TOPBP1-53BP1 interaction is required to drive the ATR-CHK1 arm of the DDR but has no effect on ATM – not addressed in Cescutti et al; d) shown for the first time that two phosphorylation-dependent ligand proteins of TOPBP1 with compatible BRCT-domain selectivity can brought into very close proximity by their mutual interaction with TOPBP1 at sites of DNA damage. These are substantial and significant advances for the particular interaction of TOPBP1 and 53BP1, while d) opens up a whole new concept of the combinatorial complexity of TOPBP1-scaffolded multi-protein complexes that hasn’t so far been addressed anywhere else to our knowledge. Furthermore, TopBP1 also interacts with MDC1 in a phosphorylation-mediated manner, which was also shown to regulate ATR activation (Wang et al., 2011 JCB). The structural details of the TopBP1-MDC1 interaction has been analyzed and reported (Leung et al., 2013). Given that the localization of 53BP1 to DNA damage sites is dependent on MDC1, the function of 53BP1 in ATR regulation must be regulated by MDC1. Overall, the results of this study only add new details to an existing model but do not advance the model significantly. The reviewer suggests that our data and the original baseline observation of Cescutti et al., are irrelevant, as there is an alternative model (Wang et al., 2011 and Leung et al., 2013), whereby TOPBP1 recruitment and ATR activation (and by implication the G1 checkpoint) is actually dependent on MDC1. The reviewer suggests that this is a major conceptual weakness in our work. In an earlier paper, from which this present manuscript partly stems, (Day et al., 2018), we showed clearly that at least in the fission yeast system, the model for MDC1 (Mdb1 in yeast) interaction with TOPBP1 (Rad4 in yeast) claimed in the Wang et al. and Leung et al. papers was not correct, and that the SDT motif suggested as recruiting TOPBP1/Rad4 to MDC1/Mdb1 actually interacts with the FHA domain of Nbs1. We have subsequently gone on to show that this model of MDC1-TOPBP1 biochemical and functional interaction is also incorrect in the mammalian system. We have shown (Leimbacher et al., 2019) that none of the SDT motifs of MDC1 (claimed in Wang et al., 2011 and in Leung et al., 2013) interact with TOPBP1, and that BRCT45 plays no role in MDC1-TOPBP1 interaction. Instead, using the same methodology as in our earlier eLife and Molecular Cell papers and in this present manuscript, we identify novel phosphorylation sites on MDC1 that are critical for interaction with TOPBP1 in vitro and in vivo. These sites actually interact with BRCT1 and BRCT2 of TOPBP1, rather than BRCT5 and are likely to be mutually exclusive with 53BP1 and RAD9 in binding to TOPBP1. We further show that direct interaction of MDC1 and TOPBP1 is not required for the G1/S or G2 DNA damage checkpoints, but is instead critical for the response to DNA damage occurring in mitosis. The structural work cited by this reviewer on which part of the previous model for MDC1 interaction with TOPBP1 is based, is unreliable, as it is very likely that the MDC1-SDT interaction with TOPBP1-BRCT45 reported in Leung et al. is a crystallisation artefact. Indeed, to their credit, the authors of that work more or less concede this in a later paper (Sun et al., 2017) where they observe authentic binding of a BLM-derived phosphopeptide to BRCT45, which makes interactions almost identical to those we report here for the 53BP1-pS366 peptide. Thus, the notion of an alternative MDC1-dependent ATR activation that the reviewer presents as making our work conceptually weak, is actually incorrect. This manuscript also suffers from several significant technical problems. For example, many experiments in this study used Cyclin A- as a marker for G1 cells. Cyclin A is largely a soluble nuclear protein. However, this study apparently used detergent-extracted cells for Cyclin A staining (Figure 4A). I am not sure if they have identified G1 cells correctly. Cyclin A is widely used as a cell cycle stage marker due to its progressive up regulation once S-phase is established, maximal levels in G2, and rapid degradation at the onset of mitosis. Consequently, nuclei with diffuse chromatin staining and low levels of cyclin A immunoreactivity, can be reasonably assigned to the G1 phase of the cell cycle. This is an absolutely standard methodology we, colleagues in our institute, and many other labs in the genome stability and DNA repair field worldwide, use routinely. The reviewer is concerned that our identification of G1 cells by this method is not reliable because our study ‘apparently used detergent-extracted cells for cyclin A staining (Figure 4A.)’. We did not use detergent-extracted cells: all the protocols used for nuclear protein immunofluorescence visualisation in this study are standard in the field and detailed in the Materials and methods. As is standard in the field, cells were first fixed with -20ºC methanol, which precipitates the proteins in situ, and then gently permeabilised for immunofluorescence. Methanol fixation is used for the explicit purpose of preventing any leaching of proteins that might occur due to permeabilization, and works extremely well, as the hundreds if not thousands of papers that use this technique for immunofluorescence microscopy would attest. In Figure 4A we only showed cells without evident cyclin A staining as these are the G1 cells we are interested in analysing. However, as we are using asynchronous cultures, we of course have cells at different cell cycle stages on our slides, and accordingly see different levels of cyclin A immunofluorescence when our cells are fixed and prepared by this standard method. An example is included as Author response image 2.
Author response image 2.
There is abundant cyclin A signal in some cells which are present on the same slide as some cells which have undetectably low cyclin A signal. As all the cells on the slide experienced precisely the same fixation and permeabilisation protocol, which does not involve detergent extraction, it is clear that our preparation does not wash-out the cyclin A from the nucleus; if it did, none of the cells would show cyclin A. The G1 checkpoint assay used in this study was not properly done. I don't see any BrdU+ EdU- cells in the si53BP1+IR sample in Figure 4C. I am not sure how the authors can conclude that 53BP1 knockdown abolished the G1 checkpoint. In Figure 4D, only BrdU labeling but not EdU/BrdU sequential labeling was done. This is not the proper G1 checkpoint assay. How can the authors be sure that these are G1 cells moving into S phase? The G1 checkpoint assay works with asynchronous cell cultures, and uses a clever double pulse labelling protocol to identify cells that are already in S phase and those that are in G1 with the potential to enter S-phase. Firstly, cells are pulsed with EdU, which becomes incorporated into the DNA in any cells that are actively replicating – i.e. in S-phase – and can be recognised by an antibody. The cells are then subjected to DNA damage – in our case γ-irradiation – and treated with a second labelled nucleotide BrdU (which has its own distinctive antibody) and a mitotic blocker – we use nocodazole – that stops cells that are have already entered mitosis from dividing and going round again. This widely used protocol is fully documented in the Materials and methods. Irradiated cells that are already in S-phase (and therefore EdU labelled) continue to synthesise DNA and also incorporate BrdU. Cells that were in G1 and therefore didn’t incorporate EdU prior to damage, stall at the G1 checkpoint so long as this is intact, and not enter S-phase and not therefore incorporate BrdU either. In normal circumstances therefore, you expect to see relatively few EdU-/BrdU+ cells – this is what we show in Figure 4C with U2OS cells and in Figure 4—figure supplement 1for RPE1 cells. If however, the cells are impaired in factors that contribute to the G1 checkpoint, such as the siRNA knockdown of 53BP1, EdU- G1 cells are not prevented from entering S-phase and start to incorporate BrdU. Thus, the presence of EdU-/BrdU+ cells following DNA damage, indicates a defect in the G1 checkpoint – and this is exactly how we have used that here. To make the BrdU+/EdU- cells clear,we show individual channels as well as an EdU/BrdU merge in Author response image 3 with some EdU-/BrdU+ cells indicated by red arrows. In the revised manuscript we have amended this figure to explicitly show the EdU channel in top and bottom panels, included arrows to indicate the EdU-/BrdU+ cells of interest, and have included the separated channels figure shown in Author response image 3, in the supplementary figures.
Author response image 3.
The reviewer also raises a concern about Figure 4D relating to our use of this assay to determine the effect of mutations in the 53BP1 phosphorylation sites on G1 checkpoint function. The same protocol was used for all of these G1 checkpoint assays and in all cases involves sequential labelling with EdU and BrdU – this is presented in detail in the Materials and methods. The reason that no EdU signal is shown, is because the absence of EdU signal is what we use to select those cells that are not in S-phase and are therefore of interest if they show a BrdU signal. This is the essence of the assay. The EdU channel was of course recorded for all of the mutants analysed as this is the only way to identify those cells that are EdU-, but we didn’t show it, because in these zoomed-in images of EdU-/BrdU+ G1 cells there was, by definition, nothing on it. However, in Figure 4—figure supplement 2B we show the individual channels underlying, including the EdU channel. There is an EdU+/BrdU+ (and therefore S phase cell) visible on the siRNA+WT add-back panel, but there is no EdU signal in the other panels which are focussed on EdU- cells. In the revised manuscript this figure shows the EdU signal. Additionally, in Figure 4—figure supplement 1, we repeat the entire exercise in RPE1 cells using the same double labelling G1 checkpoint assay. In Figure 4—figure supplement 1B – the equivalent of Figure 4C in the main figures – distinct EdU+ and EdU- cells can be seen in the top panels, and distinct EdU-/BrdU+ cells (indicated with red arrows) in the bottom panels. In Figure 4—figure supplement 1D – the equivalent of Figure 4D in the main figures – we show the EdU channel as well as the BrdU channel, and some small signal for this is visible in a couple of the frames. Of course, if you focus in on the cells of interest, those that are EdU-/BrdU+, by definition there is no EdU signal visible – but we still did the EdU pulse. As with the U2OS data in all cases we used the standard sequential double labelling protocol set out in detail in the Materials and methods. In Figure 3C, why did anti-pT670 antibody detect nuclear foci that did not colocalize with eYFP-53BP1? Many antibodies, both commercial and lab-commissioned as here, show some off-target affinity – this is not unusual. The off-target interaction does not colocalise with 53BP1 and therefore has no bearing on the on-target phospho-specific interaction with pT670 which we fully validate. This antibody is not used for any of the co-localisation studies where an off-target interaction could be a problem, but only to verify that Thr670 is phosphorylated following DNA damage in vivo. In Figure 5A, pATR formation is not defective in cells expressing the TopBP1 T670A mutant. pATR just did not colocalize with eYFP-53BP1. Where is pATR in these cells? Would this result argue against the requirement of TopBP1 phosphorylation at T640 for ATR activation? This is not correct: the T670A mutation was introduced into 53BP1 as is clearly stated in the manuscript. We do not understand the reviewer’s reference to phosphorylation of TOPBP1 at Thr640 as being required for ATR activation. We are not aware of any such phosphorylation being suggested to be important for ATR activation. In human TOPBP1 residue 640 maps to the N-terminus of BRCT domain 5 and is well away from the genetically mapped ATR-activating domain which occurs between BRCT6 and BRCT7,8 and is in any event a methionine rather than a threonine. We do not know the location of pATR molecules that do not co-localize with 53BP1, but it is reasonable to suppose that some of them remain co-located with TOPBP1, which no longer colocalises with 53BP1 when 53BP1 is mutated on T670 and/or S366. They may also be interacting with ETAA1 – a recently described alternative ATR activating molecule that functions independently of the RAD-RFC – 9-1-1 – TOPBP1 system. In budding yeast there is also evidence for direct ATR activation by RAD-RFC – 9-1-1 independent of TOPBP1, but no clear data supporting such an alternative has emerged for the metazoan system. In Figure 5C, it is surprising that some many Chk1 foci were detected. Chk1 is mobile protein after DNA damage. It isn’t clear whether the reviewer is questioning whether ‘some’ CHK1 foci were detected, or whether ‘so many’. The reviewer’s statement about CHK1 mobility likely stems from a paper from the Bartek laboratory where they looked at fluorescently-tagged CHK1 and CHK2 recruitment to UV laser stripe damage in live cells, but only over minutes after the DNA damage – laser stripe studies cannot address longer time scales as the live cells move around too much. Furthermore, the levels of slowly-repairing complex double-strand breaks generated by laser damage are rather low. In longer time scale observations (we use 4 hours) following ionising radiation, which generates high-levels of slowly-repaired chemically complex DSBs, persistent CHK1 and ATR foci are routinely observed in both U2OS and RPE1 cells. We are certainly not the only people to see this and cited three references to previous observations of CHK1 foci in the manuscript – so it is not surprising if you look at the more recent literature. In Figure 6F, there are no controls to check the effects of siTopBP1 on 53BP1 and RAD9 foci. Both 53BP1 and RAD9 are known to localize to DNA damage sites through TopBP1-independent mechanisms. How does TopBP1 affects the 53BP1-RAD9 colocalization? We have of course performed controls but we did not show these in the original submission. TOPBP1 knockdown has a negligible effect on 53BP1 foci numbers observed after irradiation in G1 cells. While TOPBP1 knockdown does decrease the total number of RAD9 foci, plenty of RAD9 foci remain, however consistent with the PLA results these show a decreased degree of coincidence with 53BP1. These controls have been added as a supplementary figure. We are surprised by the question in the last part of this comment as the effect of TOPBP1 on colocalization of 53BP1-RAD9 was clearly shown in the Proximity Ligation Assay data presented in Figure 6F in the manuscript. Here siRNA knockdown of TOPBP1 can be seen to cause a very significant decrease in the frequency with which 53BP1 and RAD9 molecules colocalise with each other. TOPBP1 therefore appears to promote the co-localisation of these molecules, and the 40nm cut-off of the PLA system suggests that this is most likely due to simultaneous interaction with the same TOPBP1 molecule. The model in Figure 7 is not supported by data. Each process and interaction shown schematically in Figure 7 and expanded upon in the accompanying figure legend, is very well supported in the published literature, or as in the case of the phosphorylation-dependent interaction of TOPBP1 and 53BP1, is demonstrated in this manuscript. The only exception to this is the identity of the kinase (or kinases) that is (are) responsible for the phosphorylation of Ser366 and Thr670 on 53BP1 following DNA damage, which we have not yet definitively determined. As is entirely reasonable for the Discussion section of a paper, the figure does involve one small speculation for which no data is yet available, in that we show the two complementary interactors with TOPBP1, the 9-1-1 clamp, and 53BP1 associated with the opposite sides of a DSB, rather than the same side. However, in our defence we do clearly state in the figure legend that we don’t yet know which is the case. What is the evidence that 53BP1 recruits TopBP1? If 53BP1 recruits TopBP1 in G1 cells, why are 53BP1 and RAD9 colocalized? Our model does not claim that 53BP1 recruits TOPBP1 as such, but rather as we show it in Figure 7TOPBP1 is simultaneously ‘recruited’ by 53BP1 and RAD9, both of which it interacts with, scaffolding their colocalisation. What is the evidence that 53BP1 functions independently of RAD9 to regulate ATR? I don't understand the logic of the model proposed. Neither 53BP1 nor RAD9 directly regulate ATR, rather ATR activation depends on interaction with TOPBP1, which in the best understood S/G2 model is tethered in the vicinity of DNA damage (in the form of RPA-coated ssDNA generated by MRN) by the phosphorylated tail of RAD9 loaded along with RAD1 and HUS1 at a 5’-recessed dsDNA-ssDNA junction. In the G1 model we explore here we show that TOPBP1 also interacts with 53BP1, which could in principle provide an alternative tether. However, as we go on to show, this interaction – which is critical in G1 – likely occurs alongside interaction with RAD9. Although it was previously thought that no resection would occur in G1 DSBs, which are overwhelmingly repaired by NHEJ, recent work from Lobrich, Jeggo and others clearly shows that all DSBs undergo some degree of resection to generate short segments of RPA-coated ssDNA. Our model therefore provides a framework for understanding how TOPBP1 helps integrate the presence of 53BP1 – which is strongly recruited downstream of DSB recognition by MRN and ATM signalling – with the presence of 9-1-1 recruited to the dsDNA-ssDNA junction generated by resection – to activate the ATR-CHK1 arm of the DNA damage response.
Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain backgroundE. coli BL21(DE3)New England BiolabsCat#C2527
Cell line (Homo sapiens)Hela cellsATCCRCB0007
Cell line (Homo sapiens)U2OS cellsSTRV
Cell line (Homo sapiens)U2OS cells stably expressing eYFP-53BP1 WT, S366A and T670AThis study
Cell line (Homo sapiens)RPE-1 htert WTSTRV
Transfected constructpeYFP-53BP1 WT, peYFP-53BP1 S366A, peYFP-53BP1 T670A, peYFP-53BP1 S366A T670AThis study
AntibodyMouse monoclonal anti-GFP [LGB-1]AbcamCat#ab291, RRID:AB_449092(1:100) dilution IF
AntibodyRabbit monoclonal anti-pATM (S1981)AbcamCat#2152–1 RRID:AB_991678 lot GR217573-12(1:100) dilution IF
AntibodyDonkey polyclonal anti-goat Alexa Fluor 647AbcamCat#ab150135 RRID:AB_2687955(1:400) dilution IF
AntibodyGoat polyclonal anti-53BP1Bethyl Laboratories, IncCat#A303-906A RRID:AB_2620256(1:100) dilution IF
AntibodyRabbit polyclonal anti-53BP1Bethyl Laboratories, IncCat#A300-272A RRID:AB_185520(1:100) dilution IF
AntibodyRabbit polyclonal anti-Rad9Bethyl Laboratories, IncCat#A300-890A RRID:AB_2269209(1:100) dilution IF
AntibodyRabbit polyclonal anti-TopBP1Bethyl Laboratories, IncCat#A300-111A RRID:AB_2272050(1:50) dilution IF, (1:500) dilution WB
AntibodyRabbit polyclonal anti-β-actin (13E5)Cell Signaling TechnologyCat#4970 also 4970P,4970L,4970S RRID:AB_2223172 lot 14(1:1000) dilution WB
AntibodyMouse monoclonal anti-p53 (DO-7)Cell Signaling TechnologyCat# 48818 RRID:AB_2713958 lot 1(1:100) dilution IF
AntibodyRabbit polyclonal anti-p-p53 (S15)Cell Signaling TechnologyCat#9284also9284S,9284L,9284P RRID:AB_331464 lot 19(1:100) dilution IF
AntibodyRabbit monoclonal anti-p21 Waf1/Cip1 (12D1)Cell Signaling TechnologyCat#2947also2947S,2947P RRID:AB_823586 lot 9(1:100) dilution IF
AntibodyGoat polyclonal anti-mouse IgG Fab2 Alexa Fluor 647 Molecular ProbesCell Signaling TechnologyCat#4410S RRID:AB_10694714 lot 11(1:400) dilution IF
AntibodyGoat anti-rabbit IgG, HRP linked AntibodyCell Signaling TechnologyCat#7074also7074S, 7074V,7074P2 RRID:AB_2099233 lot 26(1:2000) dilution WB
AntibodyGoat anti-mouse IgG, HRP linked AntibodyCell Signaling TechnologyCat#7076also7076S,7076V,7076P2 RRID:AB_330924 lot 32(1:2000) dilution WB
AntibodyMouse monoclonal anti-53BP1EMD Millipore CorpCat#MAB3802 RRID:AB_2206767 lot 2794909(1:500) dilution IF, (1:500) dilution WB
AntibodyRabbit polyclonal anti-pATR (pT1989)GeneTexCat#GTX128145 RRID:AB_2687562(1:100) dilution IF, (1:500) dilution WB
AntibodyRabbit polyclonal anti-pS366 53BP1ImmunoKontactAntigen:[CSSDLVAP(pS)PDAFRSTP](1:500) dilution IF, (1:500) dilution WB
AntibodyRabbit polyclonal anti-pT670 53BP1ImmunoKontactAntigen:[CVEEIPE(pT)PCESQGEE](1:500) dilution IF, (1:500) dilution WB
AntibodyMouse monoclonal anti-BrdU Monoclonal Antibody (MoBU-1), Alexa Fluor 488Invitrogen by ThermoFisher ScientificCat#B35130 RRID:AB_2536434 lot 1712859(1:200) dilution IF
AntibodyDonkey polyclonal anti-rabbit DKXRB TRITCInvitrogen by ThermoFisher ScientificCat#A16040 RRID:AB_2534714 lot 31-33-091912(1:400) dilution IF
AntibodyDonkey polyclonal anti-mouse DKXMU IgG F(AB)’ 2 FITCInvitrogen by ThermoFisher ScientificCat#A24507 RRID:AB_2535976 lot 42-73-052014(1:400) dilution IF
AntibodyGoat polyclonal anti-rabbit IgG (H + L) Cross-Adsorbed Goat Secondary Antibody, Cyanine5Invitrogen by ThermoFisher ScientificCat#A10523 RRID:AB_10374302 lot1675037(1:400) dilution IF
AntibodyMouse monoclonal anti-Cyclin A (B-8)Santa Cruz BiotechnologyCat#sc-271682 RRID:AB_10709300 lot L1316(1:100) dilution IF
AntibodyGoat polyclonal anti-ATR (N-19)Santa Cruz BiotechnologyCat#sc-1887 RRID:AB_630893 lot G1408(1:500) dilution WB
AntibodyRabbit polyclonal anti-HA-probe (Y-11)Santa Cruz BiotechnologyCat#sc-805 RRID:AB_631618 lot C0415(1:100) dilution IF, (1:2000) dilution WB
AntibodyMouse monoclonal anti-HA-probe (F-7)Santa Cruz BiotechnologyCat#sc-7392 RRID:AB_627809 lot C1114(1:100) dilution IF
AntibodyRabbit polyclonal anti-Tubulin (H-235)Santa Cruz BiotechnologyCat#sc-9104 RRID:AB_2241191 lot L1713(1:2000) dilution WB
Recombinant DNA reagentPlasmid: pCMH6K HA-53BP1Noon et al., 2010 a gift from Penny JeggoN/APlasmid encoding full length Human 53BP1 WT, S366A, T670A or S366A T670A mutants. Contains silent mutations for siRNA resistance.
Recombinant DNA reagentPlasmid: peYFP-53BP1This paperN/APlasmid encoding full length Human 53BP1 WT, S366A, T670A or S366A T670A mutants. Contains silent mutations for siRNA resistance.
Recombinant DNA reagentPlasmid: peYFP-C1N/A
Sequence-based reagentsiRNA targeting sequence: SCR siRNA: sense: UUCAAUAAAUUCUUGAGGU(dTdT) antisense: (dTdT) CCTCAAGAATTTATTGAAEurofins (Lou et al., 2003)
Sequence-based reagentsiRNA targeting sequence: 53BP1 siRNA*: sense: AGAACGAGGAGACGGUAAUAGUGGG(dTdT) antisense: (dTdT)CCCACTATTACCGTCTCCTCGTTCTEurofins (Noon et al., 2010)
Sequence-based reagentsiRNA targeting sequence: 3’ UTR 53BP1 siRNA**: sense: AAAUGUGUCUUGUGUGUAA(dTdT) antisense: (dTdT)TTACACACAAGACACATTTEurofins (Knobel et al., 2014)
Sequence-based reagentsiRNA targeting sequence: TOPBP1 : sense: GUAAAUAUCUGAAGCUGUA(dTdT) antisense: (dTdT) UACAGCUUCAGAUAUUUACEurofins (Broderick et al., 2015)
Sequence-based reagentsiRNA targeting: ATR siRNA ID: s536ThermoFisher Scientific
Sequence-based reagentPrimer: 53BP1 cloning fragment 1 Forward (5’- > 3’): GTCCGGACTCAGATCTATGGACCCTACTG GAAGTCAGTEurofins (this paper)Primer used for PCR in cloning experiment
Sequence-based reagentPrimer: 53BP1 cloning fragment 1 Reverse (5’- > 3’): CACACTGGCGTCCCTGTCTGACTGACCEurofins (this paper)Primer used for PCR in cloning experiment
Sequence-based reagentPrimer: 53BP1 cloning fragment 2 Forward (5’- > 3’): AGGGACGCCAGTGTGTGAGGAGGATGGTEurofins (this paper)Primer used for PCR in cloning experiment
Sequence-based reagentPrimer: 53BP1 cloning fragment 2 Reverse (5’- > 3’): TAGATCCGGTGGATCCTTAGTGAGAAACATAATCGTGTTTATATTTTGGATGCTEurofins (this paper)Primer used for PCR in cloning experiment
Sequence-based reagentPrimer: 53BP1 S366A mutagenesis Forward (5’- > 3’): TTGTTGCTCCtgcTCCTGATGCTEurofins (this paper)Primer used for PCR in cloning experiment
Sequence-based reagentPrimer: 53BP1 S366A mutagenesis Reverse (5’- > 3’): GATCTGAAGAATTCGTGGAAAGACEurofins (this paper)Primer used for PCR in cloning experiment
Sequence-based reagentPrimer: 53BP1 T670A mutagenesis Forward (5’- > 3’): AATCCCTGAGgcaCCTTGTGAAAGEurofins (this paper)Primer used for PCR in cloning experiment
Sequence-based reagentPrimer: 53BP1 T670A mutagenesis Reverse (5’- > 3’): TCTTCCACCTCAGACCCTGEurofins (this paper)Primer used for PCR in cloning experiment
Peptide, recombinant protein53BP1 pT334 peptide 'Flu'-GYGGGCSLAS(pT)PATTLHLPeptide Protein Research Limited (this paper)Fluorescein labelled for FP measurements
Peptide, recombinant protein53BP1 pS366 peptide 'Flu'-GYGSSDLVAP(pS)PDAFRSTPeptide Protein Research Limited (this paper)Fluorescein labelled for FP measurements
Peptide, recombinant protein53BP1 pS380 peptide 'Flu'-GYGTPFIVPS(pS)PTEQEGRPeptide Protein Research Limited (this paper)Fluorescein labelled for FP measurements
Peptide, recombinant protein53BP1 pT670 peptide 'Flu'-GYGEVEEIPE(pT) PCESQGEPeptide Protein Research Limited (this paper)Fluorescein labelled for FP measurements
Peptide, recombinant protein53BP1 pS366 peptide SSDLVAP(pS)PDAFRSTPeptide Protein Research Limited (this paper)
Peptide, recombinant protein53BP1 pT670 peptide EVEEIPE(pT)PCESQGEPeptide Protein Research Limited (this paper)
Commercial assay or kitIn-Fusion HD Cloning KitClonetechCat#639646
Commercial assay or kitAPEX Alexa Fluor 555 Antibody Labeling Kit (used for pS366 and pT670 53BP1 antibodies)Invitrogen by ThermoFisher ScientificCat#A10470 lot 1831224
Commercial assay or kitClick-iT EdU Alexa Fluor 647 Imaging KitInvitrogen by ThermoFisher ScientificCat#C10340
Commercial assay or kitQ5 Site-Directed Mutagenesis KitNew England BiolabsCat#E0554S
Commercial assay or kitPremo FUCCI Cell Cycle Sensor (BacMam 2.0)ThermoFisher ScientificCat#P36238
Commercial assay or kitPierce ECL Western Blotting SubstrateThermoFisher ScientificCat#32209 lot RE232713
Commercial assay or kitCell Line Nucleofector Kit VLonzaCat#VCA-1003
Chemical compound, drugNanoJuice Transfection KitEMD Millipore CorpCat#71902
Chemical compound, drugFisher BioReagents Bovine Serum Albumin (BSA) Fatty Acid-free PowderFisher Scientific by ThermoFisher ScientificCat# BP9704-100 CAS: 9048-46-8
Chemical compound, drugProLong Diamond Antifade Mountant ThermoFisher ScientificInvitrogen by ThermoFisher ScientificCat# P36965
Chemical compound, drugNuPAGE 3–8% Tris-Acetate Protein GelsInvitrogen by ThermoFisher ScientificCat#EA0378BOX
Chemical compound, drugNuPAGE AntioxidantInvitrogen by ThermoFisher ScientificCat#NP0005
Chemical compound, drugNuPAGE Sample Reducing Agent (10X)Invitrogen by ThermoFisher ScientificCat#NP0004
Chemical compound, drugNuPAGE LDS Sample Buffer (4X)Invitrogen by ThermoFisher ScientificCat#NP0007
Chemical compound, drugBenzonase NucleaseSanta Cruz BiotechnologyCat#sc-202391
Chemical compound, drugPhosphatase Inhibitor Cocktail CSanta Cruz BiotechnologyCat#sc-45065
Chemical compound, drugG418 Disulfat SaltSigma-AldrichA1720 ; CAS: 108321-42-2
Chemical compound, drugNocodazoleSigma-AldrichSML1665; CAS: 31430-18-9
Chemical compound, drug5-Bromo-2’-deoxyuridine (BrDU)Sigma-AldrichB5002; CAS: 59-14-3
Chemical compound, drugbisBenzimide H33352 trihydrochloride (Hoechst 33342)Sigma-AldrichB2261 ; CAS: 23491-52-3
Chemical compound, drugMonoclonal Anti-HA−Agarose antibody produced in mouseSigma-AldrichA2095
Chemical compound, drugcOmplete, EDTA-free Protease Inhibitor CocktailSigma-Aldrich000000005056489001; COEDTAF-RO ROCHE
Chemical compound, drugDuolink In Situ Orange Starter Kit Goat/RabbitSigma-AldrichDUO92106
Chemical compound, drugLipofectamine RNAiMAX Transfection ReagentThermoFisher ScientificCat# #13778015
Chemical compound, drugPhusion Flash High Fidelity Master MixThermoFisher ScientificCat#F-548
Chemical compound, drugPierce ECL Western Blotting SubstrateThermoFisher ScientificCat#32209 lot RE232713
Software, algorithmPrism six for Mac OS X (v6.0h)GraphPad Softwarehttps://www.graphpad.com RRID:SCR_002798
Software, algorithmCell Profiler (2.2.0)Broad Institutehttp://cellprofiler.org/ RRID:SCR_007358
Software, algorithmFIJIImageJ softwarehttp://fiji.sc/ RRID:SCR_002285
Software, algorithmMicro-Manager (µManager)Vale Lab, UCSFhttps://micro-manager.org/ RRID:SCR_000415
Software, algorithmSlideBook6Intelligent Imaging Innovations (3i)https://www.intelligent-imaging.com/slidebookRRID:SCR_014300
Software, algorithmSnapGeneGSL Biotech LLChttp://www.snapgene.com/ RRID:SCR_015052
Software, algorithmNEBaseChanger v1.2.6New England Biolabshttp://nebasechanger.neb.com/
Software, algorithmCCP4Combined Crystallographic Computing Projecthttp://www.ccp4.ac.uk/ RRID:SCR_007255
Software, algorithmPhenixPhenix Consortiumhttps://www.phenix-online.org/ RRID:SCR_014224
Software, algorithmBusterGlobal Phasinghttps://www.globalphasing.com/buster/ RRID:SCR_015653
OtherMicroscope: Olympus-3i spinning discOlympusN/A
OtherMicroscope: Olympus IX70 Core DeltaVisionOlympusN/A
OtherBioruptor Pico sonication deviceDiagenodeCat# B01060001
OtherImageQuant LAS 4000GE Healthcare Life SciencesCat#28955810
  55 in total

1.  Treslin collaborates with TopBP1 in triggering the initiation of DNA replication.

Authors:  Akiko Kumagai; Anna Shevchenko; Andrej Shevchenko; William G Dunphy
Journal:  Cell       Date:  2010-01-28       Impact factor: 41.582

2.  Structural and functional analysis of the Crb2-BRCT2 domain reveals distinct roles in checkpoint signaling and DNA damage repair.

Authors:  Mairi L Kilkenny; Andrew S Doré; S Mark Roe; Konstantinos Nestoras; Jenny C Y Ho; Felicity Z Watts; Laurence H Pearl
Journal:  Genes Dev       Date:  2008-08-01       Impact factor: 11.361

3.  The DNA damage effector Chk1 kinase regulates Cdc14B nucleolar shuttling during cell cycle progression.

Authors:  Sirisha Peddibhotla; Zhubo Wei; Rao Papineni; Micheal H Lam; Jeffrey M Rosen; Pumin Zhang
Journal:  Cell Cycle       Date:  2011-02-15       Impact factor: 4.534

4.  Regulation of DNA replication through Sld3-Dpb11 interaction is conserved from yeast to humans.

Authors:  Dominik Boos; Luis Sanchez-Pulido; Mathieu Rappas; Laurence H Pearl; Antony W Oliver; Chris P Ponting; John F X Diffley
Journal:  Curr Biol       Date:  2011-06-23       Impact factor: 10.834

5.  The human homologs of checkpoint kinases Chk1 and Cds1 (Chk2) phosphorylate p53 at multiple DNA damage-inducible sites.

Authors:  S Y Shieh; J Ahn; K Tamai; Y Taya; C Prives
Journal:  Genes Dev       Date:  2000-02-01       Impact factor: 11.361

Review 6.  Function of TopBP1 in genome stability.

Authors:  Miiko Sokka; Sinikka Parkkinen; Helmut Pospiech; Juhani E Syväoja
Journal:  Subcell Biochem       Date:  2010

7.  Globally optimal stitching of tiled 3D microscopic image acquisitions.

Authors:  Stephan Preibisch; Stephan Saalfeld; Pavel Tomancak
Journal:  Bioinformatics       Date:  2009-04-03       Impact factor: 6.937

8.  Recruitment of ATR to sites of ionising radiation-induced DNA damage requires ATM and components of the MRN protein complex.

Authors:  K E Adams; A L Medhurst; D A Dart; N D Lakin
Journal:  Oncogene       Date:  2006-02-13       Impact factor: 9.867

Review 9.  TopBP1: A BRCT-scaffold protein functioning in multiple cellular pathways.

Authors:  Christopher P Wardlaw; Antony M Carr; Antony W Oliver
Journal:  DNA Repair (Amst)       Date:  2014-07-30

10.  53BP1 Integrates DNA Repair and p53-Dependent Cell Fate Decisions via Distinct Mechanisms.

Authors:  Raquel Cuella-Martin; Catarina Oliveira; Helen E Lockstone; Suzanne Snellenberg; Natalia Grolmusova; J Ross Chapman
Journal:  Mol Cell       Date:  2016-08-18       Impact factor: 17.970

View more
  16 in total

1.  Biochemical analysis of TOPBP1 oligomerization.

Authors:  Ahhyun Kim; Katrina Montales; Kenna Ruis; Holly Senebandith; Hovik Gasparyan; Quinn Cowan; W Matthew Michael
Journal:  DNA Repair (Amst)       Date:  2020-09-21

2.  A Non-canonical BRCT-Phosphopeptide Recognition Mechanism Underlies RhoA Activation in Cytokinesis.

Authors:  J Sebastián Gómez-Cavazos; Kian-Yong Lee; Pablo Lara-González; Yanchi Li; Arshad Desai; Andrew K Shiau; Karen Oegema
Journal:  Curr Biol       Date:  2020-07-02       Impact factor: 10.834

3.  Deubiquitinase OTUD6A promotes breast cancer progression by increasing TopBP1 stability and rendering tumor cells resistant to DNA-damaging therapy.

Authors:  Yan Zhao; Xinping Huang; Dan Zhu; Min Wei; Jiechen Luo; Shuyu Yu; Yonglu Tian; Xiaofeng Zheng
Journal:  Cell Death Differ       Date:  2022-06-29       Impact factor: 15.828

4.  The CIP2A-TOPBP1 complex safeguards chromosomal stability during mitosis.

Authors:  Mara De Marco Zompit; Mònica Torres Esteban; Clémence Mooser; Salomé Adam; Silvia Emma Rossi; Alain Jeanrenaud; Pia-Amata Leimbacher; Daniel Fink; Ann-Marie K Shorrocks; Andrew N Blackford; Daniel Durocher; Manuel Stucki
Journal:  Nat Commun       Date:  2022-07-16       Impact factor: 17.694

5.  USP13 regulates the replication stress response by deubiquitinating TopBP1.

Authors:  Wootae Kim; Fei Zhao; Huanyao Gao; Sisi Qin; Jing Hou; Min Deng; Jake A Kloeber; Jinzhou Huang; Qin Zhou; Guijie Guo; Ming Gao; Xiangyu Zeng; Shouhai Zhu; Xinyi Tu; Zheming Wu; Yong Zhang; Ping Yin; Scott H Kaufmann; Kuntian Luo; Zhenkun Lou
Journal:  DNA Repair (Amst)       Date:  2021-02-06

6.  Structural basis for recruitment of the CHK1 DNA damage kinase by the CLASPIN scaffold protein.

Authors:  Matthew Day; Sarah Parry-Morris; Jack Houghton-Gisby; Antony W Oliver; Laurence H Pearl
Journal:  Structure       Date:  2021-03-30       Impact factor: 5.006

7.  Structure-function analysis of TOPBP1's role in ATR signaling using the DSB-mediated ATR activation in Xenopus egg extracts (DMAX) system.

Authors:  Katrina Montales; Ahhyun Kim; Kenna Ruis; W Matthew Michael
Journal:  Sci Rep       Date:  2021-01-11       Impact factor: 4.379

8.  PHF8-promoted TOPBP1 demethylation drives ATR activation and preserves genome stability.

Authors:  Shuai Ma; Cheng Cao; Shiyou Che; Yuejiao Wang; Dongxue Su; Shuai Liu; Wenchen Gong; Ling Liu; Jixue Sun; Jiao Zhao; Qian Wang; Nan Song; Tong Ge; Qiushi Guo; Shanshan Tian; Charlie Degui Chen; Tao Zhang; Ju Wang; Xiang Ding; Fuquan Yang; Guoguang Ying; Jie Yang; Kai Zhang; Yi Zhu; Zhi Yao; Na Yang; Lei Shi
Journal:  Sci Adv       Date:  2021-05-05       Impact factor: 14.136

9.  CK2 Phosphorylation of Human Papillomavirus 16 E2 on Serine 23 Promotes Interaction with TopBP1 and Is Critical for E2 Interaction with Mitotic Chromatin and the Viral Life Cycle.

Authors:  Apurva T Prabhakar; Claire D James; Dipon Das; Raymonde Otoa; Matthew Day; John Burgner; Christian T Fontan; Xu Wang; Sarah H Glass; Andreas Wieland; Mary M Donaldson; Molly L Bristol; Renfeng Li; Anthony W Oliver; Laurence H Pearl; Brian O Smith; Iain M Morgan
Journal:  mBio       Date:  2021-09-21       Impact factor: 7.867

10.  The E2F1 transcription factor and RB tumor suppressor moonlight as DNA repair factors.

Authors:  Swarnalatha Manickavinayaham; Renier Velez-Cruz; Anup K Biswas; Jie Chen; Ruifeng Guo; David G Johnson
Journal:  Cell Cycle       Date:  2020-08-13       Impact factor: 4.534

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.