Literature DB >> 31118953

Protium javanicum Burm. Methanol Extract Attenuates LPS-Induced Inflammatory Activities in Macrophage-Like RAW264.7 Cells.

Akash Ahujaa1, Mi-Yeon Kim2, Jae Youl Cho1.   

Abstract

Protium javanicum Burm. f. is a medicinal plant used in traditional medicine. Gum and oleoresins from this plant have been used as anti-inflammatory agents for treating ulcers, headaches, eyelid inflammation, and rheumatic pain. However, its anti-inflammatory mechanism of action is still unknown. To better understand the mechanism, we used lipopolysaccharide- (LPS-) treated RAW264.7 cells to measure inflammatory mediators with the Griess assay and to identify target signaling molecules by immunoblot analysis. In this study, we report that the Protium javanicum methanol extract (Pj-ME) plays an important role in suppressing nitric oxide (NO) levels without cytotoxicity. The effect of Pj-ME in LPS-induced expression leads to reduced inflammatory cytokine expression, specifically inducible nitric oxide synthase (iNOS), cyclooxygenase (COX-2), and tumor necrosis factor (TNF-α). Pj-ME significantly inhibited LPS-induced protein expression of the nuclear factor-kappa B (NF-κB) signaling pathway in a time-dependent manner. Syk and Src were identified as putative signaling molecules of Pj-ME-mediated anti-inflammatory activity, which were inhibited by Pj-ME. We demonstrated that Pj-ME controls the STAT3 signaling pathway by suppressing STAT3 and JAK phosphorylation and also downregulates the gene expression of IL-6. Therefore, these results elucidate Pj-ME as a novel anti-inflammatory naturally derived drug with anti-inflammatory and antioxidant properties which may be subject to therapeutic and prognostic relevance.

Entities:  

Year:  2019        PMID: 31118953      PMCID: PMC6500672          DOI: 10.1155/2019/2910278

Source DB:  PubMed          Journal:  Evid Based Complement Alternat Med        ISSN: 1741-427X            Impact factor:   2.629


1. Introduction

Inflammation is a complex defense mechanism that neutralizes and restores cell or tissue to its normal function [1]. However, proinflammatory stimuli and stress conditions lead to pathogenesis and chronic disease [2]. In this regard, macrophages play an important role in mediating inflammation and secreting inflammatory cytokines after activation [3, 4]. Macrophages are activated in several ways, such as by bacteria and hepatitis B virus, and leads to the release of inflammatory cytokines. Moreover, lipopolysaccharide (LPS), an important component of the outer wall of Gram-negative bacteria, is also known to activate macrophages and lead to the release of typical proinflammatory cytokines, such as tumor necrosis factor (TNF-α) and interleukin 6 (IL-6), promoting tissue damage and chronic disease [5]. We used LPS-stimulated macrophages to study the classical inflammation model in vitro. In fact, although inflammation is considered as an important response for the host defense against infections, it also could become cause to many chronic diseases. Sustainable levels of tissue injury, oxidative stress, angiogenesis, and fibrosis as the results of a series of inflammatory responses are also know to lead to other deadly complications in some tissues and organs such as cancer, Alzheimer's disease, diabetes, and atherosclerosis [6, 7]. Therefore, development of new and safer treatment strategies to prevent and treat these inflammatory diseases could be essential. NF-κB is family of transcription factors, which share the Rel homology domain and are sequestered in the cytoplasm by IκB (inhibitor of κB) family members [8]. Proinflammatory cytokines, such as TNF-α, IL-1, and IL-6, and triggers of toll-like receptors (TLRs), such as lipopolysaccharide, are known to activate NF-κB [9]. Signals from external stimuli are translocated through adaptor molecules, which activate the IκB kinase (IKK) complex and phosphorylates cytosolic IκB, followed by ubiquitination and sequential activation NF-κB into the nucleus, and culminating in proinflammatory cytokine activation (for example, iNOS/NO, COX-2, and TNF-α) [10]. Signal transducer and activator of transcription (STAT) is a family of cytoplasmic proteins that regulate an array of genes in response to cytokines and growth factors [11]. In contrast, STAT3 activation generates a number of inflammatory responses and regulates a variety of signaling pathways [12]. The precise mechanism that STAT3 induces the inflammatory response has not been established. However, Src tyrosine kinase or mutations in JAK proteins can lead to hyperphosphorylation of STAT3 [13]. Identification of compounds or natural products that inhibit STAT3 activation have great potential for treating inflammatory diseases [14]. Protium javanicum Burm. f., which belongs to the family Burseraceae from Indonesia, is locally known in Indonesia as “kayu bawang” or “kayu pahit”. The plant has been used for making desks, tables, and exterior walls because of its durability. Traditionally, gum, and oleoresins from P. javanicum had been used in folk medicine as anti-inflammatory agents for treating ulcers and for headaches, eyelid inflammation, and rheumatic pain [15]. Recent studies using phytochemical fractionation of P. javanicum extracts had led to the identification of scopoletin, quercetin, and stigmasterol [16]. Plant formulated natural products are gaining wide consideration in developing inflammatory and chemopreventive remedies because of their little or no side effects. Moreover, there is much considerable motivation to investigate plant-based phytochemicals and their potential to reduce inflammatory symptoms or inhibit tumor progression and metastasis [17-19]. Despite the use of Protium javanicum in traditional medicine, there have been no reports on its anti-inflammatory mechanism of action. Therefore, our objective in this study was to determine the anti-inflammatory mechanism of Protium javanicum Burm. f. methanol extract in RAW264.7 macrophages. In the present study, we have shown that the anti-inflammatory effect of Pj-ME is related to NF-κB and STAT3 in LPS-stimulated macrophages. To better understand the anti-inflammatory mechanism involving LPS-stimulated macrophages, we used RT-PCR to analyze the cytokines downregulated in LPS-stimulated macrophages after treatment with Pj-ME. We also evaluated the anti-inflammatory effect on the NF-κB signaling pathway using a luciferase reporter gene and protein expression to determine the specific molecular target. Treatment with Pj-ME reduced p85, IKKα/β, IκBα, p50, and p65 proteins in the NF-κB inflammatory pathway in a time-dependent manner. However, Syk and Src overexpression in HEK293 cells treated with Pj-ME abrogated Syk and Src phosphorylation and prevented inflammatory activity. Thus, Pj-ME targets Syk and Src to mediate its anti-inflammatory effect. We also report that Pj-ME inhibits STAT3 activation and gene expression of IL-6 in a time-dependent manner. Therefore, our results may provide evidence for the underlying mechanism of Pj-ME in activated macrophages.

2. Materials and Methods

2.1. Materials

RAW264.7 cells from mice (BLAB/c, ATCC number TIB-71) were purchased from ATCC (Rockville, MD, USA). Dimethyl Sulfoxide (DMSO), L-NG–nitroarginine methyl ester (L-NAME), lipopolysaccharide (LPS, Escherichia coli 0111:B4), and (3-4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Sigma Chemical Co. (St Louis, MO, USA). Gene specific PCR primers for iNOS, TNF-α, COX-2, and GAPDH were synthesized from Bioneer Inc. (Daejeon, Republic of Korea). Antibodies to phosphorylated and total protein (p65, p50, IκBα, IKKα/β, Syc, Syk, STAT3, JAK, and β-actin) were obtained from Cell Signaling (Beverly, MA, USA).

2.2. Animals and Preparation of Peritoneal Macrophages

C57BL/6 mice (6–8 weeks old, 17–21 g) from Daehan Biolink (Chungbuk, Korea) were maintained under standard care conditions and used for experiments according to the guidelines established by the Institutional Animal Care and Use Committee at Sungkyunkwan University (Suwon, Korea). All animal experiments were carried out by guidelines of the National Institute of Health for the Care and Use of Laboratory Animals (NIH Publication 80–23, revised in 1996) and with approval of the Institutional Animal Care and Use Committee at Sungkyunkwan University (Suwon, Korea). Peritoneal exudates were prepared by intraperitoneal injection with 4% sterile thioglycollate broth (1.0 ml, Difco Laboratories, Detroit, MI) for 4 d, according to previous method [20]. Exudates were washed three times using RPMI 1640 media containing 10% FBS, and peritoneal macrophages were plated in culture plates for each experiment.

2.3. Preparation of Pj-ME and Phytochemical Profiling

A 95% methanol extract (Code No. FBM090-039) of the aerial parts of Protium javanicum Burm. f. (Pj-ME) was obtained from the Plant Extract Bank of the Plant Diversity Research Center (https://extract.kribb.re.kr/, e-mail: mplantext@kribb.re.kr, Daejeon, Korea). Briefly, the dried aerial parts Protium javanicum were pulverized to powder using a mechanical grinder after dried at 60°C for 24 h and then passed through a 60-mesh sieve. The dried powders (100 g) were then extracted with 95% methanol (1 l x 3) for 48 h in the soxhlet apparatus as reported previously [21]. The extracts were filtered and concentrated to vacuum at 40°C under reduced pressure in rotary evaporator and dried in desiccators. The yield of the extract was approximately 12.9%. The crude extract was stored in 4°C to use in the experiment. Phytochemical profiling of Pj-ME was obtained by high performance liquid chromatography (HPLC) analysis with a system composed of a KNAUER (WellChrom) K-1001 HPLC pump, a K-500 4-channel degasser, and a K-2600 fast scanning spectrophotometer [22]. The elution solvents were buffer A (0.1% trifluoroacetic acid in H2O) and buffer B (0.08% trifluoroacetic acid in 95% acetonitrile + 5% H2O). The gradient processes were as follows: gradient: 0–30% solvent A (0–15 min), 30% solvent A (15–25min), 30–80% solvent A (25–45 min), and 80% solvent A (45–55 min). The peaks were detected at OD370 nm using a Phenomenex Gemini C18 ODS (250×4.6 mm, 5 μm). Resveratrol, quercetin, kaempferol, and luteolin were used as reference compounds. The conditions are described in Table 1. Compound analysis was performed by UPLC/HRMS (Orbitrap) analyses using Shimadzu Ultra Performance LCMS 8050 system (Shimadzu, Kyoto, Japan) with a triple quadrupole mass spectrometer equipped with electrospray ionization (ESI) source operating in negative mode (Lab Solutions software version 5.2 (Shimadzu), as reported previously [23, 24]).
Table 1

High performance liquid chromatography (HPLC) condition conditions to analyze active ingredients.

InstrumentKNAUER crop. HPLC system
ColumnPhenomenex, Gemini 5 μm C18 110A, 250 X 4.60 mm
DetectorUV/VIS detector (370 nm)
Solvent A0.1% TFA in H2O
Solvent B0.008% TFA in 95% MeCN + 5% H2O
StandardDilution with DMSO
Sample treatment50mg/ml dilution with DMSO
Injection volume20 μl
Flow rate1.0 ml/min

2.4. Expression Vector Construction

Vectors were constructed by amplification, using standard protocols with competent E. coli (DH5α). FLAG-MyD88, CFP-TRIF, MyC-Syk, and HA-Src were used as reported. Luciferase constructs that contained NF-κB binding sites were used as previously reported [25, 26]. All constructs were confirmed by DNA sequencing.

2.5. Cell Culture and Drug Treatment

The mouse-derived RAW264.7 and HEK293 cells and peritoneal macrophages were cultured in RPMI 1640 medium and Dulbecco's modified Eagle's medium (DMEM), respectively. Both were supplemented with 10% FBS. The cells were grown at 37°C with 5% CO2. Pj-ME stock solution (100 μg/ml) was prepared using DMSO.

2.6. Nitric Oxide Determination

RAW264.7 cells (1 x 106 cells/ml) were preincubated for 18 h in a CO2 incubator, treated with Pj-ME (0-200 μg/ml) or standard compound L-NAME for 30mins, and then incubated with LPS (1 μg/ml) for 24 h. The effect of Pj-ME on NO levels was determined using Griess reagents as described previously [27].

2.7. Cell Viability

RAW264.7 cells were incubated in the presence of Pj-ME for 24 h. 10 μl of MTT solution (10 mg/ml in PBS, pH 7.4) was added, and the cells were incubated for 3 h as reported [28, 29]. The reaction was stopped by adding 15% sodium dodecyl sulfate. The samples were then incubated for an additional 24h. The absorbance was calculated at 570 nm based on the control.

2.8. RT-PCR Analysis

Total RNA was extracted from RAW264.7 cells incubated with Pj-ME for 30mins and with LPS (1 μg/ml) for 6h using TRIzol reagent (Gibco BRL) according to the manufacturer's instructions. cDNA was prepared using a cDNA synthesis kit (Applied Biosystems #4368814, Foster City, CA, USA) according to the manufacturer's protocol. Semiquantitative RT-PCR gene expression analysis was performed by adding 2 μl of cDNA, 1 μl of forward 5' primer, 1 μl of reverse 3' primer, and 6 μl diethyl pyrocarbonate (DEPC) in 10 μl of PCR premix. Analysis was performed in an RT-thermal cycler (Bio-Rad, Hercules, CA, USA) as reported previously [30, 31]. Primer sequences are listed in Table 2.
Table 2

Semiquantitative PCR and real-time PCR primer sequences used in the study.

Primer Name DirectionSequence (5' to 3')
Semi quantitative PCR
iNOSForwardCCCTTCCGAAGTTTCTGGCAGCAG
ReverseGGCTGTCAGAGCCTCGTGGCTTTGG
COX-2ForwardCACTACATCCTGACCCACTT
ReverseATGCTCCTGCTTGAGTATGT
TNF-αForwardTTGACCTCAGCGCTGAGTTG
ReverseCCTGTAGCCCACGTCGTAGC
GAPDHForwardCACTCACGGCAAATTCAACGGCA
ReverseGACTCCACGACATACTCAGCAC

Real time PCR
IL-6ForwardCTAGGTTTGCCGAGTAGATCTC
ReverseGACAAAGCCAGAGTCCTTCAGAGA

2.9. Preparation of Whole Cell Lysates and Nuclear Extracts and Western Blot Analysis

For lysis, cultured cells (5 × 106 cells/ml of RAW264.7 and HEK293 cells) washed with cold PBS containing 1 mM sodium orthovanadate were treated with lysis buffer (20 mM Tris-HCl, pH 7.4, 2 mM EGTA, 1 mM sodium orthovanadate, 2 mM EDTA, 1% Triton X-100, 1 mM dithiothreitol, 50 mM β-glycerol phosphate, 2 mM PMSF, 10 μg/ml aprotinin, 1 mM benzamide, 10 μg/ml pepstatin, and 10% glycerol,) [32]. The whole cell lysates were prepared with supernatant after centrifugation at 16,000 g for 10 min at 4°C. To prepare membrane fraction, washed cells were lysed in 500 μl lysis buffer and then centrifuged at 19,326 × g for 1 min. The supernatant was further centrifuged at 14,000 rpm for 1 h at 4°C to make membrane and cytosolic fractions as the second step. Finally, the pellet was also treated with extraction buffer (without Triton X-100) [33]. Nuclear lysates were prepared in a three-step procedure. After treatment, cells were harvested, washed with 1 × PBS, and lysed in 500 μl lysis buffer composed of 50 mM KCl, 1 mM PMSF, 100 μM dithiothreitol (DTT) 10 μg/ml leupeptin, 0.5% Nonidet P-40, 20 μg/ml aprotinin, and 25 mM HEPES (pH 7.8) and on ice for 4 min. Cell lysates were then centrifuged at 19,326 × g for 1 min in a microcentrifuge. Secondly, the pellet (the nuclear fraction) was washed in washing buffer (lysis buffer but without Nonidet P-40). Finally, nuclei were prepared by incubation with an extraction buffer (lysis buffer including 10% glycerol and 500 mM KCl). The nuclei/extraction buffer mixture was frozen at -80°C, thawed on ice, and centrifuged at 19,326 × g for 5 min to obtain supernatant part as a nuclear extract. The levels of proteins from whole lysates, membrane fractions, or nuclear extract were analyzed by Western blotting through separating proteins on 10% or 12% SDS-polyacrylamide gels, transferring the proteins to polyvinylidene difluoride (PVDF) membranes, and blocking the membrane in Tris-buffered saline containing 3% bovine serum albumin [34, 35]. Mouse monoclonal antibodies directed against p50, p65, IκBα, IKKα/β, AKT, p85, and β-actin (Cell Signaling) were used to detect phosphorylated and total proteins. Following incubation with primary antibodies, blots were washed three times with TBS/Tween 20 before 1 h incubation with secondary anti-mouse or anti-rabbit antibodies. After secondary treatment, blots were again washed with TBS/Tween 20 and then processed for detection using a chemiluminescence system. Proteins were visualized using an ECL system (Amersham, Little Chalfont, Buckinghamshire, UK) as previously reported [36].

2.10. Reporter Gene Activity Assay

HEK293 cells were transfected with plasmids expressing NF-κB-luciferase (1 μg/ml), β-galactosidase (0.1 μg/ml), and either Flag-MyD88 (1 μg/ml) or HA-Src (1 μg/ml) for 24 h using PEI. Cells were subsequently treated with Pj-ME (0–200 μg/ml) for 24 h. Cells underwent three rounds of freezing and thawing. Cell lysates were used to measure NF-κB-mediated luciferase activity with a luciferase assay system as previously reported [37].

2.11. Statistical Analysis

Experiments were conducted independently at a minimum in triplicate. Statistical significance of all data (mean ± standard deviation (SD)) was evaluated by ANOVA/Scheffe's post hoc test and Kruskal-Wallis/Mann-Whitney U test using the SPSS program (SPSS Inc., Chicago, IL, USA).

3. Results

3.1. Pj-ME Suppresses In Vitro Inflammatory Responses

To assess the potential anti-inflammatory effect of Pj-ME, we used RAW264.7 cells derived from mouse monocytes/macrophages. First, we determined NO production in Pj-ME-treated RAW264.7 cells exposed to the TLR4 ligand LPS (derived from Gram (-) bacteria). Interestingly, NO production in the LPS-stimulated both RAW264.7 cells (left panel) and peritoneal macrophages (right panel) was suppressed by Pj-ME (50-200 μg/ml) in a dose-dependent manner (Figure 1(a)). There was a 78% reduction in NO production using 200 μg/ml of Pj-ME in activated RAW264.7 cells (Figure 1(a)). In addition, an escalating dose of Pj-ME (0-200 μg/ml) did not exhibit cytotoxic effects in both RAW264.7 cells (left panel) and peritoneal macrophages (right panel) under normal culture conditions (Figure 1(b)). We also showed that Pj-ME did not affect cell viability in HEK-293 cells at various concentrations (50-200 μg/ml). This suggests that the inhibitory effect of Pj-ME is not due to nonspecific toxic activity. To identify anti-inflammatory components contained in Pj-ME, we used an LC/MS profiling method with four standard anti-inflammatory compounds: resveratrol, quercetin, kaempferol, and luteolin. We were unable to identify these compounds in Pj-ME, but did identify several other compounds, including astilbin (C21H22O11) at 5.16 min, astragalin (C21H20O11) at 5.52 min, and sophoricoside (C21H22O10) at 6.04 min (Figure 1(c)). Because these compounds have been reported as anti-inflammatory suppressors [38-41], the compounds could be the active agents in the extract. Meanwhile, the standard compound L-NAME reduced the release of NO (Figure 1(d)) in a dose-dependent manner as previously reported [42]. Cell viability of L-NAME was >90% at the treatment concentrations (Figure 1(e)).
Figure 1

Effects of Pj-ME on NO production in LPS-activated macrophages. ((a) and (d)) Murine macrophage-like RAW264.7 cells or peritoneal macrophages pretreated with Pj-ME (0-200 μg/ml) or L-NAME (0-1 mM) for 30 min and then treated with LPS (1 μg/ml) for 24 h. LPS-induced NO production levels were determined by the Griess assay. ((b) and (e)) To evaluate the cytotoxic activity of Pj-ME or L-NAME, RAW264.7, and HEK293 cells, and peritoneal macrophages were treated with Pj-ME (0-200 μg/ml) and L-NAME (0-1.5 mM) for 24 h. Cell viability was then determined by the MTT assay. (c) Phytochemical fingerprinting was performed by LC/MS spectrophotometric analysis. Putative components were included in each peak. Data ((a), (b), (d), and (e)) expressed as mean ± SD are representative of 3 independent experiments. ##: p< 0.01 with respect to the untreated group;  p< 0.05 and  p< 0.01 with respect to the LPS-treated group.

3.2. Pj-ME Suppresses Inflammatory Gene Expression

To determine whether Pj-ME-modulated NO production is controlled at the transcriptional or translational level, we chose RAW264.7 cells exposed to LPS and pretreated with escalating doses of Pj-ME, and then we evaluated inflammatory gene levels using both semiquantitative and real-time PCR. We observed that LPS treatment significantly upregulated iNOS, COX-2, and TNF-α expression in macrophage-like RAW264.7 cells (Figures 2(a) and 2(b)). Expectedly, both RT-PCR and real-time PCR experiments proved that the upregulation of these genes was suppressed by Pj-ME in a dose-dependent manner (0-200 μg/ml). Notably, Pj-ME (200 μg/ml) suppressed mRNA levels of iNOS, COX-2, and TNF-α by more than 70%, according to relative intensity profiling (Figure 2(b)).
Figure 2

Effect of Pj-ME on inflammatory gene expression. ((a) and (b)) Semiquantitative RT-and real-time PCR analysis was carried out to detect mRNA expression levels of inflammatory genes iNOS, COX-2, and TNF-α in RAW264.7 cells pretreated with Pj-ME (50 to 200 μg/ml) for 30 min followed by LPS exposure for 6 h. Data (b) expressed as mean ± SD are representative of 3 independent experiments.  p< 0.01 with respect to the LPS-treated group.

3.3. Pj-ME Participates in the Regulation of the NF-κB Pathway

To test the suppressive action of Pj-ME on the intracellular signaling components involved in the activation of NF-κB, we first determined the phosphorylation levels of NF-κB-related signaling molecules (p65/p50 major subunits), which included IKKα/β, IκBα, phospho (p)-p50, and p-p65, using various LPS incubation times (0-60 min) and by immunoblot analysis. We showed that Pj-ME dramatically suppresses the LPS-mediated increase in phosphorylation of p85/PI3K, IKKα/β, IκBα, p50, and p65 after incubation of LPS for 5, 15, 30, and 60 min (Figure 3(a), left panel). Interestingly, nuclear levels of p65 and p-p65 were also reduced by treatment of Pj-ME (200 μg/ml) (Figure 3(a), right panel), demonstrating that upstream regulators of NF-κB are relevant molecular targets of Pj-ME. Since p-p50 and p-p65 are active forms of NF-κB subunits, we also confirmed whether Pj-ME can block upregulated luciferase activity in NF-κB-induced HEK293 cells transfected with MyD88, a major adaptor molecule for NF-κB activation [43]. As shown in Figure 2(b), MyD88 enhanced luciferase activity 175-fold, whereas Pj-ME suppressed luciferase activity by 98% at 200 μg/ml. Interestingly, Pj-ME decreased the phosphorylation of IKKα/β and IκBα at 5 min (Figure 3(a)), which based on our previous results could be mediated by the early activation of the tyrosine kinases Syk and Src [25, 44]. Indeed, phosphorylation of Syk and Src at early time points (2, 3, and 5 mins) was strongly reduced when the cells were treated with 200 μg/ml of Pj-ME (Figure 3(c)). To ensure that these proteins are Pj-ME targets, autophosphorylation levels of Syk or Src were examined by overexpressing the Syk or Src genes in HEK293 cells and using immunoblot analysis as previously reported [45]. Pj-ME suppressed Syk phosphorylation in HEK293 cells in a dose-dependent manner, whereas Src phosphorylation was completely inhibited at 100 and 200 μg/ml (Figures 3(d) and 3(e)). These results suggest that Src or Syk plays an important role in Pj-ME-mediated suppression of inflammatory signaling.
Figure 3

Effect of Pj-ME on the NF-κB and its upstream signaling cascade in LPS-stimulated RAW264.7 cells. ((a) left panel, (a) right panel and (c)) Western blot analysis was performed to detect protein expression levels in whole cell lysates or nuclear extracts from RAW264.7 cells treated with Pj-ME (200 μg/ml) for 30 min followed by LPS exposure (1 μg/ml) over various lengths of incubation times. Levels of phosphorylated and total p85, IKKα/β, IκBα, p50, and p65 at 5, 15, 30, and 60 min, and Syk and Src levels at 2, 3, and 5 min were determined. β-Actin was used as a loading control. (b) HEK293 cells cotransfected with NF-κB-Luc (1 μg/ml) and β-gal (as transfection control) plasmid constructs were treated with Pj-ME in the presence or absence of the adaptor molecule MyD88 (1 μg/ml). Luciferase activity was measured by using luminescence. ((d) and (e)) Inhibitory activity of Pj-ME (100 and 200 μg/ml) on autophosphorylation of Syk and Src overexpressed in HEK293 cells was determined by Western blot analysis with antibodies specific to phospho-Src or phospho-Syk. Data (b) expressed as mean± SD are representative of 3 independent experiments. ##p< 0.01 with respect to untreated group and  p< 0.01 with respect to treated group.

3.4. Pj-ME Suppresses STAT3-Induced Inflammation in RAW264.7 Macrophage Cells

Like NF-κB, STAT3 (signal transducer and activator of transcription 3) is also a major transcription factor that acts in conjunction with NF-κB to induce a number of cytokines and promotes inflammation [46]. It has also been reported that Src tyrosine kinase activates STAT3 and plays a major role in many human tumors [13, 47]. Therefore, we sought to investigate whether Pj-ME suppresses the activation of STAT3 within LPS-stimulated RAW264.7 macrophages. Immunoblot analysis showed an increase in STAT3 phosphorylation and its upstream kinase JAK at later time points (0-24 h) in the LPS-treated cells. However, Pj-ME dramatically decreased LPS-induced phosphorylation of JAK and STAT3 (Figure 4(a)). It is known that IL-6 is major activator of STAT3 [48]. To test whether IL-6 expression is affected by Pj-ME in LPS-treated RAW264.7 cells, we analyzed IL-6 gene expression via quantitative real-time PCR. Notably, Pj-ME inhibited IL-6 expression in a dose-dependent manner (Figure 4(b)).
Figure 4

Effect of Pj-ME on the upstream JAK/STAT3 signaling cascade in LPS-stimulated RAW264.7 cells. (a) Western blot analysis was performed to determine protein expression levels in whole cell lysates of RAW264.7 cells treated with Pj-ME (200 μg/ml) for 30 min followed by LPS treatment (1 μg/ml) over different amounts of time. Levels of phosphorylated and total STAT3 and JAK2 at 6, 9, 12, and 24 h were determined with their specific antibodies. β-Actin was used as a loading control. (b) STAT3-specific expression of IL-6 was determined by real-time PCR from LPS-treated RAW264.7 cells. Data (b) expressed as mean± SD are representative of 3 independent experiments. ##p< 0.01 with respect to untreated group and  p< 0.01 with respect to treated group.

4. Discussion

Since P. javanicum has been prescribed as a traditional medicine for treating diarrhea, edema, and leprosy, our aim in this study was to explore the anti-inflammatory mechanism of Pj-ME using in vitro experimental conditions [16]. Our results have shown that Pj-ME plays an inhibitory role in NO secretion in LPS-treated RAW264.7 cells, which is secreted as a byproduct involved in inflammation barrier of innate immunity [49]. Moreover, NO production is regulated by both cancerous and primary macrophages activated by inflammation-inducing signals at the transcriptional level (Figure 1(a)). Therefore, we investigated whether Pj-ME downregulates inflammatory gene expression in LPS-activated macrophages. As we expected, Pj-ME inhibited the gene expression of iNOS, TNF-α, and COX-2 in LPS-stimulated RAW264.7 cells (Figure 2(a)). Moreover, Pj-ME produced these anti-inflammatory effects without affecting cell viability (Figure 1(b)), indicating that the anti-inflammatory effect of Pj-ME is at the transcriptional level and has a specific mode of action not explained by simple cytotoxicity. Of the many inflammation-regulatory transcription factors, NF-κB and its activating signaling pathway are major regulators of inflammatory gene expression [50]. The possibility that the NF-κB signaling pathway is involved in Pj-ME-regulated anti-inflammatory signaling was explored by inducing NF-κB-driven luciferase activity by MyD88, a major adaptor molecule responsible for NF-κB pathway activation through TLR4 [51, 52]. As expected, Pj-ME (100 and 200 μg/ml) decreased NF-κB-driven luciferase activation in a dose-dependent manner. NF-κB proteins are key regulators of innate and adaptive immune responses, which is triggered by IκB protein degradation followed by IκB kinase (IKK) complex phosphorylation [9]. Based on our previous results, we also investigated NF-κB signaling pathway that regulates transcription factor and tried to identify molecule linking to Pj-ME-mediated anti-inflammatory activity. Using Western blot analysis, we found that the phospho-forms of IκBα, IKKα/β, p50, and p65 were decreased at 5, 15, 30, and 60 mins (Figure 3(a)). The effect of Pj-ME on NF-κB signaling was very strong and motivated us to study the NF-κB upstream signaling in LPS-stimulated RAW264.7 cells. As expected, Pj-ME dramatically suppressed the phosphorylation of Syk and Src, major protein tyrosine kinases known to activate the NF-κB pathway [42, 53], at 2, 3, and 5 mins (Figure 3(b)). These results suggest that Pj-ME targets Syk and Src phosphorylation in the NF-κB signaling pathway. Moreover, there have been several studies that have shown that various natural products with anti-inflammatory activity suppress Src and Syk phosphorylation, supporting the significance of Syk, Src, and NF-κB activation in inflammation and cancer [54-58]. To confirm the molecular target of Pj-ME, we used plasmid constructs to overexpress Syk and Src. Notably, Pj-ME suppressed Syk and Src phosphorylation triggered by their overexpression (Figure 3(c)). Therefore, these results imply that Pj-ME may target tyrosine kinases Syk and Src and inhibit the NF-κB pathway, which would explain the anti-inflammatory activity of this extract. Although the potential of Pj-ME for modulating gene expression was not fully evaluated, it is arguable from our study that changes in transcription and translation due to the extracts and compounds contribute to the biological effects. Our study also showed that Pj-ME suppresses STAT3 signaling and genes regulated by STAT3, namely IL-6 (Figure 4(b)). However, it is possible that suppression of IL-6 gene expression could be mediated by NF-κB. Moreover, natural compounds like resveratrol have also been reported as inhibitors of inflammation, which includes NO production triggered by STAT3/IL-6 in the tumor microenvironment [59, 60]. Therefore, our findings suggest that the potential of Pj-ME to modulate inflammatory responses could be driven by suppression of inflammatory signaling pathways linked to the activation of NF-κB and STAT3. By HPLC/MS spectrometry, we have identified several compounds such as astragalin and sophoricoside from Pj-ME. So far, we have not tested whether these compounds were involved in the anti-inflammatory activity of Pj-ME. However, literatures have apparently mentioned that astilbin, astragalin, and sophoricoside are able to suppress the production of inflammatory mediators in macrophages [38-41]. Therefore, it is assumed that the compounds could be the active agents in the extract. The fact that standard anti-inflammatory compounds including resveratrol, quercetin, kaempferol, and luteolin were not detected in this extract (data not shown) also indicates that these flavonoids are not included in Pj-ME. Further detailed study on identification of active components in this extract will be followed by activity-guided fractionation strategy. In summary Protium javanicum Burm. f. methanol extracts attenuated NF-κB-mediated inflammatory signaling by downregulating Syk and Src phosphorylation in LPS-treated RAW264.7 macrophages. Moreover, Pj-ME inhibited the STAT3 signaling pathway in late time phase, which implies that Src and Syk suppression may play an important role in inhibiting cytokines, like IL-6, and activate STAT3 (Figure 5). Although Pj-ME has been used as an ethnopharmacological remedy, we have provided evidence to support its anti-inflammatory activity, enhancing our understanding of the role of Pj-ME in inflammation. Furthermore, additional preclinical studies using in vivo models will be used to establish potential therapeutic uses.
Figure 5

Putative suppressive pathway of Pj-ME in displaying its anti-inflammatory response. It is considered that Pj-ME targets the activation of protein tyrosine kinases such as JAK and Src and Syk linked to the activation of intracellular signaling pathway for the nuclear translocation of NF-κBand STAT3. Suppression of this pathway leads to the downregulation of iNOS-mediated NO production and the expression of other cytokines such as NO and IL-6.

  6 in total

1.  Anti-inflammatory canthin-6-one alkaloids from the roots of Thailand Eurycoma longifolia Jack.

Authors:  Ying Zhang; Wei Zhao; Jingya Ruan; Nuttapong Wichai; Zheng Li; Lifeng Han; Yi Zhang; Tao Wang
Journal:  J Nat Med       Date:  2020-07-08       Impact factor: 2.343

2.  Bioactive Constituents from the Roots of Eurycoma longifolia.

Authors:  Jingya Ruan; Zheng Li; Ying Zhang; Yue Chen; Mengyang Liu; Lifeng Han; Yi Zhang; Tao Wang
Journal:  Molecules       Date:  2019-08-30       Impact factor: 4.411

3.  Trichosanthes tricuspidata Lour. Methanol Extract Exhibits Anti-Inflammatory Activity by Targeting Syk, Src, and IRAK1 Kinase Activity.

Authors:  Akash Ahuja; Deok Jeong; Mi-Yeon Kim; Jae Youl Cho
Journal:  Evid Based Complement Alternat Med       Date:  2019-12-16       Impact factor: 2.629

4.  Development and Optimization of Nanoemulsion from Ethanolic Extract of Centella asiatica (NanoSECA) Using D-Optimal Mixture Design to Improve Blood-Brain Barrier Permeability.

Authors:  Nor Atiqah Jusril; Syahrul Imran Abu Bakar; Khalilah Abdul Khalil; Wan Mazlina Md Saad; Ng Kwok Wen; Mohd Ilham Adenan
Journal:  Evid Based Complement Alternat Med       Date:  2022-03-07       Impact factor: 2.629

5.  Anti-Inflammatory Activities of an Anti-Histamine Drug, Loratadine, by Suppressing TAK1 in AP-1 Pathway.

Authors:  Jiwon Jang; Stephanie Triseptya Hunto; Ji Won Kim; Hwa Pyoung Lee; Han Gyung Kim; Jae Youl Cho
Journal:  Int J Mol Sci       Date:  2022-04-03       Impact factor: 5.923

6.  New Dammarane-Type Triterpenoid Saponins from Panax notoginseng Leaves and Their Nitric Oxide Inhibitory Activities.

Authors:  Fan Sun; Jingya Ruan; Wei Zhao; Ying Zhang; Guilin Xiang; Jiejing Yan; Mimi Hao; Lijie Wu; Yi Zhang; Tao Wang
Journal:  Molecules       Date:  2019-12-29       Impact factor: 4.411

  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.