Xiaoting Jia1, Lejuan Shi1, Xiaorong Wang1, Liyun Luo1, Li Ling1, Jiang Yin1, Ying Song1, Zhijie Zhang1, Ni Qiu1, Hao Liu1, Min Deng1, Zhimin He2, Hongsheng Li3, Guopei Zheng4. 1. Affiliated Cancer Hospital & Institute of Guangzhou Medical University, Key Laboratory of Protein Modification and Degradation, The State Key Laboratory of Respiratory, Guangzhou Key Laboratory of "Translational Medicine on Malignant Tumor Treatment", Hengzhigang Road 78#, Guangzhou, 510095, Guangdong, China. 2. Affiliated Cancer Hospital & Institute of Guangzhou Medical University, Key Laboratory of Protein Modification and Degradation, The State Key Laboratory of Respiratory, Guangzhou Key Laboratory of "Translational Medicine on Malignant Tumor Treatment", Hengzhigang Road 78#, Guangzhou, 510095, Guangdong, China. hezhimin2005@yahoo.com. 3. Affiliated Cancer Hospital & Institute of Guangzhou Medical University, Key Laboratory of Protein Modification and Degradation, The State Key Laboratory of Respiratory, Guangzhou Key Laboratory of "Translational Medicine on Malignant Tumor Treatment", Hengzhigang Road 78#, Guangzhou, 510095, Guangdong, China. docli999@163.com. 4. Affiliated Cancer Hospital & Institute of Guangzhou Medical University, Key Laboratory of Protein Modification and Degradation, The State Key Laboratory of Respiratory, Guangzhou Key Laboratory of "Translational Medicine on Malignant Tumor Treatment", Hengzhigang Road 78#, Guangzhou, 510095, Guangdong, China. zhengguopei@126.com.
Abstract
Increasing evidence suggest that lncRNAs (long noncoding RNAs) play important roles in human cancer. Breast cancer is a heterogeneous disease and the potential involvement of lncRNAs in breast cancer remains unexplored. In this study, we characterized a novel lncRNA, RP1-5O6.5 (termed as RP1). We found that RP1 was highly expressed in breast cancer and predicted poor prognosis of breast cancer patients. Gain-of-function and loss-of-function assays showed that RP1 promoted the proliferation and metastasis of breast cancer cells in vitro and in vivo. Mechanistically, RP1 maintained the EMT and stemness states of breast cancer cells via repressing p27kip1 protein expression. RP1 combined with the complex p-4E-BP1/eIF4E to prevent eIF4E from interacting with eIF4G, therefore attenuating the translational efficiency of p27kip1 mRNA. Furthermore, we found that p27kip1 evidently downregulated Snail1 but not ZEB1 to inhibit invasion of breast cancer cells. Kruppel-like factor 5 (KLF5) was positively correlated with RP1 in breast cancer tissues. Moreover, we demonstrated that KLF5 recruited p300 to the RP1 promoter to enhance RP1 expression. Taken together, our findings demonstrated that KLF5-regulated RP1 plays an oncogenic role in breast cancer by suppressing p27kip1, providing support for the clinical investigation of therapeutic approaches focusing on RP1.
Increasing evidence suggest that lncRNAs (long noncoding RNAs) play important roles in humancancer. Breast cancer is a heterogeneous disease and the potential involvement of lncRNAs in breast cancer remains unexplored. In this study, we characterized a novel lncRNA, RP1-5O6.5 (termed as RP1). We found that RP1 was highly expressed in breast cancer and predicted poor prognosis of breast cancerpatients. Gain-of-function and loss-of-function assays showed that RP1 promoted the proliferation and metastasis of breast cancer cells in vitro and in vivo. Mechanistically, RP1 maintained the EMT and stemness states of breast cancer cells via repressing p27kip1 protein expression. RP1 combined with the complex p-4E-BP1/eIF4E to prevent eIF4E from interacting with eIF4G, therefore attenuating the translational efficiency of p27kip1 mRNA. Furthermore, we found that p27kip1 evidently downregulated Snail1 but not ZEB1 to inhibit invasion of breast cancer cells. Kruppel-like factor 5 (KLF5) was positively correlated with RP1 in breast cancer tissues. Moreover, we demonstrated that KLF5 recruited p300 to the RP1 promoter to enhance RP1 expression. Taken together, our findings demonstrated that KLF5-regulated RP1 plays an oncogenic role in breast cancer by suppressing p27kip1, providing support for the clinical investigation of therapeutic approaches focusing on RP1.
Breast cancer is still the most malignant female tumor in the world. It has been estimated that about 249,260 new cases and 40,890 deaths from breast cancer occurred in the United States in 2016[1]. In China, it is estimated that approximately 272,400 new cases and 70,700 deaths from breast cancer in occurred in 2015[2]. Breast cancer is a heterogeneous disease having a variety of histopathological features, genetic markers, and diverse prognostic outcomes. Breast cancer can be divided basing on gene expression profiling into four major intrinsic subtypes: luminal A, luminal B, ErbB2 (HER2) enriched, and triple-negative breast cancer (TNBC) generally including basal-like subtype. At present, surgery, chemotherapy, radiotherapy, and targeted therapy are used for breast cancer treatment. Nevertheless, the overall survival of breast cancerpatients is still poor[3,4]. Thus, exploring the molecular networks responsible for breast cancer progression is crucial to prevent breast cancer recurrence and metastasis and to improve overall survival.Accumulating evidence has indicated that long non-coding RNAs (lncRNAs) play a significant role in breast cancer[5]. The transcript sizes of lncRNAs are over 200 bp and up to 100 kb, although as the name implies they are non-coding[6]. Still, lncRNAs are engaged in numerous biological processes, such as proliferation, apoptosis, and cell cycle regulation. In addition, dysregulation of lncRNAs contributes to the development and progression of cancer[7]. It has been revealed that lncRNA MALAT1 is elevated in colorectal cancer tissues and strongly associated with invasion and metastasis. Moreover, MALAT1 promotes the proliferation and metastasis of colorectal cancer in vitro and in vivo[8]. LncRNA HOXA11-AS is positively correlated with poor prognosis in gastric cancerpatients. Mechanistically, HOXA11-AS recruits EZH2 and the histone demethylases LSD1 or DNMT1 to affect cell growth, migration, invasion, and apoptosis[9]. In breast cancer, scores of lncRNAs function as oncogenes or tumor suppressors[10]. LncRNA CCAT2 is overexpressed in breast cancer and correlated with cell migration; it is chemosensitive to 5-fluorouracil and downregulated by it[11]. LncRNA PANDAR is upregulated in breast cancer tissues and cell lines. It impacts p16 expression by regulating the recruitment of Bmi1 to the p16 promoter, which enhances G1/S transition of breast cancer cells[12]. LncRNA GAS5 is significantly reduced in breast cancer samples relative to adjacent tissues and induces growth arrest and apoptosis[13]. Hu et al. found that reduced NBAT1, another lncRNA, is associated with tumor metastasis and poor patient prognosis of breast cancer. NBAT1 regulates DKK1 in a PRC2-dependent manner and then inhibits the migration and invasion of breast cancer cells[14]. Taken together, lncRNAs can serve as novel biomarkers for the treatment of breast cancer.In this study, lncRNA RP1-5O6.5 (that we named RP1), which is located on chromosome 22, was first identified in breast cancer. RP1 (Ensembl ID ENST00000420172) has no potential coding protein ability and consists of two exons of 297 bp in length. The role of RP1 in breast cancer has been undetermined and its underlying mechanism is largely unknown. Here, we found that RP1 was evidently upregulated in breast cancer. Higher expression of RP1 was associated with worse malignant clinical parameters and poorer patient outcomes. Our results showed that RP1 enhances the proliferation and metastasis of breast cancer in vitro and in vivo. Mechanistically, our experiments suggested that RP1 interacted with the complex p-4E-BP1/eIF4E to attenuate p27kip1 translation, and therefore promote breast cancer progression. Moreover, we demonstrated that KLF5 recruits p300 to the RP1 promoter to positively regulate RP1 transcription, and a positive correlation between KLF5 and RP1 was found in breast cancer.
Materials and methods
Cells and specimens
HEK-293T cells and breast cancer cells MCF-7, T47D, SKBR3, MDA-MB-231, BT549, HCC38, and HCC1937 were cultured in DMEM (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA). The human mammary epithelial cell line MCF-10A was maintained in DMEM/F12 (1:1) (Gibco, USA) with 5% horse serum (Gibco, USA), 10 μg/mL insulin (Sigma, USA), 20 ng/mL EGF (Sigma, USA), and 0.5 μg/mL hydrocortisone (Sigma, USA). All these cells were incubated at 37 °C with 5% CO2 in a humidified incubator.Fifty-four cases breast cancer tissues and matched adjacent normal tissues were collected from patients in the Affiliated Cancer Hospital & Institute of Guangzhou Medical University between May 2012 and July 2016. All the clinical data, such as age, tumor size, TNM stage, lymph node status, and distant metastasis were obtained from clinical and pathologic records. Another cohort of 97 cases breast cancer tissues with prognosis information were obtained from the biological resource specimen bank of Affiliated Cancer Hospital & Institute of Guangzhou Medical University. Overall survival was computed from the day of surgery to the day of death or of the last follow-up. This study was approved by the ethics committee of Affiliated Cancer Hospital & Institute of Guangzhou Medical University.
Bioinformatics analysis
We obtained the RP1 sequence from the Ensemble Genome Browser (http://www.ensembl.org/index.html) and evaluated the RP1 protein-coding ability via online software CPC (http://cpc.cbi.pku.edu.cn/), CPAT (http://lilab.research.bcm.edu/cpat/index.php), and RegRNA 2.0 (http://regrna2.mbc.nctu.edu.tw/). The RP1 promoter sequence 2 kb upstream of the transcription start site was obtained from the Ensemble Genome Browser (http://asia.ensembl.org/index.html) and analyzed by JASPAR (http://jaspar.genereg.net/) to scan for potential transcriptional factors.
RNA extraction and qRT-PCR assay
RNAs extraction and qRT-PCR assays were performed as previously[15]. The primers are listed in Table 1.
Table 1
Summary of primers used in this study
Name
Sequence(5′-3′)
For qRT-PCR assay
GAPDH-F
ATTCCATGGCACCGTCAAGGCTGA
GAPDH-R
TTCTCCATGGTGGTGAAGACGCCA
RP1-Fa
TCAAATCAGCAGAATGGGTC
RP1-Ra
TAGTGCTGTGCGTATTCCG
N-cad-F
GTGCATGAAGGACAGCCTCT
N-cad-R
CCACCTTAAAATCTGCAGGC
vimentin-F
GAAATTGCAGGAGGAGATGC
vimentin-R
GCAAAGATTCCACTTTGCGT
E-cad-F
GCCGAGAGCTACACGTTCAC
E-cad-R
GTCGAGGGAAAAATAGGCTG
ZEB1-F
CAGCTTGATACCTGTGAATGGG
ZEB1-R
TATCTGTGGTCGTGTGGGACT
Snail1-F
CTCTAGGCCCTGGCTGCTAC
Snail1-R
TCTGAGTGGGTCTGGAGGTG
U6-F
CTCGCTTCGGCAGCACA
U6-R
AACGCTTCACGAATTTGCGT
p27kip1-F
AGTTCGGCTCTGTGAACACC
p27kip1-R
TGCGGATCACTGTCACATTC
p18-F
ACGTCAATGCACAAAATGGA
p18-R
CAAATCGGGATTAGCACCTC
CDK4-F
TGCAGTCCACATATGCAACA
CDK4-R
GTCGGCTTCAGAGTTTCCAC
p21-F
AGTCAGTTCCTTGTGGAGCC
p21-R
CATGGGTTCTGACGGACAT
CDK6-F
ATGCCGCTCTCCACCAT
CDK6-R
TGTCTGTTCGTGACACTGTGC
For CHIP assay
RP1-promoter1-F
AAGCCAATTATCCAAGGTCACAG
RP1-promoter1-R
TTGGCAATCCAGCTGCTCTAG
RP1-promoter2-F
TAGCAGGCAGTGGCAGTGAGT
RP1-promoter2-R
GCCTATGGCATGTGCGGAT
For dual-luciferase report assay
pGL4-wt-RP1-Fb
GGCggtaccACAGGAGGCCGTGGGCTC
pGL4-wt-RP1-Rb
GGCagatctATTTCCTGAGCCTGTGCTATGAGTA
pGL4-del-RP1-F
CTCATAGGAAAGGGGACCTCTAAGGTG
pGL4-del-RP1-R
AGGCCCCCAGCACCCACC
aThis primer of RP1 was both used in qRT-PCR and RIP assay
bLower case was presented for restriciton enzyme site
Summary of primers used in this studyaThis primer of RP1 was both used in qRT-PCR and RIP assaybLower case was presented for restriciton enzyme site
Plasmid construction
Genomic DNA, extracted from breast cancer cells via a Blood & Cell Culture DNA Mini Kit (Qiagen, Germany), was used as a template to amplify the promoter of RP1. Briefly, the wild-type reporter fragment was amplified by PrimeStar HS DNA Polymerase with High GC Buffer (TaKaRa, Japan), digested by restriction enzymes Kpn I and Bgl II, ligated into the pGL4 vector digested by Kpn I and Bgl II, then sequenced; the correct clone was named pGL4-wt-RP1. A Site Directed Mutagenesis Kit (Clontech, Japan) was used to delete the KLF5 binding site in pGL4-wt-RP1 following the user instructions, and the correct clone after sequencing was named pGL4-del-RP1. All primers are listed in Table 1.RP1, KLF5, p27kip1, and p300 overexpression and knock-down plasmids were all obtained from Genecoopia Technology (China).
Western blot
Total proteins were isolated from cells by RIPA buffer (Thermo Scientific, USA) with protease inhibitor cocktail (Roche, Switzerland). The western blot assays were performed the same as in previous manuscript[15].
BrdU assay
Cells were seeded into 96-well plates at a concentration of 10,000 cells per well and starved overnight. 1 × BrdU solution, BrdU antibody and HRP-conjugated secondary antibody was added into cells in turn following instruction. The absolute absorbance at 450 nm was recorded by a BioTek Synergy 2 reader (BioTek Instruments, USA). The absorbance represented the cell number, with the absorbance of the control set as 100%.
Transwell assay
The invasion of breast cancer cells was assessed using the Cell Invasion Assay Kit (BD Biosciences, USA) according to the manufacturer’s instructions. 2 × 105 cells were added into the upper chamber precoated with ECMatrix™ gel, complete medium was added to the lower chamber as a chemoattractant. Twenty-four hours later, cells were fixed with pre-cold methanol and stained with 2% Giemsa solution. Finally, stained cells were visualized under a microscope.
Flow cytometry assay
Briefly, cells were suspended in PBS at concentration of 1 × 106/mL. CD24-FITC antibody, CD44-PE antibody and the control antibody were added into each tube, CD24-FITC and CD44-PE antibodies were co-mixed into one tube. Then the tubes were incubated on ice for 30 min and protected from light. After centrifugation, cells were suspended in PBS with 2% FBS twice, and then cells were analyzed by FACS.
ChIP assay
A ChIP assay was carried out using an EZ-CHIP™ Chromatin Immunoprecipitation Kit (Millipore, Germany) as before[15].
Luciferase reporter assay
Luciferase activity was determined by a Dual-Luciferase Reporter Assay System (Promega, USA) on a BioTek Synergy 2. KLF5 overexpression plasmid (0.3 μg), RP1 wildtype or deletion luciferase reporter plasmid (0.2 μg), and internal control pRLTK vector (0.02 μg) were co-transfected in each well. The luciferase activity was determined as before[15].
LncRNAs location assay
A PARIS kit was obtained from Ambion technology (USA) to evaluate RP1 location in cells. Cells were resuspend in cell fractionation buffer and centrifuged. The supernatant was the cytoplasmic fraction. The pellet was the nuclear fraction. 2× lysis/binding solution, 100% ethanol, wash solution were used to extract RNAs in cytoplasmic and nuclear fraction. Then, these RNAs were transcribed into cDNA separately. qRT-PCR assays were used to test RP1 expression. U6 was used as an internal control for the nuclear fraction and GAPDH was used as a control for the cytoplasmic fraction.
L-azidohomoalanine (AHA) labelling to identify newly synthesized proteins
RP1 Overexpression plasmid was transfected into MCF-7 and SKBR3 cells, knocking down plasmid of RP1 was transfected into MDA-MB-231 and BT549 cells. Forty-eight hours after transfection, the cells were incubated with 50 μM L-azidohomoalanine (AHA) (Invitrogen, USA) for 4 h. Proteins were labelled using Click-iT Protein Reaction Buffer Kit in accordance with the protocol. Methanol, chloroform and water were added into the proteins/Click-iT Buffer in turn. Finally, the proteins were tested by western blot assay.
RIP assay
The Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore, USA) was used to identify the interaction between RP1 and p-4E-BP1/eIF4E. Cells were collected and the lysate was stored at −80 °C. Five microgram of the antibody of interest (anti-p-4E-BP1, anti-p-S6K1, anti-eIF4E, anti-eIF4G, and negative control Normal Rabbit IgG) was added into each beads sample. Beads/antibody were incubated with rotation for 30 min. Beeds/cell lysate were incubated overnight. Proteinase K was used to digest proteins. RNAs were extracted by phenol, chloroform and isoamyl alcohol. RNAs were reversly transcripted and qRT-PCR assays were used to test the results.
Co-IP assay
Cells were collected, ultrasonicated, and centrifuged. The supernatant was used for Co-IP with 50 μL for input. Supernatant (150 μL) was incubated with normal mouse IgG antibody, eIF4E antibody, or KLF5 antibody overnight at 4 °C. Protein G magnetic beads (30 μL) were added into each supernatant with antibody, and the complex was incubated for 30 min at room temperature. Protein/protein G magnetic beads were washed 3 times in RIPA, 40 μL 2 × SDS loading buffer was added, and then samples were used for western blot.
Animal experiments
All animal experiments were approved by the Experimental Animal Ethics Committee of Guangzhou Medical University. Six-week-old female immunodeficient mice were purchased from Guangdong Animal Center (China). For tumor growth assays, a total 3 × 105 cells were subcutaneously injected into the nude mice (n = 5 per group). Tumor growth was analyzed by measuring the tumor length (L) and width (W) and calculating the volume (V) through the formula V = LW2/2. For lung metastasis assays, 1 × 105 cells were injected into nude mice via the tail vein (n = 5 per group). After 6 weeks, the mice were killed to observe pulmonary metastasis.
Statistical analyses
All experiments were performed three times, and data were presented as M ± SD. SPSS statistical software version 19.0 was used to analyze all data. Survival curves were constructed using the Kaplan–Meier method and analyzed by the log-rank test. The differences between groups were investigated by Student’s t test with only two groups, or by 1-way analysis of variance (ANOVA) when more than two groups were compared. P < 0.05 was considered statistically significant.
Results
RP1 as a lncRNA is upregulated in the TNBC subtype
To explore the role of RP1 in breast cancer, we firstly determined the expression pattern of RP1 in 54 cases of breast cancer tissues and matched adjacent normal breast tissues. The results showed that RP1 transcripts were significantly increased in breast cancer tissues compared with paired normal tissues (Fig. 1a). We then found that RP1 expression was especially elevated in the TNBC cohort in comparison with cohorts of luminal A, luminal B, and HER2+ breast cancer (Fig. 1b). We also investigated possible correlations between RP1 expression and clinicopathologic factors. We found that RP1 expression was positively correlated with tumor size, node status, TNM stage, and distant metastasis (Table S1). Additionally, we carried out qRT-PCR assay to detect the expression of epithelial-to-mesenchymal transition (EMT) biomarkers E-cadherin (E-cad), Snail1, vimentin, N-cadherin (N-cad), and ZEB1 in these breast cancer tissues, and found that RP1 expression was positively correlated with these EMT biomarkers (Table S1). Consistently, we demonstrated that RP1 expression was much higher in breast cancer cells than in the normal mammary epithelial cell line MCF-10A (Fig. 1c). Particularly, RP1 was highly expressed in TNBC cell lines (HCC38, HCC1937, BT549, and MDA-MB-231) compared with luminal type cell lines (MCF-7 and T47D) or a HER2+ type cell line (SKBR3) (Fig. 1c). Moreover, we examined the subcellular localization of RP1 and found that RP1 predominantly resided in the cytoplasm of breast cancer cells (Fig. 1d). Furthermore, we used online software to evaluate the protein coding ability of RP1. Analysis of the sequence by online software Coding-Potential Assessment Tool (CPAT) and coding potential calculator (CPC) was unable to predict the protein coding potentiality of RP1, although there is a predicted ORF among the transcript by CPAT (Fig. 1e). Additionally, RegRNA 2.0 online software predicted no ORF and no ribosome-binding site in the RP1 transcript, indicating that no protein-coding potential of RP1 exists (Fig. 1e). Collectively, these data suggested that RP1 as a lncRNA was upregulated in breast cancer and associated with breast cancer progression.
Fig. 1
Overexpressed RP1 in breast cancer.
a qRT-PCR assay was implemented to detect RP1 expression levels in 54 cases breast cancer and adjacent normal tissues vs. normal, ***P < 0.001. b
RP1 expression pattern in breast cancer tissues with different ER and HER2 were also analyzed vs TNBC, *P < 0.05, **P < 0.01. c qRT-PCR assays were performed to detect RP1 expression in mammary epithelial cell MCF-10A and breast cancer cells MCF-7, T47D, SKBR3, HCC38, HCC1937, MDA-MB-231 and BT549 vs MCF-10A, *P < 0.05, **P < 0.01, ***P < 0.001. d Cytoplasm and nucleus RNA were extracted from MDA-MB-231 and BT549 cells, respectively. RP1 cellular location was studied by qRT-PCR assay. e Three online programs CPC, CPAT and RegRNA 2.0 were used to evaluate the protein coding ability of RP1
Overexpressed RP1 in breast cancer.
a qRT-PCR assay was implemented to detect RP1 expression levels in 54 cases breast cancer and adjacent normal tissues vs. normal, ***P < 0.001. b
RP1 expression pattern in breast cancer tissues with different ER and HER2 were also analyzed vs TNBC, *P < 0.05, **P < 0.01. c qRT-PCR assays were performed to detect RP1 expression in mammary epithelial cell MCF-10A and breast cancer cells MCF-7, T47D, SKBR3, HCC38, HCC1937, MDA-MB-231 and BT549 vs MCF-10A, *P < 0.05, **P < 0.01, ***P < 0.001. d Cytoplasm and nucleus RNA were extracted from MDA-MB-231 and BT549 cells, respectively. RP1 cellular location was studied by qRT-PCR assay. e Three online programs CPC, CPAT and RegRNA 2.0 were used to evaluate the protein coding ability of RP1
RP1 promotes proliferation, invasion, and stemness of breast cancer cells via p27kip1
Given that RP1 expression was frequently upregulated in TNBC tissues and cells, we further investigated the roles of RP1 in breast cancer. We used shRNAs to knockdown RP1 expression in MDA-MB-231 and BT549 cells, and chose sh-1# and sh-2# for further experiments because of their effective silencing on RP1 expression (Fig. S1A). RP1 was overexpressed in MCF-7 and SKBR3 cells via transfection with RP1-expressing vector (Fig. S1B). BrdU assay was carried out to evaluate the effect of RP1 on cell proliferation. RP1 knockdown drastically inhibited the proliferation of MDA-MB-231 and BT549 cells (Fig. 2a). Conversely, ectopically overexpressed RP1 promoted the proliferation of MCF-7 and SKBR3 cells (Fig. 2b).
Fig. 2
RP1 promoting breast cancer progression in vitro via reducing p27kip1.
RP1 was inhibited by shRNAs in MDA-MB-231 and BT549 cells: BrdU assay (a) and transwell assay (c) were performed to evaluate viability and mobility of aboved cells vs. sh-Con, **P < 0.01; Flow cytometry assay (e) was carried out to detect the propotion of CD44+CD24− in these treated cells; g Western blot assay was used to measure the expression levels of cell cycle and EMT biomarkers in these cells. Ectopic overexpression RP1 in MCF-7 and SKBR3 cells: the viability and mobility of treated cells were determined by BrdU assay (b) and transwell assay (d) vs. Vec, **P < 0.01; Flow cytometry assay (f) was carried out to detect the propotion of CD44+CD24− in above cells; h Western blot assay was used to measure the levels of cell cycle and EMT biomarkers in these cells. i
RP1 overexression plasmid and knocking-down plasmid were transfected into MCF-7 and MDA-MB-231 cells, respectively. The new synthesis of p27kip1 in mentioned cells was analyzed by AHA labelling and western blot
RP1 promoting breast cancer progression in vitro via reducing p27kip1.
RP1 was inhibited by shRNAs in MDA-MB-231 and BT549 cells: BrdU assay (a) and transwell assay (c) were performed to evaluate viability and mobility of aboved cells vs. sh-Con, **P < 0.01; Flow cytometry assay (e) was carried out to detect the propotion of CD44+CD24− in these treated cells; g Western blot assay was used to measure the expression levels of cell cycle and EMT biomarkers in these cells. Ectopic overexpression RP1 in MCF-7 and SKBR3 cells: the viability and mobility of treated cells were determined by BrdU assay (b) and transwell assay (d) vs. Vec, **P < 0.01; Flow cytometry assay (f) was carried out to detect the propotion of CD44+CD24− in above cells; h Western blot assay was used to measure the levels of cell cycle and EMT biomarkers in these cells. i
RP1 overexression plasmid and knocking-down plasmid were transfected into MCF-7 and MDA-MB-231 cells, respectively. The new synthesis of p27kip1 in mentioned cells was analyzed by AHA labelling and western blotSubsequently, we performed transwell assay to determine cell invasion with different levels of RP1. The results indicated that the invasion of MDA-MB-231 and BT549 cells with RP1 knockdown was decreased compared with the control group (Fig. 2c, Fig. S1C). However, overexpressed RP1 obviously accelerated MCF-7 and SKBR3 cell invasion compared with the control group (Fig. 2d, Fig. S1D). Moreover, the effect of RP1 on the stemness of breast cancer cells was measured. Flow cytometry assays demonstrated that the proportion of CD44+CD24− subpopulation in MDA-MB-231 and BT549 cells with knocked-down RP1 was significantly reduced compared to that of the control group (Fig. 2e), while the opposite results were found in MCF-7 and SKBR3 cells overexpressing RP1 (Fig. 2f).Furthermore, we measured the mRNA and protein expression levels of cell cycle-related biomarkers and EMT biomarkers in breast cancer cells with different RP1 expression. We found that RP1 knockdown in MDA-MB-231 and BT549 cells enhanced p27kip1 expression at protein level but not mRNA level, whereas had no significant effects on either mRNA or protein level of p18, p21, CDK4 and CDK6 (Fig. 2g, Fig. S1E). Additionally, RP1 knockdown upregulated E-cadherin (E-cad), but downregulated vimentin, N-cadherin (N-cad), ZEB1, and Snail1 both at the mRNA and protein expression levels (Fig. 2g, Fig. S1E). Strikingly, RP1 overexpression in MCF-7 and SKBR3 cells reduced p27kip1 protein level but not mRNA level, whereas had no effect on either mRNA or protein expression levels of p18, p21, CDK4, and CDK6 (Fig. 2h, Fig. S1F). RP1 enhanced EMT biomarkers vimentin, N-cad, ZEB1, and Snail1, but decreased E-cad both at the mRNA and protein expression levels (Fig. 2h, Fig. S1F). Further, we tested the new synthesized proteins via AHA labelling and western blot assays. As demonstrated in Fig. 2i, overexpression of RP1 significantly suppressed p27kip1 but not p18 protein synthesis in MCF-7 cells, while depletion of RP1 substantially promoted p27kip1 but not p18 protein synthesis in MDA-MB-231 cells. Meanwhile, to investigate whether p27kip1 was responsible for the effect of RP1, shRNAs were applied to knockdown p27kip1 expression in MCF-7 and SKBR3 cells. We found that sh-#2 silenced p27kip1 effectively (Fig. S1G). Moreover, p27kip1 was overexpressed in MDA-MB-231 and BT549 cells after transfecting with plasmids overexpressing p27kip1 (Fig. S1G). We found that p27kip1 knockdown drastically reversed the effect of RP1 knockdown on EMT biomarkers in MDA-MB-231 and BT549 cells (Fig. S1E). Similarly, overexpressing p27kip1 completely disrupted the effect of increasing RP1 expression on the above EMT biomarkers in MCF-7 and SKBR3 cells (Fig. S1F). These observations revealed that RP1 accelerated the proliferation, invasion, and stemness of breast cancer cells by reducing p27kip1 at the protein but not mRNA level.
RP1 attenuates p27kip1 protein level via modulating translation
To further explore the mechanisms for regulation of p27kip1 expression at protein level but not mRNA level, we examined the expression of several miRNAs that have been identified to regulate p27kip1 in breast cancer cells with different RP1 levels[16-19]. The results showed that whether RP1 was overexpressed in MCF-7 and SKBR3 cells or reduced in MDA-MB-231 and BT549 cells, the expression of p27kip1-related miRNAs showed no significant alteration (Fig. S2A, Fig. S2B). To determine whether RP1 reduced p27kip1 protein level via promoting protein degradation, the proteasome inhibitor MG-132 was applied. We found that MG-132 did not reverse the decrease of p27kip1 protein levels in MCF-7 and SKBR3 cells upon RP1 overexpression (Fig. S2C). Next, we focused on translational regulation of p27kip1. Commonly, mTOR regulates protein translation via modulating S6K1 and 4E-BP1 activity. We found that mTOR was activated in breast cancer cells represented as high basic levels of p-S6K1 and p-4E-BP1, but with no significant difference between MCF-7, SKBR3, MDA-MB-231, and BT549 cell lines (Fig. 3a). Rapamycin is an inhibitor of mTOR. PF-4708671 is an inhibitor of S6K1 that is activated by mTOR to enhance protein translation. 4E1Rcat is an inhibitor that disrupts the 4E-BP1/eIF4E/eIF4G signaling to preventing protein translation. Here, we found that treatment with Rapamycin or 4E1Rcat evidently reduced the p27kip1 protein level in MCF-7 and SKBR3 cells, but PF-4708671 had no significant effect (Fig. 3b). This finding suggesting that mTOR/4E-BP1 signaling was involved in regulating p27kip1 protein expression at the translational level in breast cancer cells. To further confirm the involvement of signaling branches as mTOR downstream in RP1 mediated p27kip1 protein level, the two inhibitors PF-470867 and 4E1Rcat were applied. Experimental results showed that PF-4708671 had no effect on p27kip1 protein levels, while 4E1Rcat reversed the effect of RP1 knockdown in MDA-MB-231 and BT549 cells (Fig. 3c). Then, we performed RIP (RNA-binding protein immunoprecipitation) assays to access which point of mTOR downstream was regulated by RP1. RIP assays performed in MDA-MB-231 and BT549 cell lines showed that endogenous RP1 was detected in the products of immunoprecipitation by anti-p-4E-BP1 and anti-eIF4E antibodies (Fig. 3d). Furthermore, Co-IP assays indicated that ectopic RP1 expression promoted the interaction between p-4E-BP1 and eIF4E, but attenuated the interaction between eIF4E and eIF4G. Reversely, RP1 knockdown weakened the interaction between p-4E-BP1 and eIF4E, but enhanced the interaction between eIF4E and eIF4G (Fig. 3e). Collectively, these results suggested that RP1 bound to p-4E-BP1 and/or eIF4E to enhance the interaction between p-4E-BP1 and eIF4E, subsequently prevented eIF4E from interacting with eIF4G, resulting into inhibition of p27kip1 protein translation.
Fig. 3
RP1 suppressing p27kip1 protein level via interacting with the complex p-4E-BP1/eIF4E.
a Western blot assay was carried out to evaluate protein levels of p-S6K1 and p-4E-BP1 in MCF-7, SKBR3, MDA-MB-231, and BT549 cells. b MCF-7 and SKBR3 cells were incubated with 0.05 nM Rapamycin, 2 μM 4E1Rcat and 0.1 μM PF-4708671 for 24 h, respectively. p27kip1 protein expression in each cells were determined by western blot assay. c 2 μM 4E1Rcat and 0.1 μM PF-4708671 was used to treat MDA-MB-231 cells with downregulated RP1 and BT549 cells with downregulated RP1 for 24 h, respectively. p27kip1 protein level was measured by western blot assay. d RIP assays were performed in MDA-MB-231 and BT549 cells. e Co-IP assays were carried out in MCF-7 cells with accelerating RP1 and MDA-MB-231 cells with reducing RP1
RP1 suppressing p27kip1 protein level via interacting with the complex p-4E-BP1/eIF4E.
a Western blot assay was carried out to evaluate protein levels of p-S6K1 and p-4E-BP1 in MCF-7, SKBR3, MDA-MB-231, and BT549 cells. b MCF-7 and SKBR3 cells were incubated with 0.05 nM Rapamycin, 2 μM 4E1Rcat and 0.1 μM PF-4708671 for 24 h, respectively. p27kip1 protein expression in each cells were determined by western blot assay. c 2 μM 4E1Rcat and 0.1 μM PF-4708671 was used to treat MDA-MB-231 cells with downregulated RP1 and BT549 cells with downregulated RP1 for 24 h, respectively. p27kip1 protein level was measured by western blot assay. d RIP assays were performed in MDA-MB-231 and BT549 cells. e Co-IP assays were carried out in MCF-7 cells with accelerating RP1 and MDA-MB-231 cells with reducing RP1
p27kip1 reverses the effect of RP1 on breast cancer cells
To further broaden our investigation into the mechanism of RP1 functioning in breast cancer cells, we restored p27kip1 in MCF-7 and SKBR3 cells with overexpressed RP1. BrdU assays showed that p27kip1 significantly inhibited the proliferation of MCF-7 and SKBR3 cells with overexpressed RP1 (Fig. 4a). Conversely, we repressed p27kip1 expression in MDA-MB-231 and BT549 cells with RP1 knockdown, and showed that the proliferation of these cells was remarkably enhanced compared with each control group (Fig. 4b). As shown in Fig. 4c, overexpressing p27kip1 abolished the effect of RP1 on the invasion of MCF-7 and SKBR3 cells with increased RP1 expression. Meanwhile, we found that repressing p27kip1 accelerated the invasion of MDA-MB-231 and BT549 cells with reduced RP1 (Fig. 4d). These data indicated that p27kip1 expression level determined the effects of RP1 in breast cancer cells.
Fig. 4
p27kip1 abolishing the role of RP1 in breast cancer cells.
Overexpressing p27kip1 and control plasmids were transfected into MCF-7 cells with increasing RP1 and SKBR3 cells with overexpressed RP1, respectively. BrdU assay (a) and transwell assay (c) were performed to evaluate proliferation and invasion of these cells, respectively, vs. Vec, **P < 0.01. ShRNAs targeting p27kip1 was transfected into MDA-MB-231 cells with reducing RP1 and BT549 cells with decreasing RP1, respectively. BrdU assay (b) and transwell assay (d) were performed to evaluate proliferation and invasion of these cells, vs. sh-con, **P < 0.01
p27kip1 abolishing the role of RP1 in breast cancer cells.
Overexpressing p27kip1 and control plasmids were transfected into MCF-7 cells with increasing RP1 and SKBR3 cells with overexpressed RP1, respectively. BrdU assay (a) and transwell assay (c) were performed to evaluate proliferation and invasion of these cells, respectively, vs. Vec, **P < 0.01. ShRNAs targeting p27kip1 was transfected into MDA-MB-231 cells with reducing RP1 and BT549 cells with decreasing RP1, respectively. BrdU assay (b) and transwell assay (d) were performed to evaluate proliferation and invasion of these cells, vs. sh-con, **P < 0.01
p27kip1 inhibits EMT in breast cancer cells via downregulating Snail1
p27kip1 is a well-known negative cell cycle modulator, but little is known about its function in cell invasion. We found that Snail1 and ZEB1 exhibited the most change in expression levels among the EMT biomarkers when cells were treated with different p27kip1 levels (Fig. S1E, S1F). Thus, we investigated whether p27kip1 inhibited EMT via Snail1 or ZEB1 in breast cancer cells. Snail1 and ZEB1 was overexpressed in MDA-MB-231 cells with stable p27kip1 overexpression (Fig. 5a). Meanwhile, we tested the effect of silencing Snail1 and ZEB1 in MCF-7 cells with decreased p27kip1 (Fig. 5b). Furthermore, qRT-PCR and western blot assays demonstrated that restoring Snail1 inhibited E-cad expression and enhanced the expression levels of vimentin, N-cad, and ZEB1 in MDA-MB-231 cells with increased p27kip1, while ZEB1 had no effect on the expression of these EMT biomarkers (Fig. 5c). Transwell assays showed concurring results (Fig. 5e). Likewise, downregulating Snail1 but not ZEB1 decreased the levels of vimentin, N-cad, and ZEB1 and increased E-cad in MCF-7 cells with decreased p27kip1 (Fig. 5d), and similar results were obtained by transwell assay (Fig. 5f). All these results hinted that p27kip1 repressed the invasion of breast cancer cells by negatively targeting Snail1, but the complete mechanism is still unclear and needs further investigation.
Fig. 5
p27kip1 modulating EMT in breast cancer cells via Snail1.
a Overexpressing plasmids for Snail1 and ZEB1 was transfected into MDA-MB-231 cells with increasing p27kip1, respectively. Western blot and qRT-PCR assay were applied to determine expression of Snail1 and ZEB1 vs. Vec, **P < 0.01. b shRNAs targeting Snail1 and ZEB1 was transfected into MCF-7 cells with decreasing p27kip1, respectively. Western blot and qRT-PCR assay were applied to determine expression of Snail1 and ZEB1. Sh-3# for Snail1 and sh-1# for ZEB1 were used in the following study because of their best silencing effect on Snail1 and ZEB1 vs. sh-con, **P < 0.01. Restored Snail1 and ZEB1 in MDA-MB-231 cells treated with accelerating p27kip1, expression levels of EMT biomarkers was detected by qRT-PCR and western blot assay (c), invasion of these cells were figured out via transwell assay (e). Vec, **P < 0.01. Inhibiting Snail1 and ZEB1 in MCF-7 cells with repressing p27kip1, expression levels of EMT biomarkers was tested by qRT-PCR and western blot assay (d), invasion of these cells were measured by transwell assay (f). sh-con, **P < 0.01
p27kip1 modulating EMT in breast cancer cells via Snail1.
a Overexpressing plasmids for Snail1 and ZEB1 was transfected into MDA-MB-231 cells with increasing p27kip1, respectively. Western blot and qRT-PCR assay were applied to determine expression of Snail1 and ZEB1 vs. Vec, **P < 0.01. b shRNAs targeting Snail1 and ZEB1 was transfected into MCF-7 cells with decreasing p27kip1, respectively. Western blot and qRT-PCR assay were applied to determine expression of Snail1 and ZEB1. Sh-3# for Snail1 and sh-1# for ZEB1 were used in the following study because of their best silencing effect on Snail1 and ZEB1 vs. sh-con, **P < 0.01. Restored Snail1 and ZEB1 in MDA-MB-231 cells treated with accelerating p27kip1, expression levels of EMT biomarkers was detected by qRT-PCR and western blot assay (c), invasion of these cells were figured out via transwell assay (e). Vec, **P < 0.01. Inhibiting Snail1 and ZEB1 in MCF-7 cells with repressing p27kip1, expression levels of EMT biomarkers was tested by qRT-PCR and western blot assay (d), invasion of these cells were measured by transwell assay (f). sh-con, **P < 0.01
KLF5 coordinating with p300 upregulates RP1 transcription
To explore the mechanism of RP1 upregulation in breast cancer, we searched for transcriptional factor binding sites in the RP1 promoter via the JASPAR online program. The results suggested that there were 2 binding sites for KLF5 in the RP1 promoter (Fig. 6a). Next, we evaluated KLF5 expression in the 54 cases of breast cancer tissues and matched adjacent normal tissues. KLF5 mRNA was extremely highly expressed in breast cancer tissues compared with adjacent normal tissues (P < 0.0001). Importantly, there was a strong positive correlation between the expression levels of KLF5 and RP1 in breast cancer tissues (P = 0.0316) (Fig. 6b). Consistently, the mRNA and protein levels of KLF5 were much higher in breast cancer cells, especially in TNBC cells, compared to MCF-10A cells (Fig. 6c). Subsequently, we examined the effect of KLF5 on RP1 expression. We knocked-down KLF5 in MDA-MB-231 cells with shRNAs and chose sh-3# for further studies because of its effect on KLF5 knockdown (Fig. S3A). qRT-PCR and western blot assays were performed to test KLF5 levels in MCF-7 cells transfected with KLF5 overexpression plasmid (Fig. S3B). Overexpressed KLF5 in MCF-7 and SKBR3 cells evidently enhanced RP1 expression, while repressed KLF5 in MDA-MB-231 and BT549 cells did the opposite effect on RP1 expression (Fig. 6d). For further confirmation, we performed a chromatin immunoprecipitation (ChIP) assay followed by a luciferase reporter assay to map the binding sites for KLF5 onto the promoter of RP1. As shown in Fig. 6e, KLF5 only bound to site B to enhance the activity of the RP1 promoter in MDA-MB-231 and BT549 cells. Thus, we constructed luciferase reporters containing the 2000 bp of the RP1 promoter, which included both the wild-type and the deletion of KLF5 binding site B. We found that overexpression of KLF5 increased the luciferase activity of the wild-type reporter vector but not that of the deletion reporter vector in MCF-7 and SKBR3 cells (Fig. 6f, Fig. S3C). Alternatively, the luciferase activity of the wild-type reporter vector but not that of the deletion reporter vector was extremely decreased in MDA-MB-231 and BT549 cells with KLF5 knockdown (Fig. 6f, Fig. S3C). In addition, we co-transfected the wild-type reporter vector and overexpressing KLF5 plasmid in HEK-293T cells with the p300 inhibitor C646, and the results showed that C646 attenuated the effect of KLF5 on RP1 promoter activity (Fig. S3D). Furthermore, we found that p300 enhanced RP1 promoter activity in a dose-dependent manner with KLF5 in HEK-293T cells (Fig. S3D). Meanwhile, C646 evidently reduced RP1 in MDA-MB-231 and BT549 cells (Fig. 6g), and overexpressing p300 in MCF-7 and SKBR3 cells accelerated RP1 expression (Fig. 6g). Moreover, we restored p300 in MDA-MB-231 and BT549 cells while knocking down KLF5, and found that p300 had no effect on RP1 expression in breast cancer cells without KLF5 (Fig. S3E). Finally, we carried out Co-IP assays to show that KLF5 directly interacted with p300 in MDA-MB-231 and BT549 cells (Fig. 6h). Taken together, we propose that KLF5 recruits p300 onto the RP1 promoter to upregulate its expression in breast cancer cells.
Fig. 6
KLF5 co-transcriptionally upregulating RP1 with p300.
a A sketch map of potential binding sites of transcriptional factor KLF5 into the RP1 promoter. b qRT-PCR assay was used to evaluate KLF5 mRNA expression levels in 54 cases of breast cancer tissues and matched adjacent normal tissues. The expression relationship between KLF5 and RP1 in 54 cases of breast cancer tissues was analyzed. c qRT-PCR and western blot assay were performed to detect KLF5 expression in these cells vs. MCF-10A, *P < 0.05, **P < 0.01, ***P < 0.001. d Plasmid for overexpressing KLF5 was transfected into MCF-7 and SKBR3 cells, plasmid for knocking-down KLF5 was transfected into MDA-MB-231 and BT549 cells, respectively. RP1 expression in these treated cells were determined via qRT-PCR assay vs. Vec, **P < 0.01. vs. sh-con, **P < 0.01. e ChIP assay was performed in MDA-MB-231 and BT549 cells. Pol II contacts to polymerase II. f Dual-luciferase reporter gene assay was conducted in MCF-7 cells with overexpression KLF5 and in MDA-MB-231 cells with shRNA targeting KLF5. **P < 0.01. g MDA-MB-231 and BT549 cells were treated with C646 or DMSO for 24 h, MCF-7 and SKBR3 cells were treated with overexpressing p300, qRT-PCR assay was used to determine RP1 expression in these cells vs. DMSO, **P < 0.01 vs. Vec, **P < 0.01. h Co-IP assay was performed in MDA-MB-231 and BT549 cells
KLF5 co-transcriptionally upregulating RP1 with p300.
a A sketch map of potential binding sites of transcriptional factor KLF5 into the RP1 promoter. b qRT-PCR assay was used to evaluate KLF5 mRNA expression levels in 54 cases of breast cancer tissues and matched adjacent normal tissues. The expression relationship between KLF5 and RP1 in 54 cases of breast cancer tissues was analyzed. c qRT-PCR and western blot assay were performed to detect KLF5 expression in these cells vs. MCF-10A, *P < 0.05, **P < 0.01, ***P < 0.001. d Plasmid for overexpressing KLF5 was transfected into MCF-7 and SKBR3 cells, plasmid for knocking-down KLF5 was transfected into MDA-MB-231 and BT549 cells, respectively. RP1 expression in these treated cells were determined via qRT-PCR assay vs. Vec, **P < 0.01. vs. sh-con, **P < 0.01. e ChIP assay was performed in MDA-MB-231 and BT549 cells. Pol II contacts to polymerase II. f Dual-luciferase reporter gene assay was conducted in MCF-7 cells with overexpression KLF5 and in MDA-MB-231 cells with shRNA targeting KLF5. **P < 0.01. g MDA-MB-231 and BT549 cells were treated with C646 or DMSO for 24 h, MCF-7 and SKBR3 cells were treated with overexpressing p300, qRT-PCR assay was used to determine RP1 expression in these cells vs. DMSO, **P < 0.01 vs. Vec, **P < 0.01. h Co-IP assay was performed in MDA-MB-231 and BT549 cells
RP1 promotes breast cancer progression and predicts poor prognosis of breast cancer
We used a xenograft nude mouse model to test RP1 function in vivo. MDA-MB-231 cells with reduced RP1 and SKBR3 cells with increased RP1 were injected into nude mice, respectively, and the tumor sizes of each mouse were detected. The results suggested that MDA-MB-231 cells with reduced RP1 decreased tumor size compared with the control group. However, SKBR3 cells with overexpressed RP1 strongly increased tumor size compared to the control group (Fig. 7a). To further evaluate the effect of RP1 on lung metastasis in vivo, MDA-MB-231 cells with reduced RP1 and SKBR3 cells with increased RP1 were injected into mice via the tail vein, and then lung metastases were analyzed 6 weeks later. The data indicated that metastases of MDA-MB-231 cells with reduced RP1 were far fewer than those of the control group. However, the opposite results were obtained in SKBR3 cells with increased RP1 (Fig. 7b). Meanwhile, qRT-PCR assays were carried out to measure RP1 expression in 97 cases of breast cancer tissues with prognosis information. The results showed that RP1 expression was upregulated in 59.79% (58 out of 97) breast cancer tissues (Fig. 7c). Kaplan–Meier analysis showed that breast cancerpatients with high RP1 expression had worse overall survival compared to patients with low RP1 expression (Fig. 7d). Additionally, we drawed a sketch map to illustrate the mechanism of RP1 effect on p27kip1 (Fig. 7e). All these results implied that RP1 promotes breast cancer progression and is a potential indicator for poor prognosis in breast cancerpatients.
Fig. 7
RP1 accelerating breast cancer malignancy and becoming a positive biomarker for poor prognosis of breast cancer patients.
a 3 × 105 MDA-MB-231 cells with reduced RP1 (sh-1#) and SKBR3 cells with increased RP1 were subcutaneously injected into the nude mice (n = 5), respectively. Tumor growth was monitored every 3 days. Tumor size and weight were recorded. Data were represented as mean ± SD vs. control, **P < 0.01. b 1 × 105 MDA-MB-231 cells with reduced RP1 and SKBR3 cells with increased RP1 were injected into the nude mice via tail vein (n = 5). Six weeks later, lung metastasis of each group were analyzed. c qRT-PCR assay was carried out to detect RP1 expression levels in 97 cases of breast cancer tissues with prognosis information. d Overall survival curves of breast cancer patients with low expression versus high expression of RP1 were analyzed. e A sketch map was drawn to illustrate the mechanism of RP1 effect on breast cancer cell proliferation and metastasis
RP1 accelerating breast cancer malignancy and becoming a positive biomarker for poor prognosis of breast cancer patients.
a 3 × 105 MDA-MB-231 cells with reduced RP1 (sh-1#) and SKBR3 cells with increased RP1 were subcutaneously injected into the nude mice (n = 5), respectively. Tumor growth was monitored every 3 days. Tumor size and weight were recorded. Data were represented as mean ± SD vs. control, **P < 0.01. b 1 × 105 MDA-MB-231 cells with reduced RP1 and SKBR3 cells with increased RP1 were injected into the nude mice via tail vein (n = 5). Six weeks later, lung metastasis of each group were analyzed. c qRT-PCR assay was carried out to detect RP1 expression levels in 97 cases of breast cancer tissues with prognosis information. d Overall survival curves of breast cancerpatients with low expression versus high expression of RP1 were analyzed. e A sketch map was drawn to illustrate the mechanism of RP1 effect on breast cancer cell proliferation and metastasis
Discussion
The recent discovery of lncRNAs has provided an important new perspective on cancer progression. LncRNAs are frequently dysregulated in cancer. In support of this notion, we showed that RP1 is highly expressed in breast cancer cells and tissues. RP1 was also strongly correlated with clinical parameters and poor outcomes in breast cancerpatients. ChIP and luciferase reporter assays combined with Co-IP assays indicated that KLF5 recruits p300 to the RP1 promoter to transcriptionally upregulate RP1 expression. RP1 significantly accelerated breast cancer cell proliferation and invasion in vivo and in vitro. Further experiments suggested that RP1 directly interacts with the complex p-4E-BP1/eIF4E to inhibit p27kip1 translation, and that p27kip1 reduces Snail1 to inhibit breast cancer metastasis. Thus, our study provides evidence that RP1 has an oncogenic role in breast cancer.Aberrantly expressed lncRNAs are always regulated by several transcriptional factors. Zhang et al. confirmed that the lncRNA TUG1 is a direct transcriptional target of p53 via luciferase and ChIP assays; TUG1 knockdown significantly promotes the proliferation of non-small cell lung cancer[20]. c-Myc binds to evolutionarily conserved E-boxes to facilitate histone acetylation and transcriptional initiation of the lncRNA H19 promoter in diverse cell types, including breast epithelial, glioblastoma, and fibroblast cells[21]. It has been reported that the transcription factor KLF5 is highly expressed in basal-like breast cancer and promotes breast cancer cell proliferation, survival, migration, and tumor growth[22-24]. Likewise, we found that KLF5 was positively related with RP1 in breast cancer tissues. Subsequent analysis demonstrated that KLF5 directly bound to the RP1 promoter to upregulate its expression. Co-IP and luciferase assays showed that KLF5 interacted with p300 to upregulate RP1 expression. p300, a non-DNA-binding transcriptional coactivator, functions primarily as a “bridge” protein between DNA-bound transcription factors and the basal transcription complex, and plays a critical regulatory role in RNA polymerase II-mediated transcription[25,26]. It has been shown that FOXO3a recruits the coactivator histone acetyltransferase (HAT) CBP/p300 to transcriptionally regulate gene expression[27]. Here, we similarly found that p300 had no effect on RP1 in cells without KLF5. In the presence of KLF5, p300 enhanced RP1 expression in a dose-dependent manner. Therefore, we propose that KLF5 recruits p300 to the RP1 promoter to upregulate its expression.Moreover, we explored RP1 function in breast cancer cells. BrdU and transwell assays demonstrated that RP1 promoted the proliferation and invasion of breast cancer cells. Further investigation of the mechanism suggested that RP1 might function in breast cancer via downregulating p27kip1.There is little known about how lncRNAs regulate p27kip1. Luo et al. found that lncRNA GAS5 interacts with E2F1 and enhances the binding of E2F1 to the p27Kip1 promoter to inhibit cell proliferation and induce the G0/G1 phase in prostate cancer[28]. It has been reported that hnRNP I enhances the translation of p27Kip1 via interacting with the 5′-UTR of p27kip1 mRNA, and the interaction of UCA1 with hnRNP I suppresses the p27kip1 protein level by competitive inhibition[29]. In line with this, we found that RP1 decreased the protein but not mRNA levels of p27kip1, and had no effect on other cell cycle biomarkers. RP1 enhanced EMT biomarkers both at the mRNA and protein levels. We disclosed that suppressed p27kip1 expression drastically reversed the effect of reducing RP1 expression on these EMT biomarkers. Similarly, overexpressed p27kip1 thoroughly disrupted the effect of increasing RP1 expression on these EMT biomarkers. As is known, p27kip1 inhibits cell proliferation via G1 cell cycle arrest[30]. However, the role of p27kip1 in cancer metastasis appears contradictory. It has been reported that p27kip1 methylation is positively associated with tumor metastasis in esophageal squamous cell carcinomapatients[31]. We also showed that p27kip1 significantly inhibited cell metastasis via reducing Snail1, but the mechanism remains unknown. Very recently, cytoplasmic p27 was shown to contribute to the EMT process[32]. We hypothesized that p27 serves as a molecular switch that coordinates tumor-cell migration and metastasis. For instance, in carcinoma cells that have succeeded in hyper-phosphorylating p27 and shuttling it to and/or retaining it in the cytoplasm, p27 might contribute to enhanced EMT, motility, and invasion, allowing these cells to disseminate to distant sites; however, upon arrival at distant hostile microenvironments, these cells might undergo a mesenchymal-epithelial transition, losing the hyper-phosphorylated status of p27 and inducing its nuclear expression, thus facilitating entry into dormancy[33].There are several ways to regulate protein expression, such as transcriptional, translational, and post-translational control. miRNAs bind to the 3′UTRs of target mRNAs in an incomplete complementary pairing pattern to inhibit the further translation of target mRNAs without inducing complete degradation[34,35]. Thus, we tested the expression of p27kip1-related miRNAs and found that RP1 had no effect on these miRNAs. In eukaryotic cells, most proteins are degraded via the ubiquitin-proteasome pathway[36]. Therefore, we used the proteasome inhibitor MG-132 to treat cells and discovered that RP1 did not suppress p27kip1 via protein degradation. In addition, the mTOR signaling pathway senses and responds to nutrient availability, stress, energy sufficiency, mitogens, and hormones to modulate protein synthesis[37]. MammalianTOR complex 1 (mTORC1) directly regulates protein synthesis in cells[38]. There are 2 targets of mTORC1 in mammalian cells: 4E-BP1 and S6K1[39]. Hypo-phosphorylated 4E-BP1 binds tightly to eIF4E and prevents eIF4G from interacting with eIF4E. After mTORC1 activation, hyper-phosphorylated 4E-BP1 dissociates from eIF4E, allowing for the recruitment of eIF4G and eIF4A to the 5′-end of an mRNA[40]. A large body of evidence implies that phosphorylated S6K1 promotes the increased translation of 5′TOP (terminal oligopyrimidine tract) mRNAs[41]. Consistent with the roles of 4E-BP1 and S6K1 in protein synthesis, we employed PF-4708671 and 4E1Rcat to treat breast cancer cells and found that these inhibitors had no effect on p27kip1 in cells without RP1. Interestingly, RIP assays illustrated that RP1 interacted with the complex p-4E-BP1/eIF4E. Thus, we propose that RP1 fixes p-4E-BP1 to eIF4E, prevents eIF4G from interacting with eIF4E, and therefore inhibits p27Kip1 translation. These results highlight an important mechanism of RP1 in the promotion of breast cancer progression.In summary, we demonstrated for the first time that dysregulated KLF5/RP1/p27kip1 signaling plays a critical role in regulating the proliferation and metastasis of breast cancer. Excitingly, these investigations suggest that RP1 can serve as a potential therapeutic target and biomarker for breast cancerpatients, and provide a rationale for the further development of RP1-targeted treatments for breast cancer.table s1supplemental figure legendfigure s1figure s2figure s3