Literature DB >> 30886203

Characterization, identification and evaluation of a set of wheat-Aegilops comosa chromosome lines.

Cheng Liu1,2, Wenping Gong1, Ran Han1, Jun Guo1, Guangrong Li3, Haosheng Li1, Jianmin Song1,2, Aifeng Liu1, Xinyou Cao1,2, Shengnan Zhai1, Dungong Cheng1, Genying Li1,2, Zhendong Zhao1, Zujun Yang3, Jianjun Liu4, Stephen M Reader5.   

Abstract

This study characterized and evaluated a set of wheat-Aegilops comosa introgression lines, including six additions and one substitution. A total of 47 PLUG markers and a set of cytogenetic markers specific for Ae. comosa chromosomes were established after screening 526 PLUG primer pairs and performing FISH using oligonucleotides as probes. Marker analysis confirmed that these lines were wheat-Ae. comosa 2M-7M addition lines and a 6M(6A) substitution line. The molecular and cytogenetic markers developed herein could be used to trace Ae. comosa chromatin in wheat background. In order to evaluate the breeding value of the material, disease resistance tests and agronomical trait investigations were carried out on these alien chromosome introgression lines. Disease resistance tests showed that chromosomes 2M and 7M of Ae. comosa might harbor new stripe rust and powdery mildew resistance genes, respectively, therefore, they could be used as resistance sources for wheat breeding. Investigations into agronomical traits showed that all chromosomes 2M to 7M had detrimental effects on the agronomic performance of wheat, therefore, the selection of plants with relatively negative effects should be avoided when inducing wheat-A. comosa chromosome translocations using chromosome engineering procedures.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 30886203      PMCID: PMC6423130          DOI: 10.1038/s41598-019-41219-9

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Aegilops comosa Sm. in Sibth. et Sm. (syn. Triticum comosum (Sm. in Sibth. et Sm.) K. Richt.) is an annual diploid species (2n = 2x = 14, genome MM) with narrowly cylindrical spikes, slender glumes, parallel veins and three awns, mainly endemic to coastal regions of the former Yugoslavia, Albania, and coastal and inland Greece[1]. Ae. comosa has been found to be resistant to wheat stripe rust (Puccinia striiformis Westend)[2], leaf rust (P. recondita Roberge ex Desmaz. f. sp. tritici) and powdery mildew (Blumeria graminis f. sp. tritici)[3], stem rust (Puccinia graminis f. sp. tritici)[4,5], cereal cyst nematode (Heterodera avenae Wollenweber)[6], hessian fly (Mayetiola destructor (Say) and greenbug (Schizaphis graminum (Rondani)[3]. Moreover, Ae. comosa has salt tolerance[7]. Therefore, Ae. comosa is potentially an excellent gene source for wheat improvement. The creation of wheat-Ae. comosa amphiploids, addition, substitution and translocation lines are the first steps in the long process of transferring desirable genes from Ae. comosa to wheat. Riley et al. produced and identified a wheat-Ae. comosa 2M addition line[2]. Moreover, 2D-2M translocations[2,8] and 2A-2M translocations[5,8] were also developed. Weng et al. synthesized a T. persicum-Ae. comosa amphiploid and six addition lines[9], but the homoeologous groups of the Ae. comosa chromosomes in these additions were not identified. Hereafter, Weng et al. created a wheat-Ae. comosa 4M(4D) substitution line[10]. Recently, Jia (2016) synthesized a wheat-Ae. comosa amphiploid and obtained several wheat-Ae. comosa derivatives[11]. Besides the wheat-Ae. comosa chromosome lines mentioned above, no other references have been found reporting the development of wheat-Ae. comosa germplasm. Miller’s research group at John Innes Centre, UK, developed six wheat-Ae. comosa additions and one substitution. These lines were primarily identified by studying mitotic chromosomes used the classic method based on marker loci[12] for determining the homoeology of chromosomes within the Triticeae tribe. These lines were named as wheat-Ae. comosa 2?M-7?M additions (? indicates the homoeologous group of the M genome chromosomes in wheat background is a speculation) and a 6?M (6A) substitution. In this current research, PCR-based landmark unique gene (PLUG) markers were developed to confirm the previous tentative chromosomal identifications. In order to facilitate any future utilization of wheat-comosa chromosome translocations for wheat breeding programs, cytogenetic markers specific for Ae. comosa chromosomes were developed to assist in identifying Ae. comosa chromosomes in a wheat background. In addition, the levels of disease resistance and agronomical characteristics of the wheat-Ae. comosa 2M–7M additions and the 6M(6A) substitution were also investigated to provide useful information for the possible future development of wheat-Ae. comosa translocations or homoeologous recombinants.

Results

Identification of wheat-Ae. comosa chromosome lines using PLUG markers

Molecular markers developed based on EST primers had been widely used in identifying chromosome homoeologous groups in wheat-interspecific crosses[13,14]. In this research, a total of 526 PLUG primer pairs were screened using Ae. comosa, the T. turgidum-Ae. comosa amphiploid, CS, JM22 and JN17 as material to develop chromosome specific markers for Ae. comosa. As a result, fifty-four primer pairs were found which could generate polymorphism(s) among the material tested (Table 1). Among these fifty-four primer pairs, five, seven, eighteen, three, two, eight and eleven belonged to chromosome homoeologous groups 1 to 7, respectively, and they were Ae. comosa-specific. The PCR patterns of primer pairs TNAC1204, TNAC1137, TNAC1329, TNAC1331, TNAC1737, TNAC1740, TNAC1800 and TNAC1924 were showed in Fig. 1.
Table 1

PLUG primer pairs screened to identify specific markers of Ae. comosa chromosomes.

Chromosome homoeologous groupNumber of PLUG primer pairsNumber of polymorphic primer pairsNumber of polymorphic markers which could be located on Ae. comosa chromosomes% polymorphism
Group 1*57558.8%
Group 2677710.4%
Group 385181618.8%
Group 471311.4%
Group 578211.3%
Group 6598711.9%
Group 710911109.2%
Total52654478.9%

*Data are collected from CS-Ae. geniculata 1Mg addition but not the CS-Ae. comosa 1M addition.

Figure 1

PCR patterns of primer pairs TNAC1204 (A), TNAC1137 (B), TNAC1329 (C), TNAC1331 (D), TNAC1737 (E), TNAC1740 (F), TNAC1800 (G) and TNAC1924 (H). Lane M indicates Marker DM2000. Lanes 1–5 in (A–H) are Ae. comosa, T. turgidum-Ae. comosa amphiploid, CS, JM22 and JN17, respectively.

PLUG primer pairs screened to identify specific markers of Ae. comosa chromosomes. *Data are collected from CS-Ae. geniculata 1Mg addition but not the CS-Ae. comosa 1M addition. PCR patterns of primer pairs TNAC1204 (A), TNAC1137 (B), TNAC1329 (C), TNAC1331 (D), TNAC1737 (E), TNAC1740 (F), TNAC1800 (G) and TNAC1924 (H). Lane M indicates Marker DM2000. Lanes 1–5 in (A–H) are Ae. comosa, T. turgidum-Ae. comosa amphiploid, CS, JM22 and JN17, respectively. PCR using the fifty-four PLUG primers mentioned above was also performed on the tentatively named CS-Ae. comosa 2M–7M additions and the 6M(6A) substitution to identify the homoeologous groups for each of the Ae. comosa chromosomes. The M genome of Ae. comosa was the donor of the Mg genome of Ae. geniculata[15]. Therefore, CS-Ae. geniculata 1Mg, 2Mg and 7Mg addition lines were also introduced into the current molecular experiment (the 3Mg–6Mg addition lines are not available). The PCR results suggested that a total forty-seven markers could be located onto the M or Mg chromosomes (Tables 1 and 2). Among these markers, five could be located onto Ae. geniculata chromosome 1Mg, however, they could not produce target bands from the seven CS-Ae. comosa lines, indicating that these lines do not possess chromosome 1M of Ae. comosa. Seven (only three could located on chromosome 2Mg of Ae. geniculata), sixteen, one, one, seven and ten (only five could located on chromosome 7Mg of Ae. geniculata) markers could be located onto the tentatively named chromosomes 2M to 7M of Ae. comosa (Table 2), respectively, confirming that the chromosomes in these lines were correctly identified as 2M to 7M.
Table 2

Markers specific for Ae. comosa chromosomes developed by the current study.

No.PrimerPrimer sequence (5′-3′)Wheat chromosomal location*Location on M or Mg chromosomeEnzyme usedProduct size (bp)
11017F:ACAGCCAAGGGTATCACTTCC1B1MgTaqI1250
R:TCAAGAAAGCGCTTGTCAAAT1D
21031F:GAGATGGAAGCGACATCTCTG1B1MgTaqI350
R:CACAGCCCGTTGTCTGTACTT
31073F:CTGCTCGAGCTCTTCCAATTC1B1MgTaqI730
R:CGCCAAGCAAATGAAAGTAAT1D
41089F:CGTATGGGAAGATCACAGACC1B1MgTaqI380
R:TGGTTTCGCATACACATCAAA1D
51079F:CACTGTGAAGACCATGATTGC1B1MgHaeIII350
R:TCATCAGGTGGATCAACTTCC1D
61098F:AGCGTCAGTCATCTCAGTGCT2A2MHaeIII220
R:CCATCTCCCTCTCCTGGAA2B
71138F:CAAACTCCAGCACAGGGATAC2A2M500
R:CATCAAACAGTCCATGAGATGC2D
81204F:GAGAGGAATGCGTGAAGTTTG2AL4-0.27-0.772M850
R:AGACCATCTTTCCGGTCTTTG2BL7-0.50-0.58
2DL10-0.49-0.58
91137F:GCTGAATCACTCAACCATTCC2AL4-0.27-0.772MTaqI680
R:TGCTCGCGCTCTACTTCAC2BL4-0.65-0.892Mg
2DL9-0.76-0.94
101239F:TGGAAACTCTGCTGCATCTCT2B2MTaqI500
R:GAATATCTGGGCTCGCTTGTA2Mg
111206F:ACCTCTACACCAGAGCAGTCG2A2M1200
R:CCGAACACCTTGGACACC2B
121102F:GGAGAGGTGAAGGACCAACTC2AS5-0.78-1.002MTaqI1000
R:CCTTGCAGCGTAGTGAGATTT2BS3-0.84-1.002Mg
2DS5-0.47-1.00
131294F:CGGAAACTTTAGCCTTCTGCT3AS4-0.45-1.003MHaeIII760
R:GTCGTGTCAGATGCTTTGGAT3BS9-0.57-0.785M
3DS4-0.59-1.00
141254F:ATTGATTTCAGCCCTGGAGTT3A3MTaqI900
R:CTACTGCACGCACCAGAAGTT3B5M
151244F:TCCTGTGGTAGTTCGCTTGAC3A3M1100
R:CAAATGGTTAAGCCGGAATTT3B
161262F:AGCGTCAGAATGACAGACACC3D3M1100
R:CTTTGTATGCCTCGGAGATCA
171348F:GCTCTCAATTGCAGGTGTTTG3B3M950
R:AGCGGAATCAAAGTTGAAGGT3D
181314F:AGGCTAAGGTGACGAGCAAA3AS4-0.45-1.003MTaqI780
R:TCATCATCAAAGCATTCACCA3BS1-0.33-0.57
3DS10-0.31-0.44
191296F:GCATCCTGTCCCTCATCAC3AS4-0.45-1.003MHaeIII1200
R:TCGAGGTCTCTAGACCAATGC3BS9-0.57-0.78850
3DS4-0.59-1.00
201318F:CATGTTCAGTGGCCTACCAGT3A3MHaeIII550
R:CGCATACTTCAAAGTCCAACG3D
211643F:ACGTGGAACACAAAGCAGGTA3A3MHaeIII730
R:CTTCACCTCCACTTGCACATT3B
221327F:AGAGACCCAAGCAGGATGATT3A3MTaqI550
R:TGCTCCACTATCACACGACTC
231329F:CACATCCTCGTTGCTTACCAT3D3MTaqI800
R:TTGGTGATGATGACCTCAAGC
241331F:GACGCGTATGTGGAGACATTT3B3MTaqI1700
R:AGCTCCACCAGAGATACGTCA
251349F:CTGCCCACATAACCCTTCTG3D3MTaqI800
R:AGGAGACAGGCCACCGTGA
261350F:AGCAGCAAAGGTTAGTGCGTA3A3B3MTaqI1400
R:AGAATCTGCCAGGCTGAGAAT
271341F:GTTGAAGCCTACATGCCACAC3AL1-0.26-0.423M600
R:TAGCATGGGCTCCTAACATTGC-3BL2-0.22
C-3DL1-0.23
281364F:CGTCAGGCTCAGGGTGTC3AL4-0.61-0.783MTaqI800
R:AAAGAGCCTCTGTCTCTCAGG3BL10-0.50-0.63
3DL1-0.23-0.81
291396F:TACCGCTTCCGCTTCTTC4B4MTaqI1000
R:TGAAATGGAAAGGGAATGTCA4D7M
301496F:TGGTGCTTCTTCGACTTCTTG5B4MTaqI800
R:GCTACAACCCGGCACTCAT5M750
7M
311702F:CATGGAAAGGTTGACAAGGAAC-6AL4-0.556MTaqI1100
R:CTGGATGTTCCATTTCTGCTCC-6BL3-0.36
6DL6-0.29-0.47
321737F:CCCGCTGTAGACATCCTCTCT6B6MTaqI730
R:GGACGATGGTCGGAATCTT6D
331740F:CGGAAGTGCTCGATTGTATCT6AL7-0.88-0.906MTaqI650
R:GCGGGTTTCTTCTCAACCTT6BL5-0.40-0.66
6DL6-0.29-0.47
341745F:AGAACTCAGATGCAGGCTCAA6B6MTaqI780
R:AACAAGATGGCGAGGAAGAAC6D
351752F:GTAGACGATGTCGAGGAGCAT6AL8-0.90-1.006MTaqI780
R:CTTCACCAATTTCTCCCATGA6BL1-0.70-1.00
6DL11-0.74-0.80
361740F:CGGAAGTGCTCGATTGTATCT6AL7-0.88-0.906M1100
R:GCGGGTTTCTTCTCAACCTT6BL5-0.40-0.66
6DL6-0.29-0.47
371751F:CTTCCTTTGCTTGTGATCCTG6AL8-0.90-1.006M650
R:GCCTGAGGACTTGAAGTGGTA6BL1-0.70-1.00
6DL12-0.68-0.74
381800F:AACCATGCATCCGGTGAAC7A7MTaqI1200
R:CTCATCATCGCTTCGCTCTT7D
391920F:CTGTGACGCCCTAGAATCTGA7D7MTaqI800
R:CAAGTCGACGGTACTCTCTGG700
401915F:AGCTCCAGAAAGAGCAGCAG7A7MTaqI720
R:TTTCTCGACATAACGGTATGGAT7Mg
411924F:TAGCTTTGGAACGATGTGTGG7A7MHaeIII770
R:TGTGGAGCAGTGCTGTTTATG7D7Mg
421897F:CAAGGAGTCGCTAAGAGATGC7A7MTaqI650
R:ATTGGATATGTGCCCGATAAA7B
431823F:TTGCTGTTCCACACGTTGATA7B4MTaqI720
R:ATCGTCGAGTACGCCAACA7D7M
441888F:AGGGATGTGTTGGAGCTGTTAC-7AL1-0.394MTaqI1400
R:CACAGTGACCTTCTGCTCCTT7BL2-0.38-0.637M,7Mg
7DL5-0.30-0.61
451889F:ACCTGTTGCAAAGCCTTGAT7B4MTaqI750
R:TGACCCAGAGTTGTTAGAAGC7M
461902F:AATACCAGGTCCTCCAACTTT7A4MTaqI630
R:TGGAATCGCTGAGAAAGAATG7D7M, 7Mg
471884F:TATTTGACATGTTGGGCCTCT7B4M700
R:GGAGAAATCTGTTTGCGTTGT7M, 7Mg

*Information of wheat chromosomal locations is according to Ishikawa et al. (2007).

Markers specific for Ae. comosa chromosomes developed by the current study. *Information of wheat chromosomal locations is according to Ishikawa et al. (2007). The percentage of polymorphic markers generated for chromosome homoeologous groups 1 to 7 of Ae. comosa by PLUG primers ranged from 1.3% to 18.8% (percentage data of group 1 are from Ae. geniculata due to no CS-Ae. comosa 1M addition being available) with an average of 8.8% (Table 1). The marker localization results of primer pairs TNAC1204, TNAC1137, TNAC1329, TNAC1331, TNAC1737, TNAC1740, TNAC1800 and TNAC1924 are shown in Fig. 2.
Figure 2

PCR patterns of primer pair TNAC1204 (A), TNAC1137 (B), TNAC1329 (C), TNAC1331 (D), TNAC1737 (E), TNAC1740 (F), TNAC1800 (G) and TNAC1924 (H). Lane M indicates Marker DM2000. Lanes 1–10 in (A,H) are T. turgidum-Ae. comosa amphiploid, CS, CS-Ae. geniculata 1Mg addition, CS-Ae. comosa 2M–6M additions, CS-Ae. comosa 6M(6A) substitution and CS-Ae. comosa 7M addition, respectively.

PCR patterns of primer pair TNAC1204 (A), TNAC1137 (B), TNAC1329 (C), TNAC1331 (D), TNAC1737 (E), TNAC1740 (F), TNAC1800 (G) and TNAC1924 (H). Lane M indicates Marker DM2000. Lanes 1–10 in (A,H) are T. turgidum-Ae. comosa amphiploid, CS, CS-Ae. geniculata 1Mg addition, CS-Ae. comosa 2M–6M additions, CS-Ae. comosa 6M(6A) substitution and CS-Ae. comosa 7M addition, respectively.

FISH patterns of Ae. comosa chromosomes using oligonucleotides as probes

Chromosome specific molecular markers of wheat alien species are useful tools for screening, identifying and utilizing wheat-alien species germplasm. Our previous study found that the sequential double-color FISH and single-color FISH could be used to identify all chromosomes of Ae. uniaristata[16,17], Ae. mutica[13] and Hordeum chilense[18] simultaneously, as well as all 42 wheat chromosomes. Therefore, we suspected that this sequential FISH might be also useful to identify Ae. comosa chromosomes introduced into wheat. Subsequently, this FISH procedure was performed on mitotic metaphase chromosomes of the T. turgidum-Ae. comosa amphiploid and the CS-Ae. comosa 2M–7M additions. The results showed that all wheat and Ae. comosa chromosomes could be recognized simultaneously. The FISH patterns of CS-Ae. comosa 6M(6A) substitution and 7M addition are shown in Fig. 3.
Figure 3

FISH using Oligo-nucleotides as probes on the CS-Ae. comosa 6M(6A) substitution (A,B) and the 7M addition (C,D). (A,C) are double-color FISH patterns using Oligo-pTa535–1 (red) and Oligo-pSc119.2-1 (green) as probes; (B,D) are FISH patterns using (GAA)8 (yellow) as a probe after washing off the double-color FISH signals. Bar indicates 10 µm.

FISH using Oligo-nucleotides as probes on the CS-Ae. comosa 6M(6A) substitution (A,B) and the 7M addition (C,D). (A,C) are double-color FISH patterns using Oligo-pTa535–1 (red) and Oligo-pSc119.2-1 (green) as probes; (B,D) are FISH patterns using (GAA)8 (yellow) as a probe after washing off the double-color FISH signals. Bar indicates 10 µm. Double-color FISH showed that probes Oligo-pTa535-1 and Oligo-pSc119.2-1 mainly hybridized onto the terminal or subterminal regions of Ae. comosa chromosomes, while probe (GAA)8 mainly hybridized to centromeric or subtelomeric regions of the Ae. comosa chromosomes (Fig. 4). The satellited chromosome 1M had Oligo-pSc119.2-1 signals on terminal regions of long arms. Chromosome 2M had Oligo-pSc119.2-1 signals on terminal regions of long arms, and had Oligo-pTa535-1 signals on subterminal regions of long arm and terminal regions of the short arms. Chromosome 3M had Oligo-pTa535-1 signals on terminal regions of short arm. Chromosome 4M had Oligo-pTa535-1 signals on centromeric regions. Chromosome 5M had Oligo-pSc119.2-1 signals on both terminal regions of long and short arms. Chromosome 6M had both Oligo-pSc119.2-1 and Oligo-pTa535-1 signals on terminal regions of long arms, and had Oligo-pTa535-1 signals on terminal regions of short arms. Chromosome 7M had very strong Oligo-pSc119.2-1 signals on terminal regions of short arms. The FISH patterns of probe (GAA)8 also produced different signals on seven pairs of Ae. comosa chromosomes as shown in Fig. 4.
Figure 4

Standard FISH pattern of Ae. comosa chromosomes using Oligo-nucleotides as probes. Row (A) chromosomes before FISH; Row (B) double-color FISH patterns using Oligo-pTa535-1 (red) and Oligo-pSc119.2-1 (green) as probes; Row (C): FISH patterns using (GAA)8 (yellow) as probe after washing off the double-color FISH signals.

Standard FISH pattern of Ae. comosa chromosomes using Oligo-nucleotides as probes. Row (A) chromosomes before FISH; Row (B) double-color FISH patterns using Oligo-pTa535-1 (red) and Oligo-pSc119.2-1 (green) as probes; Row (C): FISH patterns using (GAA)8 (yellow) as probe after washing off the double-color FISH signals.

Spike and grain characters of wheat-Ae. comosa chromosome lines

Spike morphologies of the CS-Ae. comosa 2M–7M addition lines and the 6M(6A) substitution line all varied compared to that of CS (Fig. 5). Spikes of the CS-Ae. comosa 2M addition had short awns, and the lower inter-spikelet segments of the heads of CS-Ae. comosa 3M, 5M, 7M additions and the 6M(6A) substitution were more elongated compared to CS. The CS-Ae. comosa 6M addition line showed slightly elongated spikelets and overall longer spikes than CS. The CS-Ae. comosa 6M(6A) substitution showed shorter spikes and fewer spikelets compared to CS.
Figure 5

Spike and grain morphologies of wheat-Ae. comosa chromosome lines. Grain and spikes from left to right are CS, CS-Ae. comosa 2M–7M addition lines and the 6M(6A) substitution line. All the spikes and grain are collected from Jinan, Shandong Province.

Spike and grain morphologies of wheat-Ae. comosa chromosome lines. Grain and spikes from left to right are CS, CS-Ae. comosa 2M–7M addition lines and the 6M(6A) substitution line. All the spikes and grain are collected from Jinan, Shandong Province. Grain morphologies of the CS-Ae. comosa 4M, 6M, 7M addition lines and the 6M(6A) substitution line were similar to that of CS (Fig. 5), while the CS-Ae. comosa 2M and 3M additions showed slender grains compared to CS, and 5M addition showed slightly larger grains compared to CS. CS-Ae. comosa 2M (brown) and 4M (dark yellow) additions had darker seed coat colors than the control CS, while the CS-Ae. comosa 5M addition had a lighter seed coat color than the control CS.

Disease resistance tests of wheat-Ae. comosa chromosome lines

In this current research, wheat stripe rust, leaf rust, stem rust and powdery mildew resistance of CS, the CS-Ae. comosa 2M–7M addition lines and the 6M(6A) substitution line were tested. The results showed that all the material tested were moderately to highly susceptible to leaf rust and stem rust (Table 1). The CS-Ae. comosa 2M addition was nearly immune to stripe rust while CS and other CS-Ae. comosa chromosome lines tested were all highly susceptible to stripe rust (Table 1), suggesting that chromosome 2M of Ae. comosa carries stripe rust resistant gene(s). The CS-Ae. comosa 7M addition line was nearly immune to powdery mildew while CS and all other CS-Ae. comosa chromosome lines tested were highly susceptible to powdery mildew (Table 3), indicating that chromosome 7M of Ae. comosa carries powdery mildew resistant gene(s).
Table 3

Stripe rust, leaf rust, stem rust and powdery mildew infection types of CS-Ae.

GenotypeStripe rustLeaf rustStem rustPowdery mildew
CS-Ae. comosa 2M addition;334
CS-Ae. comosa 3M addition4444
CS-Ae. comosa 4M addition4343
CS-Ae. comosa 5M addition4444
CS-Ae. comosa 6M addition4344
CS-Ae. comosa 7M addition433;
CS-Ae. comosa 6M(6A) substitution4344
CS4444

comosa chromosome lines.; denotes high resistance, 3 and 4 rating denote susceptibility.

Stripe rust, leaf rust, stem rust and powdery mildew infection types of CS-Ae. comosa chromosome lines.; denotes high resistance, 3 and 4 rating denote susceptibility.

Agronomic trait investigation of wheat-Ae. comosa chromosome lines

Plant height, spike length, flag leaf length and width as well as other four agronomic traits of CS, the CS-Ae. comosa 2M–7M addition lines and the 6M(6A) substitution, were studied. The results showed that generally a detrimental effect occurred when different chromosome pairs of Ae. comosa were introduced into wheat. The introduction of chromosome 2M of Ae. comosa into CS appeared to reduce plant height (Fig. 6A) and also had a negative influence on flag leaf width, spikelet number/spike, grain number/30 spikes and thousand grain weight (Fig. 6D,F–H). Chromosome 3M of Ae. comosa introduced into CS showed a negative impact on flag leaf width, spikelet number/spike and grain number/30 spikes (Fig. 6D,F,G). Chromosome 4M of Ae. comosa introduced into CS appeared to reduce plant height (Fig. 6A) and also had a negative influence on flag leaf length, spikelet number/spike, grain number/30 spikes (Fig. 6C,F,G). The introduction of chromosome 5M of Ae. comosa into CS appeared to reduce plant height (Fig. 6A) and also had a negative impact on flag leaf width, tiller number/plant, spikelet number/spike and grain number/30 spikes (Fig. 6D–G). Chromosomes 6M and 7M of Ae. comosa introduced into CS both showed a negative influences on spikelet number/spike, grain number/30 spikes (Fig. 6F,G), while when a pair of wheat 6A chromosome was substituted by a pair of 6M chromosomes of Ae. comosa, a negative impact occurred on flag leaf width, tiller number/plant and grain number/30 spikes (Fig. 6D,E,G).
Figure 6

Agronomical traits investigation result of the material tested Data of tiller number from Jinan City were not obtained due to crop rotation. PH, SL, FLL, FLW, TNPP, SNPS, GNTS and TKW are the abbreviations of plant height, spike length, flag leaf length, flag leaf width, tiller number per plant, spikelet number per spike, grain number of thirty spikes and thousand kernel weight, respectively. 1 represents CS, 2–8 represents CS-Ae. comosa 2M–7M addition lines and 6M(6A) substitution line. *significant at P < 0.05 by comparing relative data to that of CS; **significant at P < 0.01 by comparing relative data to that of CS. Bar represents standard deviation.

Agronomical traits investigation result of the material tested Data of tiller number from Jinan City were not obtained due to crop rotation. PH, SL, FLL, FLW, TNPP, SNPS, GNTS and TKW are the abbreviations of plant height, spike length, flag leaf length, flag leaf width, tiller number per plant, spikelet number per spike, grain number of thirty spikes and thousand kernel weight, respectively. 1 represents CS, 2–8 represents CS-Ae. comosa 2M–7M addition lines and 6M(6A) substitution line. *significant at P < 0.05 by comparing relative data to that of CS; **significant at P < 0.01 by comparing relative data to that of CS. Bar represents standard deviation.

Discussion

Development of molecular and cytogenetic markers specific for Ae. comosa chromosomes and their utilization

Morphological studies[12,19,20], cytogenetic markers[13,21], biochemical markers[20,22] and molecular markers[13,14] have previously been used to determine chromosome homoeologous groups of alien-derived chromosomes in wheat backgrounds. All the methods mentioned above have been used in the identification of wheat-Ae. comosa germplasm[4,8-11]. Among these methods, molecular marker development is one of the easiest, quickest and cheapest approaches. However, the molecular markers specific for Ae. comosa chromosomes are currently limited in number. In this research, we developed 47 PLUG markers in order to identify the homoeologous group of each of the Ae. comosa chromosomes in six wheat-Ae. comosa addition lines and one substitution line. The results were consistent with the method[12] (mitosis combined with morphologies etc.) that Miller and Reader used (material identification result not published), indicating that both methods for determining the homoeology of chromosomes within the Triticeae were accurate. Therefore, the EST-based molecular markers utilized in the current study could be widely used in the future for screening and identifying wheat-Ae. comosa Robertsonian translocations. Tiwari et al. developed molecular markers specific for Ae. geniculata chromosome 5MgS, and concluded that these markers may be useful for monitoring introgression into wheat from Ae. comosa, Ae. geniculata and Ae. biuncialis due to the fact that these Aegilops species share a common M genome[23]. However, the sequence-specific amplified polymorphic markers developed for the M-genome chromosomes of Ae. comosa[24] seem not to completely support the previous conclusion. Furthermore, Molnár et al. found that some markers which were assigned to the M-genome chromosomes of Aegilops showed different chromosomal locations in the allopolyploid species[25]. In this research, primers TNAC1294 and TNAC1254 of homoeologous group 3 amplified the same polymorphic bands from wheat lines carrying the 3M and 5M chromosomes (Table 2). Moreover, primers TNAC1396, TNAC1496, TNAC1823, TNAC1888, TNAC1889, TNAC1902 and TNAC1884 were found to amplify polymorphic amplicons in M-genome chromosomes of Ae. comosa but could not generate polymorphisms for Mg-chromosomes of Ae. geniculata (Table 2). Possible explanations for this are, gene duplication[25] or chromosomal rearrangement[26] might have occurred to M chromosomes in the process of forming polyploids. These results also imply that careful validation need to be done before applying the PLUG markers developed herein to other M-chromosome containing species. Friebe et al. established the standard karyotype of Ae. comosa[27], however, the C-banding patterns of different subspecies of Ae. comosa differed markedly. A similar observation was reported by Teoh et al.[28]. Later, FISH markers of Ae. comosa chromosomes using SSR probes ((ACG)n and (GAA)n)[29] and repeated DNA probes (pSc119.2, Afa family and pTa71)[30] were developed. However, the FISH patterns of chromosomes 2M, 3M, 4M and 7M using pSc119.2 as a probe were different from those of this current research, and a similar phenomenon was also found by using (GAA)n as a probe. Recently, Kwiatek et al. established the standard FISH patterns of Ae. comosa chromosomes using probes pAs1, pSc119.2, 5S and 35S rDNA[31]. However, the FISH patterns of chromosomes 2M, 4M and 7M using pSc119.2 as a probe were different from those of our present research. These FISH pattern differences mentioned above might be due to different origins of the accessions of Ae. comosa. Therefore a standard FISH pattern needs to be established for each individual research study when different accessions of Ae. comosa are used. Even though the FISH pattern using Oligo-pTa535-1 as a probe has not been reported earlier, it had been found that on its own it could not be used to identify the Ae. comosa chromosomes (Fig. 4B). The FISH patterns using the combined probes Oligo-pTa535-1 and Oligo-pSc119.2-1, or (GAA)8 could be used to distinguish the individual chromosome of Ae. comosa used in this research.

Agronomical traits influences by introducing Ae. comosa chromosomes into wheat

Transferring alien chromosomes into wheat might lead to the change of disease resistance[13,14,32], plant height[14,32,33], leaf or spike morphology[14,32,34], thousand kernel weight or seed hardness[14,32,35,36], fertility[34,37] and quality[14,32,35,38]. In our current research, the introduction of chromosomes 2M to 7M into wheat not only affected the spike morphology (Fig. 5), but also affected fertility of the apical spikelet (Fig. 5), resistances (Table 3), thousand kernel weight or tiller number. (Fig. 6). Therefore, a comprehensive characterization needs to be done for each individual addition or substitution line before embarking on chromosome engineering activities with the intention of recombining that alien chromosome with wheat. CS-Ae. comosa 6M addition showed a longer but elongated spike compared to CS, however, the CS-Ae. comosa 6M(6A) substitution line showed a shorter and dense spike, indicating that (a) chromosome 6M of Ae. comosa might possess gene(s) that affect longer spike, a similar phenomenon found in Agropyron cristatum[39], (b) chromosome 6A of wheat might possess a compactness gene(s), a conclusion supported by ref.[40], and (c) chromosome 6A of wheat may carry genes that affect spike length, supported by findings of ref.[41]. Based on these conclusions, we suggest the use of wheat-alien species chromosome introgression lines, including addition, substitution, translocation or deletions, to locate important functional genes on wheat or alien species chromosomes. Furthermore, the possibility exists that future researchers might narrow down the target region or even clone the genes that affect compactness or spike length from chromosome 6A using CS deletion lines and the reference sequences of CS.

Ae. comosa chromosomes possess stripe rust and powdery mildew resistance new genes

Riley et al. found that chromosome 2M of Ae. comosa introduced into wheat improved stripe rust resistance[42]. Later, using induced homeologous pairing and crossing over, they transferred stripe rust resistance gene Yr8[2]and stem rust resistance gene Sr34[4,5] from Ae. comosa into wheat. In our current research, the CS-Ae. comosa 2M addition line was nearly immune to stripe rust but this may not be attributable to gene Yr8 because this gene has already lost its resistance in China[43]. Therefore, there might be another stripe rust resistance gene(s) on the chromosome 2M of Ae. comosa which needs further research into pathotype reactions. So far, a total of 60 powdery mildew resistance genes have been designated. Among them, 19 originate from wheat’s alien relatives, such as Pm7, Pm8, Pm17 and Pm20 from Secale cereale, Pm12, Pm32 and Pm53 from Ae. speltoides, Pm13 from Ae. longissima, Pm21 and Pm55 from Dasypyrum villosum, Pm19, Pm34, Pm35 and Pm58 from Ae. tauschii, Pm29 from Ae. ovata, Pm40 and Pm43 from Thinopyrum intermedium, Pm51 from Th. ponticum, and finally Pm57 from Ae. searsii. However, no powdery mildew resistance genes have so far been reported to have been transferred from Ae. comosa to wheat. In this research, we found that the CS-Ae. comosa 7M addition line was nearly immune to powdery mildew while wheat control CS was highly susceptible, indicating that chromosome 7M of Ae. comosa possesses a potentially new powdery mildew resistance gene(s). Both CS-Ae. comosa 2M and 7M additions are worthy of further study for production of chromosome translocations and then subsequent incorporation of their disease resistance into wheat breeding programs in China.

Conclusion

In conclusion, we characterized, identified and evaluated a set of wheat-Ae. comosa chromosome lines, including 2M–7M addition lines and a 6M(6A) substitution line, using the newly developed Ae. comosa chromosome specific molecular markers and cytogenetic markers, disease resistance tests and agronomical traits investigations. Chromosomes 2M to 7M of Ae. comosa are stripe rust and powdery mildew resistance source for wheat breeding, respectively. However, the selection of plants with relatively negative effects should be avoided when inducing wheat-A. comosa chromosome translocations using chromosome engineering procedures.

Methods

Plant materials

Triticum aestivum cv. Jinan17 (JN17) and Jimai22 (JM22) cultivars were developed at the Crop Research Institute at Jinan, China. T. aestivum cv. Chinese Spring (CS) was provided by Prof. Zujun Yang, School of Life Science and Technology, University of Electronic Science and Technology of China, Chengdu. Ae. comosa (TA1967), a T. turgidum-Ae. comosa amphiploid (TA3402), and CS-Ae. geniculata 1Mg, 2Mg and 7Mg addition lines (TA7655-TA7661) were provided by Mr. J. Raupp, Wheat Genetic and Genomic Resources Center, Kansas State University, USA. Six CS-Ae. comosa addition lines and one substitution line, tentatively named as wheat-Ae. comosa 2M–7M additions and a 6M(6A) substitution, were provided by Prof. S.M. Reader, John Innes Centre, UK.

Disease resistance testing

Stripe rust, leaf rust, stem rust and powdery mildew resistance reactions of the suspected CS-Ae. comosa 2M–7M addition lines and the 6M(6A) substitution line and CS were tested. CS is highly susceptible to all four pathogens, hence the disease response scoring did not begin until CS was fully infected. Pathogenic race selection and disease response rating scale of four diseases were all according to ref.[14]. The pathogen inoculation methods of stripe rust, leaf rust and powdery mildew were according to ref.[44], while stem rust inoculation was according to ref.[45]. Stripe rust resistance was determined on adult plants using isolates of races CY32, CY33 and Su-4 in the experimental farmland of School of Life Science and Technology, University of Electronic Science and Technology of China. Stem rust resistance was determined on seedlings using mixed isolates of 34MKGQM and 21C3CTHSM in the greenhouse of College of Plant Protection, Shenyang Agricultural University. Leaf rust resistance was determined on seedlings using mixed leaf rust isolates of THTT, PHTT, THKS, THTS and THKT in the greenhouse of College of Plant Protection, Agricultural University of Hebei. Powdery mildew resistance was determined on both seedlings (in greenhouse) and adult plants (field) following inoculation with mixed powdery mildew races collected from four different cities including Jinan, Linyi, Dezhou and Heze of Shandong Province.

Agronomical trait investigation

Thirty individual plants of the suspected CS-Ae. comosa 2M–7M additions, 6M(6A) substitution and CS were planted in farmland at four different cities including Jinan, Dezhou, Heze and Linyi of Shandong Province on October 25, 2015. The experimental design, data collection of plant height, spike length, flag leaf length and width, tiller number, spikelet number, grain number per 30 spikes and thousand-kernel weight were according to ref.[14].

Data processing and qualification

Data on the number of tillers per plant from Jinan was not obtainable. Data processing and t-test was performed using Microsoft Excel 2010. The data from four sites (tiller number, across the three cities) were completely consistent with each other, and the trait variation when compared to the background genotype CS will be regarded as attributable to the presence of the alien chromatin. Alternatively, it might be considered as a result of interaction of genotype and environments. In this research, only the former will be discussed.

DNA isolation and PLUG-PCR

Total genomic DNA was prepared from young leaves using the SDS protocol[46]. A total of 526 PLUG primer pairs were synthesized according to refs[47,48], of which 57, 67, 85, 71, 78, 59 and 109 pairs belonged to chromosome homoeologous groups 1 to 7, respectively. All primer pairs were synthesized by Chengdu Ruixin Biological Technology Co., Ltd., and PCR protocol followed that according to refs[47,48]. In order to obtain high levels of polymorphism, the PCR products were digested with the 4-base cutter enzymes HaeIII and TaqI according to refs[47,48] and were separated on 2% agarose gels.

Fluorescence in situ hybridization (FISH) analysis

Root tip treatments and chromosome slide preparations were according to ref.[49]. Probes Oligo-pTa535-1, Oligo-pSc119.2-1 and (GAA)8 were synthesized by Chengdu Ruixin Biological Technology Co., Ltd. Probe sequences, the fluorochromes for probe labeling, FISH protocols and labeled DNA signal detection methods were according to refs[50,51]. FISH using (GAA)8 as a probe could be used to identify all 42 wheat chromosomes except 1A, 3D, 4D, 5D and 6D, as described by ref.[50]. FISH using Oligo-pSc119.2-1 and Oligo-pTa535-1 probes could identify all 42 wheat chromosomes simultaneously as described by ref.[51]. Photomicrographs of FISH chromosomes were taken using an Olympus BX-51 microscope. Supplementary figures
  24 in total

1.  Localization of anchor loci representing five hundred annotated rice genes to wheat chromosomes using PLUG markers.

Authors:  Goro Ishikawa; Toshiki Nakamura; Taizo Ashida; Mika Saito; Shuhei Nasuda; Takashi R Endo; Jianzhong Wu; Takashi Matsumoto
Journal:  Theor Appl Genet       Date:  2008-11-01       Impact factor: 5.699

2.  A guide to the homoeology of chromosomes within the Triticeae.

Authors:  T E Miller; S M Reader
Journal:  Theor Appl Genet       Date:  1987-06       Impact factor: 5.699

3.  Characterization of chromosome-specific S-SAP markers and their use in studying genetic diversity in Aegilops species.

Authors:  Ervin D Nagy; István Molnár; Annamária Schneider; Géza Kovács; Márta Molnár-Láng
Journal:  Genome       Date:  2006-04       Impact factor: 2.166

4.  Introgression of Agropyron cristatum 6P chromosome segment into common wheat for enhanced thousand-grain weight and spike length.

Authors:  Jing Zhang; Jinpeng Zhang; Weihua Liu; Haiming Han; Yuqing Lu; Xinming Yang; Xiuquan Li; Lihui Li
Journal:  Theor Appl Genet       Date:  2015-06-21       Impact factor: 5.699

5.  Molecular cytogenetic identification of a novel dwarf wheat line with introgressed Thinopyrum ponticum chromatin.

Authors:  Guiling Chen; Qi Zheng; Yinguang Bao; Shubing Liu; Honggang Wang; Xingfeng Li
Journal:  J Biosci       Date:  2012-03       Impact factor: 1.826

6.  Characterization of wheat-Secale africanum chromosome 5R(a) derivatives carrying Secale specific genes for grain hardness.

Authors:  Guangrong Li; Dan Gao; Shixiao La; Hongjin Wang; Jianbo Li; Weilin He; Ennian Yang; Zujun Yang
Journal:  Planta       Date:  2016-02-16       Impact factor: 4.116

7.  Molecular and Cytogenetic Characterization of a Powdery Mildew-Resistant Wheat-Aegilops mutica Partial Amphiploid and Addition Line.

Authors:  Cheng Liu; Guang-Rong Li; Wen-Ping Gong; Gen-Ying Li; Ran Han; Hao-Sheng Li; Jian-Min Song; Ai-Feng Liu; Xin-You Cao; Xiu-Sheng Chu; Zu-Jun Yang; Cheng-Yan Huang; Zhen-Dong Zhao; Jian-Jun Liu
Journal:  Cytogenet Genome Res       Date:  2016-02-03       Impact factor: 1.636

8.  Chromosome isolation by flow sorting in Aegilops umbellulata and Ae. comosa and their allotetraploid hybrids Ae. biuncialis and Ae. geniculata.

Authors:  István Molnár; Marie Kubaláková; Hana Šimková; András Cseh; Márta Molnár-Láng; Jaroslav Doležel
Journal:  PLoS One       Date:  2011-11-23       Impact factor: 3.240

9.  Cytogenetic analysis of Aegilops chromosomes, potentially usable in triticale (X Triticosecale Witt.) breeding.

Authors:  M Kwiatek; H Wiśniewska; B Apolinarska
Journal:  J Appl Genet       Date:  2013-02-02       Impact factor: 3.240

10.  Agronomic Traits and Molecular Marker Identification of Wheat-Aegilops caudata Addition Lines.

Authors:  Wenping Gong; Ran Han; Haosheng Li; Jianmin Song; Hongfei Yan; Genying Li; Aifeng Liu; Xinyou Cao; Jun Guo; Shengnan Zhai; Dungong Cheng; Zhendong Zhao; Cheng Liu; Jianjun Liu
Journal:  Front Plant Sci       Date:  2017-10-12       Impact factor: 5.753

View more
  2 in total

1.  Mining of Wheat Pm2 Alleles for Goal-Oriented Marker-Assisted Breeding.

Authors:  Ziyang Yu; Luning Xiao; Fuyu Su; Wei Liu; Fuyi Luo; Ran Han; Yanjun Mu; Wenjing Zhang; Liru Wu; Xiao Liang; Nina Sun; Linzhi Li; Pengtao Ma
Journal:  Front Plant Sci       Date:  2022-05-12       Impact factor: 6.627

2.  Identification of 5P Chromosomes in Wheat-Agropyron cristatum Addition Line and Analysis of Its Effect on Homologous Pairing of Wheat Chromosomes.

Authors:  Cuili Pan; Qingfeng Li; Haiming Han; Jinpeng Zhang; Shenghui Zhou; Xinming Yang; Xiuquan Li; Lihui Li; Weihua Liu
Journal:  Front Plant Sci       Date:  2022-02-24       Impact factor: 5.753

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.