| Literature DB >> 29075275 |
Wenping Gong1, Ran Han1, Haosheng Li1, Jianmin Song1, Hongfei Yan2, Genying Li1,3, Aifeng Liu1, Xinyou Cao1,3, Jun Guo1, Shengnan Zhai1, Dungong Cheng1, Zhendong Zhao1, Cheng Liu1,3, Jianjun Liu1.
Abstract
Aegilops caudata is an important gene source for wheat breeding. Intensive evaluation of its utilization value is an essential first step prior to its application in breeding. In this research, the agronomical and quality traits of Triticum aestivum-Ae. caudata additions B-G (homoeologous groups not identified) were analyzed and evaluated. Disease resistance tests showed that chromosome D of Ae. caudata might possess leaf rust resistance, and chromosome E might carry stem rust and powdery mildew resistance genes. Investigations into agronomical traits suggested that the introduction of the Ae. caudata chromosome in addition line F could reduce plant height. Grain quality tests showed that the introduction of chromosomes E or F into wheat could increase its protein and wet gluten content. Therefore, wheat-Ae. caudata additions D-F are all potentially useful candidates for chromosome engineering activities to create useful wheat-alien chromosome introgressions. A total of 55 EST-based molecular markers were developed and then used to identify the chromosome homoeologous group of each of the Ae. caudata B-G chromosomes. Marker analysis indicated that the Ae. caudata chromosomes in addition lines B to G were structurally altered, therefore, a large population combined with intensive screening pressure should be taken into consideration when inducing and screening for wheat-Ae. caudata compensating translocations. Marker data also indicated that the Ae. caudata chromosomes in addition lines C-F were 5C, 6C, 7C, and 3C, respectively, while the homoeologous group of chromosomes B and G of Ae. caudata are as yet undetermined and need further research.Entities:
Keywords: Aegilops caudata; agronomic traits; chromosome rearrangement; disease resistance; molecular marker
Year: 2017 PMID: 29075275 PMCID: PMC5644244 DOI: 10.3389/fpls.2017.01743
Source DB: PubMed Journal: Front Plant Sci ISSN: 1664-462X Impact factor: 5.753
Stripe rust, leaf rust, stem rust and powdery mildew resistances of ALCD-Ae. caudata additions.
| 0; | 0; | 0; | 0 | ||
| ALCD | Alcedo ( | 0; | 3 | 3 | 4 |
| ALCD- | 0; 1 | 3 | 3 | 4 | |
| ALCD- | 0; 1 | 4 | 3 | 3 | |
| ALCD- | 1 | 0; 1 | 3 | 3 | |
| ALCD- | 1 | 3 | 1 | 0 | |
| ALCD- | 1 | 3 | 4 | 4 | |
| ALCD- | 1 | 4 | 4 | 4 | |
| CS | Chinese Spring | 4 | 4 | 4 | 4 |
| Wheat variety Mianyang11 | 4 | 4 | 4 | 4 | |
| Wheat variety Mianyang15 | 4 | 4 | 4 | 4 |
All the four wheat diseases listed in this table are scored using a 0–4 scale, whereas 0 indicates immune,; means nearly immune, 1 indicates highly resistant, 3 indicates moderately susceptible, and 4 means highly susceptible. 0; 1 means that the resistance level of some plants was nearly immune, and some are highly resistant. The stipe rust and powdery mildew resistance levels of material tested at the seedling and adult plant stages are completely same, therefore, only one stipe rust and powdery mildew resistance level of each material were listed herein.
Figure 1Agronomical traits investigation result of the material tested. Spikelet number, grain number per 30 spikes and thousand-kernel weight data of Ji'nan are not obtained due to crop rotation.1–7 represent T. aestivum cv. Alcedo, Alcedo-Ae. caudata B to G addition lines. PH (A), SL (B), SNPS (C), FLL (D), FLW (E), TNPP (F), GNTS (G), and TKW (H) are the abbreviations of Plant Height, Spike Length, Spikelet Number Per Spike, Flag Leaf Length, Flag Leaf Width, Tiller Number Per Plant, Grain Number of 30 Spikes and Thousand Kernel Weight, respectively. *significant at P < 0.05 by t-test as compared to relative data of ALCD; **significant at P < 0.01 by t-test as compared to relative data of ALCD. Bar represents standard deviation.
Figure 2Protein and wet gluten contents of the material tested. Pro (A), Protein; WGC (B), Wet Gluten Content; 1–7 represent T. aestivum cv. Alcedo, Alcedo-Ae. caudata B to G addition lines. *significant at P < 0.05 by t-test as compared to relative data of ALCD; **significant at P < 0.01 by t-test as compared to relative data of ALCD. Bar represents standard deviation.
Primers screened and relative information of molecular markers obtained.
| EST-STS | 410 | 77 | 18.7 | 15 | 3.6 |
| EST-SSR | 258 | 46 | 17.8 | 13 | 5.0 |
| COS | 107 | 21 | 19.6 | 4 | 3.7 |
| PLUG | 185 | 64 | 34.6 | 23 | 12.4 |
Indicate additional DNA bands were amplified by comparing to wheat controls.
Figure 3PCR patterns of primer TNAC1497 (A,B) and TNAC1605 (C,D). Arrows indicate polymorphic bands; Panels A,B are from agarose gel, while C,D are from polyacrylamide gel. TA1908 represents Ae. caudata, while ALCD, CS, MY11, and MY15 mean T. aestivum cv. Alcedo, cv. Chinese Spring, cv. Mianyang11 and cv. Miyang15, respectively. TA10543 means T. turgidum, TA3598-TA3563 mean ALCD-Ae. caudata additions B–G, respectively.
Markers specific for Ae. caudata chromosomes developed by the current study.
| 1 | BF291891 | EST-STS | F:CATGGACATCGACAAGATCG | 1DS5-0.70-1.00 | B | – | 750 |
| 2 | MAG2282 | EST-SSR | F: ATGCCACTGGGGAGACAGTATG | 1DS | B | – | 350 |
| 3 | BE446243 | EST-STS | F:CAAGGAGTGCAAGAAGCACA R:GTCGCCTCTTGCTTAAATGC | C-2DS1-0.33 | B | – | 830 |
| 4 | BCD348 | EST-SSR | F: TTCACCGCCAAACACAGAGC | 2AS | B | – | 400 |
| 5 | BE499186 | EST-STS | F: CTGCTGCTCCTCCTGCTC | 3DL3-0.81-1.00 | B | – | 600 |
| 6 | MAG1242 | EST-SSR | F: GCCACCGACTGTTAGGTTTCACTC | 5B | B | – | 400 |
| 7 | BE606912 | EST-SSR | F:CTGCAAAGACACCCAACAGA R:TCATCATGCACCATCAGTCA | 2BS3-0.84-1.00 | C | – | 850 |
| 8 | TNAC1497 | TANC | F:ATCAAACCTGACGGTGTTCAG R:CATGCAGACTACAGGTCCAGA | 5AS1-0.40-0.75 5BS4-0.43-0.56 5DS4-0.22-0.63 | C | – | 900 |
| 9 | TNAC1605* | TNAC | F:TTGCCCTTGTTGTGAAGAATC R:TGTGCCATAGGCTCTCTTTGT | 5AL12-0.35-0.57 5BL8-0.52-0.75 5DL1-0.60-0.69 | C | – | 1,500 |
| 10 | TNAC1559 | TNAC | F:AAACAAGGCCCTGAAACACTT R:CATTGTCAGGCTATGGGACAT | 5AL10-0.57-0.78 5BL9-0.76-0.79 5DL5-0.76-1.00 | C | 400 | |
| 11 | MAG1426 | EST-SSR | F: GCGAGTTTTCGTAGCAAAGG | 5B | C | – | 300 |
| 12 | BE494952 | EST-STS | F: GGAAGGATCCGACAACAAAA | 5BS6-0.81-1.00 | C, D | 500 | |
| 13 | CDO457 | EST-SSR | F: CCTTCTTTTCGCAGCCATATCG | 5AL | C, D | – | 350 |
| 14 | TNAC1002 | TNAC | F:ATGTTGGAAGGATTGTCATCG R:ATCCTTAAAGGTGCGGCCATA | unknown | D | – | 250 |
| 15 | BE586140 | EST-STS | F: GATCCTCGTGATGCTGATGA | 1DS5-0.70-1.00 | D | 350 | |
| 16 | TNAC1178 | TNAC | F:TGATACCGAGGCTATCCACAT R:ACATGAACAAGGATCATGCTG | C-2AS-0.78 2BS11-0.27-0.53 2DS1-0.33-0.41 | D | 400 | |
| 17 | TNAC1204 | TNAC | F:GAGAGGAATGCGTGAAGTTTG R:AGACCATCTTTCCGGTCTTTG | 2AL4-0.27-0.77 2BL7-0.50-0.58 2DL10-0.49-0.58 | D | 260 | |
| 18 | BF293305 | EST-STS | F: GGCAATCATTATGGATGCTG | 5BS6-0.81-1.00 | D | – | 260 |
| 19 | CDO1326 | EST-SSR | F:CCGTAACAAGCAACATAAAGGGTC | 5AL | D | – | 280 |
| 20 | COS96 | COS | F:TGAGAAGCTTGAGGAGTTGG | 5AS1-0.40-0.75 5BS4-0.43-0.56 | D | – | 520 |
| 21 | TNAC1688 | TNAC | F:TGAAGTGTCAGTGCCCTTCTT | 6D | D | – | 770 |
| 22 | TNAC1719 | TNAC | F:TCATAGCACATGCAGCAACA | 6B | D | – | 500 |
| 23 | TNAC1722 | TNAC | F:CCAAGGTTATGATCCTTTCCA | 6B | D | – | 480 |
| 24 | TNAC1735 | TNAC | F:CGAATCTGTCAGGTGCAACA | 6B 6D | D | – | 1,400 |
| 25 | TNAC1739 | TNAC | F:ACATCGAGAAGATCGAGTTGC | 6B 6D | D | – | 1,000 |
| 26 | TNAC1728 | TNAC | F:AAGGCGCTCACCCTTCTC | 6B 6D | D | 1,100 | |
| 27 | TNAC1673 | TNAC | F:TCAGGTGGTACGTCGTCTTGT | 6D | D | 320 | |
| 28 | TNAC1679 | TNAC | F:TATTGGCTCAACCAACCATTC | 6AS5-0.65-1.00 6BS-Sat 6DS4-0.79-0.99 | D | 900 | |
| 29 | TNAC1721 | TNAC | F:TCCTGTTCTCGTTCCTAGGTG | 6B | D | 250 | |
| 30 | TNAC1731 | TNAC | F:TGTTGCTTTCAGAGCGAATTT | 6B | D | 1,400 | |
| 31 | BE500714 | EST-STS | F: GTGTCTGTTGGACCTGCAAA | C-1DS3-0.48 | E | – | 710 |
| 32 | BE637610 | EST-STS | F: TAGCACCCAAGGGAAGAAGA | C-1DS3-0.48 | E | 450 | |
| 33 | COS41 | COS | F:AAGGGGTTCATGGATAAAGG | 2AL1-0.85-1.00 2BL6-0.89-1.00 2DL9-0.76-1.00 | E | – | 400 |
| 34 | TNAC1812 | TNAC | F:ACTTCGCTTGGTCTCCTCAAT | 7AL5-0.63-0.71 7BL7-0.63-0.78 7DL5-0.30-0.61 | E | 920 | |
| 35 | TNAC1782 | TNAC | F:TCACTGAACAGCCTAGACATGG | 7AS2-0.73-0.83 7BS2-0.27-1.00 7DS4-0.73-1.00 | E | 400 | |
| 36 | MAG3047 | EST-SSR | F: CCACGCCAACAAGAGATTTT | 7BL | E | – | 400 |
| 37 | TNAC1140 | TNAC | F:TCCCAGAAATTACAAGGCTCA | 2AL3-0.77-1.00 2BL6-0.89-1.00 2DL6-0.94-1.00 | F | 600 | |
| 38 | COS38 | COS | F:ATCAACAAGATCTTCGACGG | 2BL4-0.50-0.89 2DL9-0.76-1.00 C-2AL1-0.85 | F | – | 350 |
| 39 | TNAC1296 | TNAC | F:GCATCCTGTCCCTCATCAC | 3AS4-0.45-1.00 3BS9-0.57-0.78 3DS4-0.59-1.00 | F | – | 2,200 |
| 40 | TNAC1359 | TNAC | F:GTAAATAGCGCCATCTGCGTA | 3AL3-0.42-0.61 3BL3-0.41-0.50 3DL1-0.23-0.81 | F | – | 1,200 |
| 41 | TNAC1367 | TNAC | F:CCTCAACATCTCCAAGGATCA | 3AL5-0.78-0.85 3BL7-0.63-0.81 3DL1-0.23-0.81 | F | – | 950 |
| 42 | BE442801 | EST-STS | F: CCTTTATGCAGCGAGTGTGA | 3BS8-0.78-1.00 | F | 320 | |
| 43 | TNAC1294 | TNAC | F:CGGAAACTTTAGCCTTCTGCT | 3AS4-0.45-1.00 3BS9-0.57-0.78 3DS4-0.59-1.00 | F | 750 | |
| 44 | MAG620 | EST-SSR | F: TAGTTGCATGGTCGCTTCTG | 3A | F | – | 220 |
| 45 | MAG905 | EST-SSR | F: ATGTGAATGGAAGGTCGGAG | 3AL | F | – | 350 |
| 46 | MAG501 | EST-SSR | F: CAGCACCAACATCAGATTGC | 3DS | F | – | 220 |
| 47 | MAG500 | EST-SSR | F: CAGCACCAACATCAGATTGC | 3DS | F | – | 270 |
| 48 | BE637804 | EST-STS | F:CGCAGTTGCAGAAATTGGTA | 1BL3-0.85-1.00 | G | – | 350 |
| 49 | BE426818 | EST-STS | F:ATGGGGATTCCAAGATAGGG | 2BL6-0.89-1.00 | G | 750 | |
| 50 | COS47 | COS | F:TGACGAAGAAGATCGAAAGG | 2AL1-0.85-1.00 2BL6-0.89-1.00 2DL9-0.76-1.00 | G | – | 800 |
| 51 | BE406551 | EST-STS | F: TGCTTCCGCAACTACATCAG | 3DL3-0.81-1.00 | G | – | 520 |
| 52 | BE403428 | EST-STS | F: ACTGTGATCCCCGACAGGTA | 3DL3-0.81-1.00 | G | 150; 250 | |
| 53 | MAG4194 | EST-SSR | F: CATCCACATCCAACAGCAAC | 3AL | G | – | 400 |
| 54 | BE445831 | EST-STS | F: GTGCTTCAACTTCCCAAAGC | 4BS1-0.81-1.00 | G | – | 680 |
| 55 | MAG1682 | EST-SSR | F: CGAATGCCAAGCTGTTCCCT | 4BL | G | – | 260 |
PCR product separated on a native polyacrylamide gel. –,no restriction enzyme used.
the primer pairs were newly developed.
Figure 4Schematic patterns of Ae. caudata chromosome rearrangement compared to wheat chromosomes as a reference revealed by PLUG markers physically mapped. Ae. caudata chromosomes were marked as B, C, D, E, F and G. W means wheat, W1–W7 represents wheat chromosome group 1–7, respectively. Define the lengths from centromere to both chromosome ends are 1, the values shown on the left of the chromosomes are fragment length (FL).