Literature DB >> 30856220

Specific clones of Trichomonas tenax are associated with periodontitis.

Sarah Benabdelkader¹, Julien Andreani¹, Alexis Gillet², Elodie Terrer^1,2, Marion Pignoly², Herve Chaudet¹, Gerard Aboudharam^1,2, Bernard La Scola¹.

Abstract

Trichomonas tenax, an anaerobic protist difficult to cultivate with an unreliable molecular identification, has been suspected of involvement in periodontitis, a multifactorial inflammatory dental disease affecting the soft tissue and bone of periodontium. A cohort of 106 periodontitis patients classified by stages of severity and 85 healthy adult control patients was constituted. An efficient culture protocol, a new identification tool by real-time qPCR of T. tenax and a Multi-Locus Sequence Typing system (MLST) based on T. tenax NIH4 reference strain were created. Fifty-three strains of Trichomonas sp. were obtained from periodontal samples. 37/106 (34.90%) T. tenax from patients with periodontitis and 16/85 (18.80%°) T. tenax from control patients were detected by culture (p = 0.018). Sixty of the 191 samples were tested positive for T. tenax by qPCR, 24/85 (28%) controls and 36/106 (34%) periodontitis patients (p = 0.089). By combining both results, 45/106 (42.5%) patients were positive by culture and/or PCR, as compared to 24/85 (28.2%) controls (p = 0.042). A link was established between the carriage in patients of Trichomonas tenax and the severity of the disease. Genotyping demonstrates the presence of strain diversity with three major different clusters and a relation between disease strains and the periodontitis severity (p<0.05). More frequently detected in periodontal cases, T. tenax is likely to be related to the onset or/and evolution of periodontal diseases.

Entities: CellLine Chemical Disease Gene Species

Mesh：

Substances：
Protozoan Proteins

Year: 2019 PMID： 30856220 PMCID： PMC6411126 DOI： 10.1371/journal.pone.0213338

Source DB: PubMed Journal: PLoS One ISSN： 1932-6203 Impact factor: 3.240

Introduction

Periodontal disease is a widespread oral disease affecting adults and younger people, characterized by an inflammatory reaction that affects periodontium tissue [1]. A new classification published in 2018 based on description (localized or generalized), severity and complexity of management divides periodontitis into 4 stages, including initial periodontitis (I), moderate periodontitis (II), severe periodontitis with potential for additional tooth loss (III) and advanced periodontitis with extensive tooth loss and potential for loss of dentition (IV) [2]. According to this classification, periodontitis is also graded in 3 levels estimated with direct or indirect evidence of progression rate: slow (A), moderate (B) and rapid (C). Periodontal disease is characterized by receding gums, alveolar bone destruction, loss of dental junctions associated with the apparition of periodontal pockets, and in some forms, dental calculus deposits. This promotes the establishment of an anaerobic microenvironment that allows the growth of anaerobic microorganisms [3]. The immunological process initiates the migration of microorganisms into tissues and disrupts the immune response, causing the periodontium to resorb [4,5]. Some host risk factors have now been clearly identified, including smoking [6] and diabetes mellitus [7], but other genetic factors require further study [8]. The human oral cavity contains an abundant and polymorphic microbiota. A set of bacterial complexes living in subgingival plaque has been identified by Socransky et al; with the initial establishment of Streptococcus spp. and their disappearance, multiple complexes defined by green purple or yellow colors have been described but only the orange and red complexes have been suspected of being associated with the development of periodontitis [3]. Metagenomic studies confirm the association of certain bacterial species found in the orange complex, such as Prevotella intermedia, Prevotella nigrescens and Fusobacterium nucleatum [9,10]. But also the strong association of the disease with the three bacteria described in the red complex: Pophyromonas gingivalis, Tannerella forsythia and Treponema denticola are also found in the periodontal pockets by metagenomic recent studies[11,12] and new species involved have recently been identified [13]. Nevertheless, the “red complex” theory remains debatable due to its isolation in healthy controls (30%, 3/10) [14]. An increase in lytic phages in pathological situations also disturbs the periodontal-associated bacteria present [15]. Similarly, meta-transcriptomics analysis showed that the transcription of bacterial virulence factors increased in patients with periodontitis compared to healthy individuals [16]. Viral etiology has also been suggested as being involved in the development of periodontitis, and different viruses have been involved including Herpesviruses (HSV-1), Cytomegalovirus (CMV) and Epstein-Barr virus (EBV) [17]. Since the 1980s, the implication of eukaryotes in periodontal disease has also been proposed [18], such as the protists Trichomonas tenax and Entamoeba gingivalis [19-21] and yeasts, such as Candida sp. [22]. However, until now, studies focusing on the association between protists and periodontal disease did not use groups of healthy controls to differentiate between abnormal proliferation and natural colonization [20]. Like its neighboring species, Trichomonas vaginalis, the vaginitis-inducing pathogen, T. tenax belongs to the Parabasalia phylum and to the Trichomonadidae family [23]. Trichomonas tenax can ingest bacteria and various particles by phagocytosis necessary for their development[24]. Initially identified as an harmless commensal [18], then known as a zoonotic parasite [25], this microorganism was detected in the periodontal pockets using mostly optical microscopy [26,27], with an occurrence in patients ranging from 0 to 94.1% depending on the country and the detection procedure [21]. T. tenax has occasionally been isolated in cases of the salivary glands, lymph nodes or respiratory tract infections [28][29][30]. Recently, T. tenax was found to be significantly more prevalent in patients with Down syndrome combined with periodontal lesions (14/52), using 18S rRNA gene PCR in comparison to control patients (5/52), with a non-significant difference in plaque indexes between the two groups [31]. In this cohort study, we sought to estimate the prevalence of T. tenax and establish a potential link with the periodontitis severity. We investigated the presence of T. tenax in periodontitis as compared to the healthy controls using culture and quantitative molecular detection systems. We also used a genome-based system of strain typing to investigate the possibility that a clone or a group of clones of T. tenax with particular pathogenicity are involved in periodontitis.

Materials and methods

Clinical sample collection and treatment

This study was carried out in accordance with the recommendations and approved by the clinical research ethics committee, IFR 48, Aix-Marseille University (protocol N° 2016–011). All subjects gave a written informed consent in accordance with the Declaration of Helsinki. One hundred and ninety-one adults were prospectively enrolled in this cohort, 106 adult patients with periodontitis and 85 healthy adult control patients, (). The study took place in the Odontology Department of the Hospital La Timone, Marseille, France, between January 2015 and June 2016. The 106 patients with periodontitis could be separated in three classes of severity: 19 patients with mild periodontitis (M), 27 with moderate periodontitis (Mo) and 60 with severe periodontitis (S) according to a previously reported scale using various criteria evaluation: size of the probing depth and the attachment loss for each patient [32]. Smoking status was also collected (. Subgingival dental plaque samples were collected from multiple periodontal pocket and combined into a single tube per patient for the group test and the same method was used for healthy gingival sites in the control group. The sample was collected using a sterile Gracey curette (HuFriedy, Rotterdam, Netherlands) and transported into 1 mL of transport medium (C-top Ae-Ana, Eurobio, France). The samples were analyzed according to the detailed protocol in .

Isolation of Trichomonas tenax

Twelve-and-a-half cm2 vented flasks (Corning, NY, USA) containing 10 mL of liquid ATCC: 1171 TYGM-9 medium without rice starch were used to inoculate 250 μL of the clinical samples. The medium was supplemented with 100 Units/mL of Penicillin-Streptomycin Gibco (ThermoFisher, MA, USA) and 20 μg/mL Voriconazole (Sigma-Aldrich, United-States) to retard the bacterial and fungi growth that may interfere with the T. tenax development. Flasks were then incubated under anaerobic conditions using Anaerogen generators (ThermoFisher, MA, USA) at 35°C. Growth was observed by optical microscopy examination. For the strains cryopreservation, cultures were centrifuged at 720 x g for 10 minutes. The final pellet was suspended in 1 mL of TYGM9 medium containing 1% of di-methyl-sulfoxide (DMSO) and placed in a Nunc cryotube, maintained at -80°C for between 15 and 20 hours before being placed inside a -150°C freezer.

Molecular identification and typing of isolates

Primer design

Based on the analysis of Malik et al.[33], we designed specific primers in the 3,048 bp sequence of the RNA polymerase II rpb1 gene available on the NCBI website (accession number: HM016234.1 for T. tenax strain NIH4). Primers were designed using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) with standard parameters ().

Genome sequencing of Trichomonas tenax

Briefly, 15 vented Corning 75cm2 (NY, USA) flasks containing LYI medium of T. tenax NIH4 reference strain (ATCC number 30207) were pelleted at 2000 g for 15 minutes, rinsed twice with the same centrifugation parameters in Page’s amoeba Saline before final re-suspension in 1 mL of phosphate buffered saline. Concentrated cells were placed at -80°C before DNA extraction and sequencing. Genomic DNA was sequenced using the Illumina MiSeq (Illumina, Inc, San Diego CA 92121, USA). The gDNA was quantified by a Qubit assay (Life technologies, Carlsbad, CA, USA) to 6.3 ng/μL and dilution was performed requiring 1 ng of DNA as input. The genomic DNA was fragmented and tagged. Limited cycles of PCR amplification completed the tag adapters and introduce dual-index barcodes. After purification on AMPure beads (Life Technologies, Carlsbad, CA, USA), libraries were then normalized on specific beads according to the Nextera XT protocol (Illumina). Normalized libraries were pooled into a single sequencing library, the MiSeq. The pooled single strand library was loaded onto the reagent cartridge and then onto the instrument along with the flow cell. Automated cluster generation and paired-end sequencing with dual index reads was performed in a single 39-hour, 2x251- base pair run (bp). Total information of 10.5 Gb was obtained from a cluster density of 1,288,000 per mm2 with 86.3% (20,305,000 clusters) of the clusters passing quality control filters. Within this pooled run, the index representation of T. tenax was determined to 39.43%. The 8,005,980 paired end reads were filtered according to the read qualities.

Multilocus sequence typing

The reads obtained were assembled using the CLC Genomics Workbench. Protein sequences were predicted using the Prodigal platform [34] and analysis. A local Blastp on the predicted proteins was performed on NCBI Blast (Basic Local Alignment Search Tool) against non-redundant protein sequences (nr) database using the standard parameters. The T. tenax NIH4 genome sequence was deposited on the EMBL-EBI website (Bioproject: PRJEB22701 and whole contigs under accession numbers OCTD01000001-OCTD01004161). Seven single-family household genes were selected ranging in length from 450 to 500 bp ( based on MLST designed for Trichomonas vaginalis [35]. Single standard PCRs were performed to allow DNA amplification of each selected gene. Primer hybridization was conducted at 59°C and amplified products were sequenced as described previously [36]. Sequences were corrected and assembled using the ChromasPro software version 1.71 (Technelysium, Australia). Obtained sequences were aligned using MUSCLE tool in the Molecular Evolutionary Genetics Analysis software (MEGA) version 7.0.18 (Pennsylvania State University, United-States) and, finally, phylogenetic trees were generated using the maximum-likelihood (ML) method within FastTree version 2.0 [37]. MLST nucleotide sequences data are available in the EMBL-EBI database under accession numbers LT934459 to LT934497.

Direct molecular detection from clinical samples

qPCR on the rpb1 gene was used to confirm the presence of T. tenax directly from clinical samples using specific primers and probe (. Cross amplifications were prevented in silico and primers were tested on the DNA of Trichomonas vaginalis strain G3 (ATCCPRA-98). DNA extraction from our isolates and specimens were performed using the NucleoSpin Tissue kit (Macherey-Nagel, Hoerdt, France). The optimized 20 μL Quantitative Real-Time Polymerase Chain Reaction (qPCR) mix contained: master mix (10 μL), primers (0.5 μL, 20 nM), probe (0.5 μL, 5 nM), water (3.5 μL) and 5 μL of DNA. qPCR temperature cycle was: DNA activation at 50°C for two minutes, denaturation at 95°C for five minutes, followed by 40 cycles of 95°C for one second and 60°C for 30 seconds for the plate read. qPCR tubes were deposited in a CFX96 Touch thermal cycler (Bio-rad, France). The results were normalized by testing the gene encoding albumin in parallel. The primers used were: Forward: 5’- GCTGTCATCTCTTGTGGGCTG T-3’, Reverse: 5’- AAACTCATGGGAGCTGCTGGTTC-3’ and FAM probe: 6FAM- 5’ CCTGTCATGCCCACACAAATCTCTCC-3’[38]. A ratio of the cycle threshold (Ct) obtained in q-PCR for the rpb1 gene and the albumin gene was calculated. (

Statistical analysis

The statistical analysis was performed using “R” software (Version 3.5.1) using a ordinal logistic regression with a four-modalities qualitative variable to investigate the correlation between health status and detection methods (culture or PCR) with the existence of T. tenax. χ2 tests for sex and smoking status descriptive statistics and Fisher test for the phylogenetic tree analysis using Statistical Package for the Social Sciences (SPSS Inc, IBM Company).

Results

Isolation of Trichomonas sp.

Fifty-three strains of Trichomonas sp. were obtained from periodontal samples, 37/106 from patients with periodontitis and 16/85 from control patients (p = 0.018) (). Six isolates were lost before conservation. Protists were likely to be T. tenax based on their morphology as observed by microscopy. For a definitive identification, we first performed alignment of available rpb1 gene using online Clustal Omega [39] with standard parameters for 11 sequences of Trichomonas spp. and we visualized it using MView online software (http://www.ebi.ac.uk/Tools/msa/mview/). Following the 100% consensus sequence available (), we designed degenerated primers on conserved regions between the 11 different Trichomonadidae strains. In order to evaluate the intra-species diversity of the rpb1 gene, we amplified and sequenced the rpb1 gene from 15 randomly chosen strains isolated from our control and diseased patients. Of the 3,000 base pairs obtained, all sequences were 100% identical to the reference strain T. tenax NIH4, except one strain (number 13) which possesses two synonym single nucleotide polymorphisms (SNP). All remaining isolates were identified as T. tenax using our specific primers.

Detection of T. tenax using quantitative real time PCR

Sixty of the 191 samples were positive for T. tenax, 24/85 controls and 36/106 periodontitis patients (p = 0.089) (). The standardized results using the average ratio of the rpb1 gene on the albumin gene demonstrate the absence of a link between the amount of Trichomonas DNA and the pathological status (p = 0.087, χ2) ().

Combined results

A good correlation was observed between qPCR and culture, as 83% of positive cultures were also positive for qPCR and 88% of negative cultures were also negative for qPCR. By combining both results, 45/106 patients were positive by culture and/or PCR, compared to 24/85 of controls (p = 0.042, χ2). No association could be found with the patient's gender and health status (p = 0.710, χ2) or with the detection of T. tenax (p = 0.485, χ2). The carriage of T. tenax and smoking status are correlated regardless of health status (p = 0.001, χ2). Regarding the periodontitis classification of each patient, T. tenax is significantly more detected in severe periodontitis than in mild or moderate periodontitis (p<0.05).

Genome sequencing

The 46,742,176 base pair (bp) draft genome obtained contains 4,161 scaffolds with a N50 of 13,554 bp with a minimum of 4,002 bp to a maximum of 92,188 bp with a G+C content estimated of about 34.6% similar to T. vaginalis G3 (35.5%). The gene prediction determined 34,291 Open Reading Frame (ORF) includes 21,854 proteins that could be annotated and 12,437 ORFans. Of these, 21,193 proteins are in common with T. vaginalis, and only five with Trichomonas gallinae, four with T. tenax (sequences of the same strain already available on the nr database) and one with Tritrichomonas foetus. This high number of best hits shared with T. vaginalis G3 strain is logical, as this species in the only species of Trichomonas spp. for which a draft genome is available. In the T. vaginalis G3 genome, about 250 genes were annotated as ribosomal proteins [40]. In T. tenax, we obtained in the draft 52 ORFs annotated as the 40S ribosome and 68 annotated as the 60S ribosome. We isolated the complete sequence of the rpb1 gene measuring 4,962 nucleotides and, congruently, the alignment with the same strain in the database showed 61% of coverage with 100% identity. The alignment starts at position 229 and finishes at position 3,276 of the complete sequence and makes the 3’end of this gene available.

MLST typing

Four housekeeping genes were extracted based on the T. vaginalis typing system: Alanyl tRNA synthetase (ALTS), DNA mismatch repair protein (DMRP), Serine hydromethyltransferase (SHMT), and Mannose-6-phosphate isomerase (M6PI). For genes for which no homologs of Trichomonas vaginalis could be detected in our T.tenax draft genome, we chose three genes because of their functional similarity to complete the system: Glutamine amidotransferase class-I (GAT1), Histidyl tRNA synthetase (HIST), Cysteinyl tRNA synthetase (CYST) (). The 47 strains and the reference NIH4 strain are clustered into three major groups: strains obtained in the control group are significantly predominant in group 1 and strains isolated in periodontitis patients are significantly predominant in group 3 (p <0.05, Fisher). Only periodontal patient strains constitute the cluster 2. (). Phylogenetic tree analysis, based on each housekeeping gene, showed similar topologies. Indeed, six of seven genes also present three major clusters, namely the DMRP, SHMT, ALTS, SHMT, M6PI and GAT1 gene (). Concerning the tree based on the CYST gene, all sequences are identical between controls and patients, highlighting the conservation and lack of variability in this portion of the gene. All strain sequences obtained for each gene portion were compared with the sequences of the reference strain T. tenax NIH4 to investigate the presence of a single nucleotide polymorphism (SNP) (). Four isolates had the same genotype, while the others 43 isolates each had a specific genotype.

Trichomonas tenax relationship based on multilocus sequence typing phylogenetic analysis.

Maximum likelihood phylogenetic tree of T. tenax strains. Colors legend: black for patients, blue for control and red for reference strain.

Discussion

In this study, by combining a polyphasic approach that associates culture and qPCR, we found a correlation between periodontitis and the presence of T. tenax (p< 0.05). Although T. tenax is more frequently detected by qPCR in patients than in controls, the difference is not significant (p = 0.435). A significant difference was observed using culture only (p = 0.015). By combining the culture and PCR results to neutralize the effect of false negative of each technique and evaluate the real prevalence of T. tenax, the difference is significant (p = 0.042). The probability of false positive/negative frequency is reduced due to the good correlation observed between both techniques: 83% of positive cultures also positive for qPCR and 88% of negative cultures also negative for q-PCR techniques. We believe that this good correlation indicates that the culture and handling protocols, including the transport medium specifically developed for anaerobic microorganisms, were highly efficient. However, as commonly observed in clinical microbiology, the higher sensitivity of the PCR suggests that some T. tenax did not grew in culture. The reasons are unknown but usually because microorganisms are dead at time of inoculation due to delayed inoculation between sampling and culture, quality of the operator or quality of the batch of transport or culture media. The 11.6% of the positive samples in culture not identified by real-time PCR shows that false positive occur also with molecular amplification, usually as a consequence of inhibitors. Furthermore, positive culture in controls underlines the difficulty of having a true negative control group. We first suspected that a higher rate of positive culture in periodontitis patients could have been the result of a higher concentration of protist in these samples. But the absence of such differences observed using quantitative PCR disproves this hypothesizes. Indeed, no difference in the amount of T. tenax DNA in controls and patients is demonstrated after normalization of the results by the albumin gene. A recent review reports higher prevalence of T. tenax occurrence in gum diseased (gingivitis and periodontitis) in most studies present in the literature and explains that the heterogeneity of the prevalence observed may be due to the different methods used to detect the protist (majority of microscopic observation, insufficient use of molecular biology) and the studied population diversity [21]. The same limits may be pointed out in another study reporting the absence of trichomonas in healthy sites in periodontitis patients [27]. Theses discrepancies, as compared to our study, could be related with false positive of our PCR procedure. However, the high level of positive culture herein is not in agreement with this hypothesis and the detection of trichomonads from healthy sites in controls with no periodontal disease indicated that T. tenax carriage remains common in the oral cavity. A correlation could also be established between the severity of periodontitis and the presence of protists (p<0.05). T. tenax is found in severe periodontitis differing from other periodontitis, by the depth of the pocket as well as the loss of attachment. The environment of severe periodontitis would therefore be more favorable to the development of the protist and other bacteria species leading to serious lesions and inflammatory responses. We now suspect that the specific periodontal microbiota associated with periodontitis could promote the growth of T. tenax. Indeed, when inoculated in the culture medium, the sample also contains bacterial microbiota of dental pockets. Indeed, periodontitis is suspected to be due to an inflammatory response to microorganisms [1,8]. Finally, no single microorganism is implicated but rather a combination of microorganisms act synergistically [3,17,20]. Investigating the difference in microbiota between healthy individuals and patients with mild and moderate periodontitis compared to severe periodontitis would highlight the combined role of protist and oral microbiome. Several studies have demonstrated the efficacy of PCR in detecting T. tenax by employing rRNA sequencing [41]. Likewise, oral cavity metagenomics studies have identified significant T. tenax rRNA intergenic spacers [42]. Nonetheless, these systems come up against identification limits. Designing primers based on the rpb1 gene according to Malik et al. [33], allowed us to create a highly specific and sensitive system: this gene is both discriminatory between different species and genotypes and is highly conserved within the same species [43,44]. All isolated strains of Trichomonas sp. were identified as T. tenax, once again demonstrating the effectiveness of this primer system and the extreme conservation of T. tenax based on the rpb1 gene. Finally, the MLST system made it possible to investigate the clonal relationship between the protist and periodontitis based on the system created for the closely studied neighboring species, T. vaginalis [35]. The data obtained reveal the existence of three clusters grouping T. tenax, suggesting genetically diverse strains affecting the periodontium tissue. A significant association could be observed between clustering and the occurrence of periodontitis. The possibility of finding new virulence factors in common between strains in future work could confirm the virulence of diseased strains related to the severity of the periodontal disease. Recently, a physiopathology mechanism of T. tenax has been described in the periodontitis disease: T. tenax induced an effect against the human macrophage and deregulates the proinflammatory cytokines [45]. Furthermore, in vitro studies showed that T. tenax had cytotoxic effects on mammalian cells [46]. An animal model reproducing periodontitis suggested in these recent studies could be used to explore the potential pathophysiological role of T. tenax [21,47].

Conclusion

A high prevalence of T. tenax in both controls and patients is detected using genomic-dependent and culture-based methods of detection. T. tenax was more frequently associated with severe periodontitis. Three clusters of strains were highlighted by the MLST genotyping system, two were significantly associated with periodontitis. T. tenax appears to be associated with the onset or/and evolution of periodontal diseases. However, although these differences are statistically significant, it is impossible to determine whether they are a cause or a consequence of the disease.

Quantitative Real-Time PCR (q-RT PCR) specific for Trichomonas tenax.

(DOCX) Click here for additional data file.

The table below presents the classification of each patient.

The numbers correspond to a patient and preserve anonymity. The discontinuity of the numbering is linked to the change of operator in the laboratory. In black: patients with periodontitis.—In bold: the patient controls. (DOCX) Click here for additional data file.

Sequence types of Trichomonas tenax based on single-nucleotide polymorphism against the Trichomonas tenax reference strain.

In bold: the number of sequences types. (DOCX) Click here for additional data file.

The table below presents the cycle threshold obtained in q-PCR for the RPB1gene and the albumin gene for the standardization.

In black: periodontitis patients. In bold: controls. (DOCX) Click here for additional data file.

Trichomonas tenax phylogenetic analysis based on Alanyl tRNA synthetase (ALTS) gene.