Literature DB >> 30842486

One-step loop-mediated isothermal amplification (LAMP) for the rapid and sensitive detection of Fusarium fujikuroi in bakanae disease through NRPS31, an important gene in the gibberellic acid bio-synthesis.

S Y Zhang1, D J Dai1,2, H D Wang1,2, C Q Zhang3.   

Abstract

Rice bakanae disease caused by Fusarium fujikuroi is one of the most famous seed borne diseases. If infected seeds are used, this disease will occur with serious impacts. Thus, a simple, reliable, specific and sensitive method for surveillance is urgently needed to screen infected seeds and seedlings at early developmental stages. In this study, a rapid and efficient loop-mediated isothermal amplification (LAMP) method was developed to detect F. fujikuroi in contaminated rice seeds and seedlings for diagnosis of bakanae disease. NRPS31 gene plays an important role in the gibberellic acid (GA) bio-synthesis of F. fujikuroi, and is not present in any other sequenced fungal genome, and thus was adopted as the target for LAMP primer design. The LAMP assay enables the fast detection of as little as 1 fg of pure genomic F. fujikuroi DNA within 60 minutes. Further tests indicated that the LAMP assay was more sensitive and faster than the traditional isolation method for F. fujikuroi detection in rice seeds and seedlings. Our results show that this LAMP assay is a useful and convenient tool for detecting F. fujikuroi, and it can be applied widely in seed quarantine of bakanae disease, providing valid data for disease prevention.

Entities:  

Mesh:

Substances:

Year:  2019        PMID: 30842486      PMCID: PMC6403233          DOI: 10.1038/s41598-019-39874-z

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Rice (Oryza sativa L.) is an essential staple food consumed worldwide. A recent survey by the International Food Policy Research Institute indicates that rice production will need to increase 38% by 2030 to feed the expanding human population but available arable land is being lost to housing and industrialization. Rice bakanae disease (RBD) caused by seed-borne Fusarium fujikuroi results in serious economic losses in rice growing countries[1-6]. RBD is one of the most serious and oldest problems in rice productions, and was first described in 1828 in Japan[7]. RBD leads to a significant production loss of up to even 50% of rice yields. In 2011, up to 40% disease incidence was reported from the Kapurthala, Ropar, Patiala, Ludhiana, Amritsar, Gurudaspur and Hoshiarpur districts of Punjab, India[8]. In Korea, 2.9% of the rice seedlings in seed boxes were infected by RBD in 2003, and a major increase to 28.8% was documented in 2006[4]. Thus, if food security for this important crop is to be preserved, monitoring methods for F. fujikuroi in seeds are urgently needed to prevent the occurrence and spread of RBD. RBD can affect rice from the pre-emergence stage to the mature stage, and cause elongation and upward root growth of rice plants mainly due to gibberellic acids (GAs), a family of plant hormones, which were secreted by F. fujikuroi[9-13]. RBD is transmitted mainly by seed contamination and the pathogen can survive in seeds and infected rice straw. Importantly, infested seeds will pass the pathogen to healthy seeds when they are stored together. During the disease’s cycle in rice fields, infection can occur by sowing infected seeds with non-infested seeds. As generally, seeds contaminated with the fungus provide the initial source for secondary infection. Under favorable environmental conditions, infected plants have the capacity to produce numerous conidia that subsequently infect healthy plants, resulting in major yield loss[14,15]. Thus, early detection of F. fujikuroi in seeds and seedlings is essential to prevent the occurrence and spread of RDB. Several methods for surveillance of RBD, including F. fujikuroi isolation, seed morphology scanning, and polymerase chain reaction (PCR) detection, are among the common practical methods adopted for RDB diagnosis in the laboratory[8,16]. However, these traditional methods are unsuitable for field applications, as they require technical expertise, specialized equipment and can be time-consuming. Technologically, the extraction and consequent molecular detection of genomic DNA from F. fujikuroi contaminated seed samples is usually difficult to be exerted. It can be ascribed to the complicated biochemical components existed in seeds, including not only the genomic DNA, but also some microbes and overwhelming number of PCR inhibitors. Taking such disadvantages into account, a DNA amplification technique known as loop-mediated isothermal amplification (LAMP) has been developed in this study for the detection of F. fujikuroi. LAMP was invented and applied as early as in 2000 and is recognized as a user-friendly, rapid, and efficient amplification method of DNA sequences at a single temperature, that is both sensitive and specific[17]. This technique is less sensitive to inhibitors than PCR and, hence, has been applied for detection of several plant-pathogens, including Didymella bryoniae from cucurbit seeds[18] and Colletotrichum truncatum from soybeans[19]. The LAMP assay employs four to six oligonucleotide primers and the strand displacement activity of Bst DNA polymerase to amplify specific DNA sequences with high specificity[20]. The large quantity of amplified product and by-product (magnesium pyrophosphate) obtained via the LAMP reaction allows effective detection of target DNA based on visual assessment of turbidity, or a color change that develops upon addition of color-changing reagents[21]. LAMP products can also be visualized as banding pattern on agarose gel[22]. Overall, without any special equipment, LAMP assays can amplify DNA with high specificity and efficiency compared with conventional PCR. In this study, we developed a specific and efficient method for one-step detection method of F. fujikuroi in rice seeds based on the non-ribosomal peptide synthetase (NRPS31),which is conserved and unique to F. fujikuroi and plays an important role in the GA bio-synthesis.

Results

LAMP primers

The LAMP primers (Fig. 1, Table 1) for F. fujikuroi were checked by comparison with all available relevant sequences. The primers were chosen to allow specific amplification of F. fujikuroi and did not show any similarities to other sequences available in NCBI GenBank database. During the design of LAMP primers, ΔG values of the 3′ ends F3/B3 primer and F2/B2 primer, 5′ ends of the F1c and B1c primer were determined and the values were −4.51, −4.74, −4.91, −5.26, −5.40 and −5.51 Kcal/mole, and all ΔG values were less than −4 Kcal/mol. Finally, a set of four primers exhibiting high species specificity and sensitivity which targeted the NRPS31 sequence of F. fujikuroi were selected for further study. The selected target for the LAMP assay was located on non-ribosomal peptide synthetase (HF679023.1, position 6544644 to 6544870 bp).
Figure 1

Partial sequence of non-ribosomal peptide synthetase (NRPS31) of Fusarium fujikuroi and the location of the Loop-Mediated Isothermal Amplification (LAMP) primers of Fns31–1. Arrows indicate the direction of extension. By targeting six conserved regions of NRPS31 (F3c, F2c, Flc, B1, B2, B3), four specific primers,including two outer (F3 and B3) and two inner, FIP (Forward Inner Primer, F1c and F2) and BIP (Backward Inner Primer, B1c and B2) primers were designed. F1c is the complementary sequence of F1.

Table 1

Primers Fns31-1 used for development of a loop-mediated isothermal amplification (LAMP) assay for specific detection of Fusarium fujikuroi.

Primer typeSequence (5′-3′)
F3CGGCCCTTATACCCCATTC
B3GCGCCACTATTGCTGTCT
FIP (F1c-F2)*ACTTGCGCTGGAAAGACCAGAACATCCGCCACCTCACTGA
BIP (B1c-B2)GGTCACCAATCCTCGGCTACAGCCCTAGGAGATGGTCGCTTA

*FIP is a hybrid primer consisting of the F1c sequence and the F2 sequence, BIP is a hybrid primer consisting of the B1c sequence and the B2 sequence.

Partial sequence of non-ribosomal peptide synthetase (NRPS31) of Fusarium fujikuroi and the location of the Loop-Mediated Isothermal Amplification (LAMP) primers of Fns31–1. Arrows indicate the direction of extension. By targeting six conserved regions of NRPS31 (F3c, F2c, Flc, B1, B2, B3), four specific primers,including two outer (F3 and B3) and two inner, FIP (Forward Inner Primer, F1c and F2) and BIP (Backward Inner Primer, B1c and B2) primers were designed. F1c is the complementary sequence of F1. Primers Fns31-1 used for development of a loop-mediated isothermal amplification (LAMP) assay for specific detection of Fusarium fujikuroi. *FIP is a hybrid primer consisting of the F1c sequence and the F2 sequence, BIP is a hybrid primer consisting of the B1c sequence and the B2 sequence.

Specificity and sensitivity of the LAMP assay

The specificity of the primers was tested with F. fujikuroi isolates and no-target DNA samples of different pathogenic and nonpathogenic fungi.With the addition of 0.15 μM Hydroxynaphthol blue (HNB), the results of LAMP assay can be visualized via color shift from violet to blue. The F. fujikuroi isolates tested positive in every replicated test, indicated by color changes from violet to azure evidently of the reaction solution, whereas the original violet color was retained for other fungi (Fig. 2A). The nuclease-free water templates showed no color change in any validation test. Moreover, a ladder-like pattern in gel electrophoresis of the LAMP amplified products revealed similar findings to the color change (Fig. 2B). Consequently, the newly developed LAMP assay employing the primer Fns31-1 (Table 1) showed high specificity in detection of F. fujikuroi.
Figure 2

The specific loop-mediated isothermal amplification of Fusarium fujikuroi by the primers Fns31–1. (A) Assessment based on HNB visualization of color change of the LAMP products; (B) Agarose gel electrophoresis of LAMP products. M, DNA marker; 1. F. fujikuroi; 2. F. fujikuroi; 3. F. fujikuroi; 4. F. fujikuroi; 5. F. fujikuroi; 6. F. fujikuroi; 7. F. fujikuroi; 8. F. fujikuroi; 9. F. avenaceum; 10. F. semitectum; 11. F. verticillioide; 12. F. lateritium; 13. F. sambucinum; 14. F. culmorum; 15. F. sporotrichioides; 16. F. oxysporum; 17. F. proliferatum; 18. F. solani; 19. F. graminearum; 20. Curvularia lunata; 21. Aspergillu terreus; 22. Sclerotinia sclerotiorum; 23. Bipolaris sorokiniana; 24. Phomopsis asparagi; 25. Penicillium sp.; 26. Ustilaginoidea virens; 27. Pyricularia oryzae; 28. Alternaria alternata; 29. Rhizoctonia solani; 30. nuclease-free water.

The specific loop-mediated isothermal amplification of Fusarium fujikuroi by the primers Fns31–1. (A) Assessment based on HNB visualization of color change of the LAMP products; (B) Agarose gel electrophoresis of LAMP products. M, DNA marker; 1. F. fujikuroi; 2. F. fujikuroi; 3. F. fujikuroi; 4. F. fujikuroi; 5. F. fujikuroi; 6. F. fujikuroi; 7. F. fujikuroi; 8. F. fujikuroi; 9. F. avenaceum; 10. F. semitectum; 11. F. verticillioide; 12. F. lateritium; 13. F. sambucinum; 14. F. culmorum; 15. F. sporotrichioides; 16. F. oxysporum; 17. F. proliferatum; 18. F. solani; 19. F. graminearum; 20. Curvularia lunata; 21. Aspergillu terreus; 22. Sclerotinia sclerotiorum; 23. Bipolaris sorokiniana; 24. Phomopsis asparagi; 25. Penicillium sp.; 26. Ustilaginoidea virens; 27. Pyricularia oryzae; 28. Alternaria alternata; 29. Rhizoctonia solani; 30. nuclease-free water. After it was determined that the primer Fns31-1 was specific for F. fujikuroi, the lowest detection limit was characterized using 10-fold serial dilutions of pure F. fujikuroi DNA (1 ng to 10 ag) extracted from three separate isolates F. fujikuroi. The lowest detection limit for F. fujikuroi was per reaction within 60 min incubation time when using template DNA extracted from pure cultures10 fg and 1 fg, respectively for color shift through addition of HNB and gel electrophoresis (Fig. 3). As a comparison, conventional PCR conducted with primers Fns31-1-F3/Fns31-1-B3 exhibited 100 times higher than LAMP. The results indicated that, compared to the PCR method, our LAMP assay was more sensitive.
Figure 3

The results of loop-mediated isothermal amplification (LAMP) with different concentration of DNA template. (A) Assessment based on HNB visualization of color change of the LAMP products. (B) Assessment based gel electrophoresis analysis of the LAMP products. M, DNA marker; 1. 1 ng/μl; 2, 100 pg/μl; 3, 10 pg/μl; 4, 1 pg/μl; 5, 100 fg/μl; 6, 10 fg/μl; 7, 1 fg/μl; 8, 100 ag/μl; 9, 10 ag/μl; 10, nuclease-free water.

The results of loop-mediated isothermal amplification (LAMP) with different concentration of DNA template. (A) Assessment based on HNB visualization of color change of the LAMP products. (B) Assessment based gel electrophoresis analysis of the LAMP products. M, DNA marker; 1. 1 ng/μl; 2, 100 pg/μl; 3, 10 pg/μl; 4, 1 pg/μl; 5, 100 fg/μl; 6, 10 fg/μl; 7, 1 fg/μl; 8, 100 ag/μl; 9, 10 ag/μl; 10, nuclease-free water.

LAMP detection of F. fujikuroi in rice seeds

The efficiency of the LAMP assay in detecting F. fujikuroi in rice seeds was tested by inoculating pathogen-free samples of rice seeds with F. fujikuroi. The results of LAMP assay were positive with inoculated treatments at a mixing ratio (inoculated rice seeds:non-inoculated healthy seeds) of 1:199, while none of the non-inoculated treatments showed any reaction. This was supported by similar results of conventional methods of fungus isolation. Typical fungal colonies distributed around each seed in the plates. As the mixing ratio decreased to 1:399, the LAMP assay was shown to provide substantially more positive results than those of fungus isolation. At the ratio of 1:3199, for example, the detection rate (%) for fungus isolation was only 0.67 but that of LAMP was as high as 16.67 (Table 2). This result indicated that the LAMP assay was more sensitive than the traditional isolation method.
Table 2

The detection rate of LAMP assay and conventional microbiological isolation method for Fusarium fujikuroi at different levels of infestation.

Detection methodDetection rate (%)b at different mixing ratioa
1:991:1991:3991:7991:15991:3199
isolation100.00*c100.00*77.00*12.00*0.67*0.67*
LMAP100.00*100.00*96.67**90.00**46.67**16.67*

aMixing ratio means mixing the number of inoculated rice seeds: the number ofnon-inoculated healthy seeds. For example, 1:99 means one inoculated rice seed was mixed with 99 non-inoculated healthy seeds.

bFor each mixing ratio, 20 seeds were used at random to detect the Fusarium fujikuroi for each seed. Detection rate (%) means numbers of seeds for which F. fujikuroi was detected out of 20 seeds.

cMean values with the different number of asterisks within the same column were significantly different (t tests, P < 0.01).

The detection rate of LAMP assay and conventional microbiological isolation method for Fusarium fujikuroi at different levels of infestation. aMixing ratio means mixing the number of inoculated rice seeds: the number ofnon-inoculated healthy seeds. For example, 1:99 means one inoculated rice seed was mixed with 99 non-inoculated healthy seeds. bFor each mixing ratio, 20 seeds were used at random to detect the Fusarium fujikuroi for each seed. Detection rate (%) means numbers of seeds for which F. fujikuroi was detected out of 20 seeds. cMean values with the different number of asterisks within the same column were significantly different (t tests, P < 0.01).

LAMP detection of F. fujikuroi in rice seedlings

After elongation symptoms were observed in the seedlings incubated with inoculum suspension, the seedlings treated with phenamacril and negative control were still healthy. The results of LAMP assays from seedlings incubated with inoculum suspension of F. fujikuroi at the concentration from 1 × 103 conidia ml−1 to 1 × 106 conidia ml−1 were all positive.The seedlings inoculated with 1 × 106 conidial ml−1 suspension and treated with 3 μg/ml of phenamacril were all negative (Fig. 4). When compared to traditional isolation and culture methods, the LAMP assay was more accurate and showed higher sensitivity. Among the inoculated samples with different concentration of conidia, F. fujikuroi was only re-isolated from seedlings inoculated with 1 × 105 and 1 × 106 conidia ml−1 with the respective frequency of 63.2% and 87.6% but not isolated from inoculations with 1 × 103, 1 × 104 conidia ml−1.
Figure 4

The detection of inoculated seedlings by loop-mediated isothermal amplification. 1–4, DNA from seedlings samples incubated with 1 × 103, 1 × 104, 1 × 105 and 1 × 106 conidia ml−1; 5, DNA from inoculated seedlings samples treated with 3 μg/ml of phenamacri; 6, the DNA template of Fusarium fujikuroi; 7, DNA from non-infested seedlings as a negative control; 8, negative control (no seedling).

The detection of inoculated seedlings by loop-mediated isothermal amplification. 1–4, DNA from seedlings samples incubated with 1 × 103, 1 × 104, 1 × 105 and 1 × 106 conidia ml−1; 5, DNA from inoculated seedlings samples treated with 3 μg/ml of phenamacri; 6, the DNA template of Fusarium fujikuroi; 7, DNA from non-infested seedlings as a negative control; 8, negative control (no seedling). As shown in Fig. 5, the color of the naturally diseased seedling and positive control sample was sky blue and the color of the negative control and healthy samples was violet, however, amplification was never observed in healthy seedling and negative positive control samples. For each of the two sites, Shaoxing and Jinhua,13 infected seedlings randomly chosen all showed positive. For the traditional isolation method, F. fujikuroi was successfully isolated from 7 infected seedlings with the frequency of 53.8%. The results show that, compared to the traditional isolation method, our LAMP assay was more rapid and sensitive for field samples.
Figure 5

The detection from stems infected rice bakanae disease collected from the field by loop-mediated isothermal amplification. 1–13, samples of the bakanae disease in the field; 14, the DNA template of Fusarium fujikuroi; 15–19, healthy plant; 20, nuclease-free water.

The detection from stems infected rice bakanae disease collected from the field by loop-mediated isothermal amplification. 1–13, samples of the bakanae disease in the field; 14, the DNA template of Fusarium fujikuroi; 15–19, healthy plant; 20, nuclease-free water.

Discussion

RBD caused by F. fujikuroi is an important seed-borne disease that is common in the primary rice production regions. Traditional isolation and culture methods are important in the diagnosis of plant fungal diseases. However, because of morphological similarities, it is difficult to distinguish F. fujikuroi from other Fusarium species by microscopic observation alone, which can be lengthy and require special training. Meanwhile, our research shows it is hard to efficiently and accurately assay seed samples if the infection rate by F. fujikuroi is below 0.25%. The seedling blotter assay was widely employed in seed health tests for Fusarium sp., however, it requires large seed sample sizes to ensure reliability of the test result. Until present, the recommended method by ISTA (the International Rules for Seed Testing) (http://www.bibme.org/citation-guide/apa/web-site/) requires blotting a sample of 400 rice seeds,evenly dividing onto 16 filter paper (90-mm) soaked with distilled water. After incubation at 22 °C in 12 h cycles of light and darkness for 7 d, each seed was examined and confirmed by stereoscopic and the percentage of infected seeds was recorded. Hence, visual, rapid and accurate seed health testing technique could contribute meaningfully to eliminate infested seed lots and thereby minimize the threat of outbreaks of this disruptive disease. The several existing assays developed to test seeds for F. fujikuroi require long incubation periods (blotter assay), or expensive equipment (PCR and real-time PCR). In contrast to traditional methods of pathogen detection in plant tissues, the LAMP assay is simple and requires no special techniques, specialized equipment and knowledge. Only the primers, reagents, and a temperature-controlled device are needed to perform the LAMP reactions. When the LAMP products were detected through gel electrophoresis,a ladder-like pattern of the amplified products was observed in all assays. Moreover, the results can be easily visualized with the addition of HNB in LAMP assay, which enables a clear and easy detection of positive samples by unaided eye via color shift from violet to blue. Furthermore, this modification did not diminish either sensitivity or specificity of the reaction[23]. Previous reported LAMP assays for fungi mostly target regions of high similarity among species such as ITS[24,25] which tend to have less interspecific variability and possibly hamper the development of species-specific primers. Our LAMP assay for the detection of F. fujikuroi employed four specific LAMP primers, which were designed, based on the sequence of the conserved NRPS31gene. This gene is conserved and unique to F. fujikuroi and plays an important role in the GA bio-synthesis[26]. Thus, NRPS31 gene was a highly specific target for the design of LAMP primers for the detection of F. fujikuroi. Generally, the seeds may contain many species of Fusarium, Penicillium, Rhizopus, Alternaria and Ustilaginoidea, however, the results provided in this study clearly indicated that the LAMP method diminished the possibility of cross-reactivity due to the specificity of the primers. The sensitivity of the LAMP assay with genomic DNA of F. fujikuroi was 10 fg and 1fg respectively for color shift through addition of HNB and gel electrophoresis, and the sensitivity was further verified on plant samples. The reported TaqMan real-time PCR and SYBR Green real-time PCR assay had the respective detection limit of 27.5 fg and 10 pg of F. fujikuroi DNA[27,28]. Upon detecting for seed and seedling samples, the LAMP assay yielded satisfactory results compared to traditional isolation and culture methods. This rapid, simple and cost-effective LAMP assay also overcomes limitations frequently encountered when using PCR assays for detection of F. fujikuroi and other slow-growing fungal pathogens in seeds. In summary, the LAMP method targeting NRPS31 gene which was conserved and unique to F. fujikuroi was successfully developed for detection of F. fujikuroi in pure culture, rice seedlings and seeds, showing excellent sensitivity, specificity, simplicity and user-friendly handling compared with conventional methods.

Materials and Methods

Fungal isolates, culture conditions and DNA extraction

F. fujikuroi isolates were isolated from diseased rice seedlings in Shao xing (120°65s, 29°98w), and Jia xing (120°86s, 30°75w) Zhejiang Province, China, and the isolates were identified using both morphological[16] and molecular approaches, using sequencing translation elongation factor 1-α[29,30] and maintained in potato dextrose agar (PDA) slants in dark. Other twenty-one rice seed-associated fungi[31,32] were bought from Agricultural Culture Collection of China (ACCC), China Center of Industrial Culture Collection (CICC) or China General Microbiological Culture Collection Center (CGMCC) and accession codes and host type are listed in Table 3. These strains were adopted to provide comparison to confirm the specificity of proposed methods for F. fujikuroi. Prior to experiments, all isolates were transferred to PDA plates and were incubated for 5 d at 25 °C in darkness. Genomic DNA was extracted from each sample using a Rapid Fungi Genomic DNA Isolation Kit (Sangon, Shanghai, China) according to the manufacturer’s instructions. The quality of the DNA was checked in agarose gels (1.7%) and the quantity determined in a spectrophotometer (NanoDrop Technologies, Wilmington, Delaware, USA).
Table 3

Fusarium and other fungal isolates used to evaluate the analytical specificity of the LAMP assay for detection of Fusarium fujikuroia.

SpeciesIsolateHostLocation
Fusarium fujikuroi FFSX-05RiceZhejiang, China
F. fujikuroiFFSX-20RiceZhejiang, China
F. fujikuroiFFJX-14RiceZhejiang, China
F. fujikuroiFFJH-09RiceZhejiang, China
F. fujikuroiFFJS-16RiceJiangsu, China
F. fujikuroiFFJX-20RiceJiangsu, China
F. fujikuroiFFJX-22RiceJiangsu, China
F. fujikuroiCGMCC 3.1108bRiceZhejiang, China
F. avenaceumACCC 30065cSoilChina
F. semitectumACCC 31945dSoilBeijing, China
F. verticillioideACCC 37123RiceGansu, China
F. lateritiumACCC 30023SoilGuangdong, China
F. sambucinumACCC 30078/Beijing, China
F. culmorumACCC 37130Grass seedGansu, China
F. sporotrichioidesACCC 37402GarlicHenan, China
F. oxysporumACCC 30927RiceHainan, China
F. proliferatumCICC 2489cRiceAnhui, China
F. solaniACCC 37119RiceHebei, China
F. graminearumACCC 37680WheatJiangxi, China
Curvularia lunata ACCC 36693RiceAnhui, China
Aspergillu terreus ACCC 31880SoilXinjiang, China
Sclerotinia sclerotiorum ACCC 36462RapeShandong, China
Bipolaris sorokiniana ACCC 36805WheatBeijing, China
Phomopsis asparagi CICC 2706dReedHebei, China
Penicillium sp.ACCC 31507SoilShandong, China
Ustilaginoidea virens ACCC 2711RiceHunan, China
Pyricularia oryzae ACCC 37631RiceFujian, China
Alternaria alternata ACCC 36843RiceHainan, China
Rhizoctonia solani ACCC 36246RiceBeijing, China

aF. fujikuroi isolates were positive with LAMP primer Fns31-1.

bCGMCC, China General Microbiological Culture Collection Center.

cACCC, Agricultural Culture Collection of China.

dCICC, China Center of Industrial Culture Collection.

Fusarium and other fungal isolates used to evaluate the analytical specificity of the LAMP assay for detection of Fusarium fujikuroia. aF. fujikuroi isolates were positive with LAMP primer Fns31-1. bCGMCC, China General Microbiological Culture Collection Center. cACCC, Agricultural Culture Collection of China. dCICC, China Center of Industrial Culture Collection.

Inoculation of rice seeds with F. fujikuroi

Seeds (cultivar XS11) were artificially infected with F. fujikuroi by a method with small modifications[18,30]. Briefly, agar plugs (0.5 cm in diameter) of F. fujikuroi (CGMCC 3.1108) were cut at the leading edge of colony growth after 7 d at 25 °C on PDA plates under continuous darkness, and three agar plugs were incubated into separate 250-ml Erlenmeyer flasks containing 20 g autoclaved rice seeds and 100 ml nuclease-free water. Subsequently, the mixtures of fungal plugs and rice seeds were co-incubated at 25 °C for 72 h at 150 rpm with alternating light and dark. Seeds exposed to the fungus were then removed from the Erlenmeyer flasks, and air-dried on sterile absorbent paper at 25 °C for 48 h.

Generation of rice seedlings infected by F. fujikuroi

With respect to inoculation of seedlings, seed lots of rice, cultivar XS11, found free of seed-borne F. fujikuroi were used in the experiments, which were surface sterilized by method of Kim[33] with modifications. Seeds were immersed in 4% sodium hypochlorite for 3 min and rinsed three times consecutively in sterile distilled water, and transferred to seedling tray (26 cm × 13 cm × 6 cm) containing sterile distilled water, and incubated at 57 °C for 13 min. F. fujikuroi isolate (CGMCC 3.1108) was cultured on PDA plates and incubated at 25 °C under continuous light for 7 d. We then added 5 ml of distilled water to each plate, dislodged the conidia with a cotton swab, and filtered the suspension through double-layered cheesecloth. Conidia of F. fujikuroi were collected from 7-d-old cultures on PDA and suspended in sterile distilled water. The conidial suspensions were determined using a hemocytometer and adjusted to concentrations of 1 × 103, 1 × 104, 1 × 105 and 1 × 106 conidial ml−1.Thirty germinated sprouts with germ length up to half of length of the seed were soaked in each concentration of the conidial suspensions for 12 h at 28 °C, 70 rpm in the dark. Negative controls were double-distilled water (ddH2O) in place of spore suspension. To ensure the accuracy of the results and avoid false positives, 30 sprouts inoculated with 1 × 106 conidial ml−1 suspension, and treated with 3 μg/ml of phenamacril[34], the most effective fungicide preventing RBD available at present, as another negative control. After inoculation, 30 sprouts were sown in nutrient solution in a growth chamber with a 12-h photoperiod and a daytime temperature of 28 °C and 25 °C at night (70–80% RH) until disease symptoms were observed. After 15 d, when the elongation and upward growth of roots were observed as seedling symptoms, the internodes of seedling stem bases were cut into small segments (length at 0.5 cm).

Isolation of F. fujikuroi from seeds and seedlings

To assess the detection result by LAMP, traditionally isolation and culture method was used to isolate F. fujikuroi from rice seeds and seedlings. The internodes of seedling stem bases were cut into small segments (length at 0.5 cm), and immersed in sterile water to remove dirt from the surface. The segments or seeds were immersed in 4% sodium hypochlorite for 4 min and 70% alcohol for 10s successively and rinsed three times in sterile water. Finally, the samples were dried with sterile absorbent paper, and inoculated on PDA in a Petri-dish under 25 °C in the dark. The percentage of F. fujikuroi-infested was observed after 3 d (n = 200 seeds or segments)

LAMP primers design and screen

The NRPS31 gene is not present in any known sequenced fungal genome other than F. fujikuroi and this gene plays an important role in the GA bio-synthesis, which is necessary for pathogenesis[26]. Thus, this conserved and unique NRPS31 gene was a highly specific target for the design of LAMP primers for the detection of F. fujikuroi. A set of LAMP primers, comprising two outer (F3 and B3) and two inner (FIP and BIP) primers were designed using the Primer Explorer V4 software program (http://primerexplorer.jp), based on the F. fujikuroi NRPS31 sequence (HF679023.1). Best primer selection was based ΔG values of less than or equal to −4 Kcal/mol at the 3′ end of F3/B3 and F2/B2, and 5′ ends of F1c and B1c, and were synthesized by Sangon.

LAMP reaction mixtures and conditions

LAMP reactions were performed using the above described primer sets shown in Fig. 1 and Table 1. Each reaction contained 0.8 μM of the primers FIP and BIP, 0.1 μM of the primers F3 and B3, 0.8 M betaine, 1.4 mM dNTPs, 20 mM TrisHCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 6 mM MgSO4, 0.1% (v/v) Triton X-100, 8 U of Bst DNA polymerase, 150 μM HNB and 1 μl of the target DNA sample extracted as described. The reaction mixtures were incubated in a heated block at an optimal temperature of 64 °C with an amplification period of 60 min followed by incubation at 80 °C for 10 min to terminate the reactions. The reaction results were examined via visual color changes of HNB (from violet to sky blue) after the reaction and/or further confirmed via 1% agarose gel electrophoresis.

Assessment of specificity and sensitivity of LAMP assay

The specificity was determined by the LAMP assay with DNA extracted from eight F. fujikuroi and other twenty-one rice seed-borne or soil-born fungi[29], as discussed above and listed in Table 2. To determine the sensitivity of the LAMP assay, genomic DNA from F. fujikuroi (CGMCC 3.1108) was used. The LAMP assay detection limit is defined here as the smallest amount of DNA detected in each test replicate. The LAMP assay was tested using ten-fold serial dilutions of pure isolate genomic DNA ranging from 10 ng/μl to 100 fg/μl. Dilution series were prepared in sterile deionized water. The associated LAMP assays were performed using the same conditions mentioned above. In order to obtain consistent results, each LAMP reaction was repeated in triplicate. Negative controls contained nuclease-free water in place of template DNA. All reactions were performed three times.

DNA purification and LAMP detection from rice seeds and seedlings

To determine how effective LAMP detection was for identifying the presence of F. fujikuroi, the detection assays were conducted on infected rice seeds and seedlings. Individual F. fujikuroi-infected seed was mixed with 99, 199, 399, 799, 1599 and 3199 healthy seeds in the Erlenmeyer flasks, respectively, and incubated at 25 °C, 300 rpm for 2 h. Single healthy seed mixed with 99 healthy seeds samples served as a negative control. To evaluate the LAMP detection of F. fujikuroi from artificially infested seeds, 20 seeds were collected at random from each Erlenmeyer flask and each seed was transferred to a 1.5-ml self-standing screw-cap tube (Bio Basic Canada Inc) for the DNA extraction. DNA from each seed was extracted using a Chelex-100 protocol[35] with modifications made as follows:200 μl of 5% Chelex-100 sodium form (Sigma-Aldrich) solution was added to each seed, which was then crushed using a sterile micro pestle. After centrifugation at 2000 rpm for 1 min, the tubes were treated for 6 s at 40 KHz in an ultrasonic bath (Desen DSA50-GL2, Fuzhou, Fujian, China), and then submerged in water bath (Sen Xin DKB-501A, Shanghai, China) at 100 °C for 5 min, with both steps then repeated again. Suspensions in the tubes were then allowed to cool to room temperature before the tubes were stored at −20 °C if not immediately used as DNA template for LAMP reactions. DNA extractions for inoculated seedlings were from small segments using the method as described above for seed samples, and stored at −20 °C until tested using the LAMP assays. All assays were done in triplicate in order to obtain consistent results. Purified DNA from F. fujikuroi on PDA was used as a positive control while DNA from non-inoculated healthy seedling was used as a negative control.

LAMP detection of F. fujikuroi from seedlings collected in rice fields

To further confirm the efficiency of LAMP assays for the detection of F. fujikuroi from seedlings, naturally infected seedlings and healthy seedlings were collected from the fields in Shaoxing and Jinhua of Zhejiang Province. For each site, a total of 35 seedlings just occurring of symptom were sampled from different rice fields and fields were separated, at least, 30 km from each other. Five to 10 seedlings were collect from each field. These seedlings samples were brought back to laboratory for testings. For each site, 13 out of 35 seedlings was chosen at random and small segments from stems of each seedling were adopted for LAMP assay and traditional isolation of F. fujikuroi as described above.
  15 in total

1.  Visual detection of pandemic influenza A H1N1 Virus 2009 by reverse-transcription loop-mediated isothermal amplification with hydroxynaphthol blue dye.

Authors:  Xue-Jun Ma; Yue-Long Shu; Kai Nie; Meng Qin; Da-Yan Wang; Rong-Bao Gao; Miao Wang; Le-Ying Wen; Feng Han; Shu-Mei Zhou; Xiang Zhao; Yan-Hui Cheng; De-Xin Li; Xiao-Ping Dong
Journal:  J Virol Methods       Date:  2010-04-08       Impact factor: 2.014

2.  Multiple evolutionary origins of the fungus causing Panama disease of banana: concordant evidence from nuclear and mitochondrial gene genealogies.

Authors:  K O'Donnell; H C Kistler; E Cigelnik; R C Ploetz
Journal:  Proc Natl Acad Sci U S A       Date:  1998-03-03       Impact factor: 11.205

3.  Deciphering the cryptic genome: genome-wide analyses of the rice pathogen Fusarium fujikuroi reveal complex regulation of secondary metabolism and novel metabolites.

Authors:  Philipp Wiemann; Christian M K Sieber; Katharina W von Bargen; Lena Studt; Eva-Maria Niehaus; Jose J Espino; Kathleen Huß; Caroline B Michielse; Sabine Albermann; Dominik Wagner; Sonja V Bergner; Lanelle R Connolly; Andreas Fischer; Gunter Reuter; Karin Kleigrewe; Till Bald; Brenda D Wingfield; Ron Ophir; Stanley Freeman; Michael Hippler; Kristina M Smith; Daren W Brown; Robert H Proctor; Martin Münsterkötter; Michael Freitag; Hans-Ulrich Humpf; Ulrich Güldener; Bettina Tudzynski
Journal:  PLoS Pathog       Date:  2013-06-27       Impact factor: 6.823

4.  Development and Validation of a TaqMan Real-Time PCR Assay for the Specific Detection and Quantification of Fusarium fujikuroi in Rice Plants and Seeds.

Authors:  Greice Amaral Carneiro; Slavica Matić; Giuseppe Ortu; Angelo Garibaldi; Davide Spadaro; Maria Lodovica Gullino
Journal:  Phytopathology       Date:  2017-05-25       Impact factor: 4.025

5.  Production of Fumonisin B(inf1) and Moniliformin by Gibberella fujikuroi from Rice from Various Geographic Areas.

Authors:  A E Desjardins; R D Plattner; P E Nelson
Journal:  Appl Environ Microbiol       Date:  1997-05       Impact factor: 4.792

6.  Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue.

Authors:  Motoki Goto; Eiichi Honda; Atsuo Ogura; Akio Nomoto; Ken-Ichi Hanaki
Journal:  Biotechniques       Date:  2009-03       Impact factor: 1.993

7.  Early Detection of Airborne Inoculum of Magnaporthe oryzae in Turfgrass Fields Using a Quantitative LAMP Assay.

Authors:  Caterina Villari; Walter F Mahaffee; Thomas K Mitchell; Kerry F Pedley; Michael L Pieck; Francesca Peduto Hand
Journal:  Plant Dis       Date:  2016-10-26       Impact factor: 4.438

8.  LAMP for human African trypanosomiasis: a comparative study of detection formats.

Authors:  Sally L Wastling; Kim Picozzi; Abbas S L Kakembo; Susan C Welburn
Journal:  PLoS Negl Trop Dis       Date:  2010-11-02

9.  Reverse transcription loop-mediated isothermal amplification (RT-LAMP) for rapid detection of viral hemorrhagic septicaemia virus (VHS).

Authors:  H Soliman; M El-Matbouli
Journal:  Vet Microbiol       Date:  2005-12-27       Impact factor: 3.293

10.  Mapping quantitative trait loci responsible for resistance to Bakanae disease in rice.

Authors:  R Abdul Fiyaz; Ashutosh K Yadav; S Gopala Krishnan; Ranjith K Ellur; Bishnu M Bashyal; Nitasha Grover; Prolay K Bhowmick; M Nagarajan; K K Vinod; Nagendra K Singh; Kumble V Prabhu; Ashok K Singh
Journal:  Rice (N Y)       Date:  2016-09-13       Impact factor: 4.783

View more
  7 in total

Review 1.  Loop Mediated Isothermal Amplification: A Promising Tool for Screening Genetic Mutations.

Authors:  Arjuna Srividya; Biswajit Maiti; Anirban Chakraborty; Gunimala Chakraborty
Journal:  Mol Diagn Ther       Date:  2019-12       Impact factor: 4.074

Review 2.  Recent Advances in Molecular Diagnostics of Fungal Plant Pathogens: A Mini Review.

Authors:  Ganeshamoorthy Hariharan; Kandeeparoopan Prasannath
Journal:  Front Cell Infect Microbiol       Date:  2021-01-11       Impact factor: 5.293

3.  Identification of Rice Seed-Derived Fusarium Spp. and Development of LAMP Assay against Fusarium Fujikuroi.

Authors:  Hubiao Jiang; Na Wu; Shaomin Jin; Temoor Ahmed; Hui Wang; Bin Li; Xiaobi Wu; Yidan Bao; Fei Liu; Jing-Ze Zhang
Journal:  Pathogens       Date:  2020-12-22

4.  Development and Validation of a Loop-Mediated Isothermal Amplification Diagnostic Method to Detect the Quarantine Potato Pale Cyst Nematode, Globodera pallida.

Authors:  Maria João Camacho; Maria L Inácio; Manuel Mota; Eugénia de Andrade
Journal:  Pathogens       Date:  2021-06-12

5.  Detection of Potato ring rot Pathogen Clavibacter michiganensis subsp. sepedonicus by Loop-mediated isothermal amplification (LAMP) assay.

Authors:  Hasan Sagcan; Neslihan Turgut Kara
Journal:  Sci Rep       Date:  2019-12-31       Impact factor: 4.379

6.  A LAMP at the end of the tunnel: A rapid, field deployable assay for the kauri dieback pathogen, Phytophthora agathidicida.

Authors:  Richard C Winkworth; Briana C W Nelson; Stanley E Bellgard; Chantal M Probst; Patricia A McLenachan; Peter J Lockhart
Journal:  PLoS One       Date:  2020-01-24       Impact factor: 3.240

7.  Rapid diagnostics for Gnomoniopsis smithogilvyi (syn. Gnomoniopsis castaneae) in chestnut nuts: new challenges by using LAMP and real-time PCR methods.

Authors:  Anna Maria Vettraino; Nicola Luchi; Domenico Rizzo; Alessia Lucia Pepori; Francesco Pecori; Alberto Santini
Journal:  AMB Express       Date:  2021-07-12       Impact factor: 3.298

  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.