Literature DB >> 30840888

APOBEC Mutagenesis and Copy-Number Alterations Are Drivers of Proteogenomic Tumor Evolution and Heterogeneity in Metastatic Thoracic Tumors.

Nitin Roper1, Shaojian Gao1, Tapan K Maity1, A Rouf Banday2, Xu Zhang1, Abhilash Venugopalan1, Constance M Cultraro1, Rajesh Patidar3, Sivasish Sindiri3, Anna-Leigh Brown4, Alexander Goncearenco4, Anna R Panchenko4, Romi Biswas1, Anish Thomas1, Arun Rajan1, Corey A Carter5, David E Kleiner6, Stephen M Hewitt6, Javed Khan3, Ludmila Prokunina-Olsson2, Udayan Guha7.   

Abstract

Intratumor mutational heterogeneity has been documented in primary non-small-cell lung cancer. Here, we elucidate mechanisms of tumor evolution and heterogeneity in metastatic thoracic tumors (lung adenocarcinoma and thymic carcinoma) using whole-exome and transcriptome sequencing, SNP array for copy-number alterations (CNAs), and mass-spectrometry-based quantitative proteomics of metastases obtained by rapid autopsy. APOBEC mutagenesis, promoted by increased expression of APOBEC3 region transcripts and associated with a high-risk APOBEC3 germline variant, correlated with mutational tumor heterogeneity. TP53 mutation status was associated with APOBEC hypermutator status. Interferon pathways were enriched in tumors with high APOBEC mutagenesis and IFN-γ-induced expression of APOBEC3B in lung adenocarcinoma cells, suggesting that the immune microenvironment may promote mutational heterogeneity. CNAs occurring late in tumor evolution correlated with downstream transcriptomic and proteomic heterogeneity, although global proteomic heterogeneity was significantly greater than transcriptomic and CNA heterogeneity. These results illustrate key mechanisms underlying multi-dimensional heterogeneity in metastatic thoracic tumors. Published by Elsevier Inc.

Entities:  

Keywords:  APOBEC; copy number alterations; evolution; heterogeneity; lung adenocarcinoma; proteogenomics; rapid autopsy; thymic carcinoma

Mesh:

Substances:

Year:  2019        PMID: 30840888      PMCID: PMC6461561          DOI: 10.1016/j.celrep.2019.02.028

Source DB:  PubMed          Journal:  Cell Rep            Impact factor:   9.423


INTRODUCTION

Understanding the mechanisms by which metastatic lung adenocarcinoma (LUAD) and thymic carcinoma (TC) evolve may provide greater insight into tumor progression and may guide novel therapeutic avenues. Autopsy programs established to harvest tumor tissue from metastatic sites at the end of life have demonstrated significant heterogeneity depending on tumor type (Campbell et al., 2010; Gundem et al., 2015; Kumar et al., 2016; Liu et al., 2009; Patch et al., 2015; Shah et al., 2009). For example, metastatic pancreatic cancer has high inter-metastatic heterogeneity of genomic rearrangements (Campbell et al., 2010), but not of driver mutations (Makohon-Moore et al., 2017), whereas metastatic clear-cell renal carcinoma has recurrent driver mutations that occur late within individual metastases (Gerlinger et al., 2014), resulting in high inter-metastatic heterogeneity. Within non-small-cell lung cancer (NSCLC), previous work has characterized the evolution of primary tumors and has demonstrated significant intra-tumor heterogeneity in copy-number alterations and driver mutations (de Bruin et al., 2014; Jamal-Hanjani et al., 2017; Zhang et al., 2014b). In these studies, mutations generated by the cytosine deaminase activity of APOBEC (apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like) family of enzymes (substitutions of C with T or G in TCA or TCT motifs (Roberts et al., 2013) were found to occur late in the evolution of primary tumors (de Bruin et al., 2014) and were associated with subclonal mutations (Jamal-Hanjani et al., 2017). However, it is also critically important to understand the evolution of metastatic NSCLC, given metastatic lineages develop early in primary tumor development (Zhao et al., 2016). Thus, the evolution of metastatic disease may be substantially different from primary tumors. Moreover, previous NSCLC tumor heterogeneity studies have largely focused on whole-exome sequencing approaches. The evolution of tumors at the level of transcriptome or proteome and the underlying mechanisms that may generate multidimensional heterogeneity remain largely unknown. Here, we sought to address the following questions: What is the degree of genomic (mutational and copy number), transcriptomic, and proteomic heterogeneity within and between metastases of a given patient? What is the relationship between these three levels of heterogeneity? What are the potential drivers of such heterogeneity? To address these questions, we performed rapid (“warm”) autopsies on four patients with LUAD and one patient with TC. The autopsies were initiated within 3 h of death to allow for procurement of sufficient quantity and quality of DNA, RNA, and protein from metastatic tumor tissue for whole-exome and transcriptome sequencing, DNA copy-number analysis, and mass-spectrometry-based proteomics. Our integrated analysis of the genome, transcriptome, and proteome uncovered key mechanisms likely driving proteogenomic heterogeneity within and across metastatic sites.

RESULTS

Sampling of Metastatic Tumors through Rapid Autopsy Protocol

We have established a rapid (“warm”) autopsy protocol for thoracic malignancies (including lung cancers and thymic epithelial tumors, among others) at the NIH Clinical Center. Under this protocol, patients with metastatic disease who are near the end of life receive inpatient hospice care. Upon death, an autopsy is performed within 3 h to procure sufficient quantity and high-quality of DNA, RNA, and protein from all possible sites of metastatic disease. For this study, we enrolled four patients with LUAD: patients RA000 and RA004 with oncogenic KRAS mutations who were previous smokers and patients RA003 and RA005 with EGFR mutations who were both non-smokers. We additionally enrolled patient RA006 with squamous cell TC, a non-smoker, who died within 1.5 years of diagnosis after no response to treatment (Table S1). All our study patients, except for patient RA000, were diagnosed with stage IV disease, had received chemotherapy and/or targeted therapy (range 2–8 lines of therapy), and were previously enrolled in a clinical trial at the NIH Clinical Center (Table S1). For each patient, we harvested 44–183 metastatic tumor lesions from multiple organs, including lung, liver, and kidney (Table S1). We selected a total of 40 tumor samples for further analyses based on tumor content by histology (Figure 1; Data S1). Before analysis, three samples with sequencing data were removed from the study because of low tumor content (Table S1). Additional tumor tissue collected from the likely primary site at the time of diagnosis was available for whole-exome sequencing in three patients (RA000, RA003, and RA006).
Figure 1.

Flowchart of Study

Five patients underwent rapid autopsy (defined here as within 3 h of patient death). Thirty-three metastatic lung adenocarcinoma (LUAD) and 7 metastatic thymic carcinoma tumors from lung, liver, and kidney were subjected to whole-exome sequencing (WES), RNA sequencing, copy-number analysis, and mass-spectrometry-based proteomics, followed by assessment of intra- and inter-metastatic tumor heterogeneity. Three samples were removed from the study after sequencing because of low tumor content.

Intra- and Inter-Metastatic Mutational Tumor Heterogeneity Is Highly Variable within Patients and Can Be Extreme

For each patient, we performed whole-exome sequencing (WES) of the metastatic tumors, primary tumors, where available, and matched germline DNA. A range of 182 (RA005) to 1,058 (RA003) non-silent mutations were identified per patient (Table S2). RNA sequencing (RNA-seq) demonstrated a high, independent validation rate of WES (Data S2), similar to previous studies (Network, 2014). We found significant mutational heterogeneity within each patient with non-truncal variants ranging from 67% in RA000 to 99% in RA003 (Figure 2A).
Figure 2.

Intra- and Inter-metastatic Heterogeneity of Somatic Mutations of Tumors from All Autopsy Patients

(A) Heatmaps depict the distribution of non-silent somatic mutations among metastatic and, where available, primary tumors for each patient. Driver mutations are listed to the left of each heatmap. The total number of non-silent mutations and the percentage of non-truncal mutations are shown below each heatmap. The bars to the right of each heatmap summarizes intra- and inter-metastatic heterogeneity; mutations present in all regions (purple), in more than one, but not all (green), or only in one region (brown).

(B and C) Jaccard similarity coefficients of metastases within each patient based on mutations identified by exome sequencing (B) and expressed variants by RNA-seq (C). Each circle represents the Jaccard similarity coefficient between two metastases. Coefficients range from zero to one representing highest and lowest heterogeneity, respectively. The p value for the difference in mean Jaccard similarity coefficients between two groups of patients is shown. P, tumor sample obtained at diagnosis; L, lung tumor at autopsy; Li, liver tumor at autopsy; K, kidney tumor at autopsy.

Activating mutations in EGFR (RA003) and KRAS (RA000, RA004) were present in primary and all metastatic tumors of the respective patients. However, an activating HRAS mutation was present in all metastatic sites of patient RA006 at autopsy, but not in the primary tumor at the time of diagnosis. Patients RA003 and RA006 had an average of 12 and 14 non-truncal driver mutations, respectively. In contrast, there was an average of only 3.7 non-truncal driver mutations in the other three patients (RA005, RA004, and RA000), demonstrating variability in metastatic site-specific driver mutation acquisition among patients (Figure 2A). Intra-tumor mutational heterogeneity in driver mutations was found when tested in RA003 tumors L2d/L2e (Figure 2A). Next, we calculated Jaccard similarity coefficients (defined as the ratio of shared to all mutations between two metastatic tumors) for each patient to quantitatively assess intra- and inter-metastatic tumor genomic heterogeneity (values 0–1 correspond to the range from minimal to maximal heterogeneity (Blokzijl et al., 2016; Makohon-Moore et al., 2017) (Table S3). The means of the Jaccard similarity coefficients for each patient ranged from 0.25 (RA003) to 0.73 (RA000) and were significantly different between patients (p = 2.2 × 10−16, Kruskal-Wallis ranksum test; Figure 2B). Two patients, RA003 and RA006, were clear outliers and exhibited what we termed “extreme” mutational heterogeneity. These two patients had significantly lower combined mean Jaccard similarity coefficients compared to the other patients (mean 0.28 vs. 0.57, p = 2 × 10−16, chi-square test) (Figure 2B). Jaccard similarity coefficients exhibited a similar trend based on expressed mutations identified by RNA-seq analysis (Figure 2C). Additional sequencing resulting in a median exome coverage of 487× (range 435 to 528) for the tumors from patients RA003 and RA006 did not substantially alter the observed extreme level of heterogeneity (Figure S1; Table S3). To further evaluate mutational heterogeneity within each patient, we applied PyClone to estimate the proportion of cancer cells identified with a given mutation and the clonal structure of each tumor. As expected, truncal, key driver mutations, such as EGFR and KRAS, were clonal with high cellular prevalence whereas many shared or private mutations had medium to lower cellular prevalence (subclonal) (Table S2). Patient RA003 had the highest number of subconal mutations (range 243–506), followed by patients RA006 (range 23–103) and RA005 (40–85) and then patients RA004 (range 4–50) and RA000 (2–53) (Table S2). Similarly, patient RA003 had the largest and highest number of subclonal clusters, followed by patients RA006 and RA005 (Figure S2A). In contrast, patients RA004 and RA000 had very few subclonal clusters (Figure S2A), demonstrating differences in clonal structure between patients. However, mutations that may be lost because of copy-number loss were not accounted for in these analyses (McPherson et al., 2016). Collectively, these results indicate that intra- and inter-metastatic mutational heterogeneity can vary considerably among patients, with extreme heterogeneity evident in a subset of patients.

APOBEC Mutagenesis Strongly Correlates with Mutational Tumor Heterogeneity

Next, we generated phylogenetic trees by two independent methods, and both showed a similar evolutionary pattern (Figures 3 and S2B–S2E). We then analyzed mutational signature profiles for each tumor by layering phylogenetic trees with mutational signatures to elucidate whether specific mutational processes could explain the observed variability in mutational tumor heterogeneity. Smoking signature mutations (C → A) were highly prevalent in patients RA000 and RA004, who were smokers (Figure 3). Mutations generated by the cytosine deaminase activity of APOBEC were most prevalent in patients RA003, RA005, and RA006, all of whom were non-smokers (Figure 3; Data S3). Smoking signature mutations were generally truncal, whereas APOBEC signature mutations were largely in the shared and private branches of the phylogenetic trees (Figures 3A–3E; Data S3).
Figure 3.

Inferred Phylogeny, Mutational Signatures, and APOBEC-Associated Heterogeneity

(A–E) Phylogenetic trees were generated by the Phangorn method from all validated mutations identified by whole-exome sequencing from tumors within patient RA003 (A), RA006 (B), RA005 (C), RA000 (D), and RA004 (E) using the maximum parsimony method. Trees are rooted in mutations common to all tumors within each patient. Trunk and branch lengths are proportional to the numbers of mutations acquired on the corresponding trunk or branch. Each private branch represents mutations unique to each individual tumor. Colors represent COSMIC mutational signatures. Select driver mutations and focal copy-number amplifications/deletions are mapped to the trunks and branches as indicated. Asterisks denote nonsense mutations.

(F–H) APOBEC fold enrichment correlates with Jaccard similarity coefficients across NCI autopsy patient tumors based on exome variants (F), expressed variants (G), and TRACERx lung adenocarcinoma patient tumors (patients with five or more tumors shown) (H). Each circle represents mean APOBEC fold enrichment and the Jaccard similarity coefficient between two tumors from a given patient. P, tumor sample obtained at diagnosis; L, lung tumor at autopsy; Li, liver tumor at autopsy; K, kidney tumor at autopsy.

P-values for correlation coefficients are shown.

To further assess the timing of APOBEC-induced mutagenesis, we evaluated mutational signatures in available tumors collected at the time of diagnosis. We found no evidence of APOBEC mutagenesis in these samples, including those from patients RA003 and RA006 (Figures 3A and 3B), indicating that APOBEC signature mutations were acquired later during further progression of metastatic disease. Next, we evaluated the relationship between APOBEC mutagenesis and mutational heterogeneity. APOBEC mutation fold enrichment, a measure of APOBEC mutagenesis (Roberts et al., 2013) (Table S4), strongly correlated with Jaccard similarity coefficients based on WES variants (Pearson rho = −0.66, p = 2.2 × 10−16) and expressed variants by RNAseq (Pearson rho = −0.55, p = 7.704 × 10−8) (Figures 3F and 3G). To validate this finding, we examined the relationship between APOBEC mutagenesis and mutational heterogeneity in the TRACERx cohort of 17 LUAD patients with five or more sites of multi-region exome sequencing (133 total tumors)(Jamal-Hanjani et al., 2017). In line with findings in our cohort, we found APOBEC mutagenesis strongly correlated with Jaccard similarity coefficients (Pearson rho = −0.4689, p = 1.255 × 10−8) in the TRACERx cohort (Figure 3H). Thus, these results suggest that APOBEC mutagenesis is a significant contributor to the generation of mutational tumor heterogeneity.

Expression of APOBEC3 Region Transcripts Correlates with APOBEC Mutagenesis

Previous analyses of early-stage TCGA LUAD patients have shown a weak but significant association between expression of APOBEC3 transcripts and APOBEC mutagenesis (Chan et al., 2015). We examined RNA-seq data from our metastatic cohort to determine whether APOBEC3 region transcript expression contributed to the observed variability in APOBEC mutagenesis. Among the LUAD patients, we found APOBEC3B to be expressed at higher levels than APOBEC3A; this was particularly evident in the tumors of patient RA003 (Figure 4A). APOBEC mutagenesis (measured here by the counts of tCw to tTw and tGw mutations) (Roberts et al., 2013) was highly correlated with APOBEC3B expression (Pearson rho = 0.68, p = 9.4 × 10−5), but not with APOBEC3A expression (Pearson rho = 0.19, p = 0.34) (Figures S3A and S3b). Analysis of isoform-specific expression of APOBEC3A and APOBEC3B with custom TaqMan assays confirmed these results (Figures S3C and S3D). Moreover, in multiple tumors of patient RA003 with significant APOBEC mutagenesis, APOBEC3B was expressed 20- to 50-fold higher than APOBEC3A (Figures 4A and 4B).
Figure 4.

Relationship between APOBEC Fold Enrichment, Mutational Signatures, APOBEC3 Region Transcript Expression, APOBEC3AB Germline Variant, and Mutant TP53

(A) APOBEC fold enrichment of each tumor. Asterisks denote significant enrichment. The dashed line denotes zero enrichment of APOBEC mutations. The proportion of COSMIC signatures for each tumor appears below APOBEC fold enrichment. The number of risk alleles for APOBEC3 germline variant rs12628403 is shown below the proportion of COSMIC signatures. The expression of APOBEC3B, APOBEC3A, and APOBEC3AB is shown below the proportion of COSMIC signatures.

(B and C) The relative expression of isoforms APOBEC3B1, APOBEC3A1, and APOBEC3AB in tumor relative to normal lung or liver by custom TaqMan assays in patient RA003 (B) and patient RA006 (C). Six of the 37 tumors are not included here because of insufficient RNA for sequencing. (D–F) APOBEC signature mutations per megabase in the TCGA (D) and in the Broad dataset (E) and the total APOBEC mutations in TRACERx dataset (F) in TP53 mutant compared with TP53 wild-type tumors.

(G and H) APOBEC3B expression (G) and APOBEC3A expression (H) in TP53 wild-type and mutant tumors in the TCGA dataset. p values shown are adjusted for patient age and the number of pack years smoked.

‡visual inspection of RNA-seq data shows expression of APOBEC3AB.

See Figure S4E for details.

To elucidate factors affecting APOBEC mutagenesis in our patients, we genotyped an APOBEC3 germline variant, rs12628403, associated with increased APOBEC mutagenesis (Nik-Zainal et al., 2014). This germline variant is a proxy for a 30-kb deletion that fuses the coding region of APOBEC3A with the 3′ UTR of APOBEC3B to generate a chimeric APOBEC3A-APOBEC3B (APOBEC3AB) transcript. This chimeric transcript is more stable than the APOBEC3A transcript and leads to higher APOBEC3A protein levels in vitro (Caval et al., 2014). Only patient RA006, the TC patient, was a carrier of the rs12628403 allele and was predicted to generate the APOBEC3AB transcript (Figure 4A). Indeed, APOBEC3AB expression in tumors of this patient was identified by RNA-seq (Figure 4A) and validated using a TaqMan assay (Figure 4C). However, the APOBEC3B transcript was also expressed in tumors from this patient, suggesting that both may have contributed to APOBEC mutagenesis. Expression of APOBEC3B (Pearson rho = 0.77, p = 0.08) and APOBEC3AB (Pearson rho = 0.62, p = 0.18), but not APOBEC3A (Pearson rho = 0.23, p = 0.67), significantly correlated with APOBEC mutagenesis in all tumors from patient RA006 (Figures S4A–S4C). Although expression of APOBEC3AB was lower than APOBEC3B (Figure 4C), APOBEC3A encoded by APOBEC3AB is considered a more potent inducer of mutagenesis than APOBEC3B (Caval et al., 2014; Landry et al., 2011). Therefore, we quantified the contribution of APOBEC3A and APOBEC3B to APOBEC mutagenesis by calculating YTCA and RTCA enrichment (where Y is a purine and R is a pyrimidine), attributed to differential activity of these enzymes (Chan et al., 2015). In all tumors with high APOBEC mutagenesis from patient RA006, there was significant enrichment of YTCA compared to RTCA (Figure S4D), thereby suggesting APOBEC3A-like mutagenesis as a likely driver of extreme heterogeneity in this metastatic TC patient with a germline APOBEC3AB deletion. Together, our results implicate expression of APOBEC3 region transcripts as a mediator of APOBEC mutagenesis in metastatic LUAD and TC.

TP53 Mutations Are Associated with APOBEC Hypermutator Status in LUAD

Given the role of TP53 in repressing APOBEC3B expression (Periyasamy et al., 2017), we hypothesized that mutant TP53, detected only in the LUAD patient RA003, may be contributing to high APOBEC3B expression and increased APOBEC mutagenesis. We found mutant TP53 was associated with APOBEC hypermutator status (Nik-Zainal et al., 2014) in our cohort and in three independent LUAD datasets (Imielinski et al., 2012; Jamal-Hanjani et al., 2014; Network, 2014) (Table S5). Moreover, mutant TP53 was also associated with significantly higher counts of APOBEC signature mutations, higher expression of APOBEC3B, and an increase in APOBEC3A, compared with wild-type TP53 tumors in the TCGA dataset (Figures 4D–4H). Thus, our results suggest mutant TP53 contributes to increased APOBEC3B expression, APOBEC mutagenesis, and is associated with APOBEC hypermutator status in LUAD.

Integration of Copy Number, Transcript, and Protein Abundance Highlights Mechanisms of Proteomic Heterogeneity

To evaluate multi-dimensional heterogeneity, we plotted Pearson correlation coefficients (PCCs) for each data type between pairs of tumors for each patient across all genes for which copy number, transcript expression, and protein abundance data were available (Figures 5A–5E). Each patient displayed variable patterns of heterogeneity across each data type. Patient RA003 exhibited the least (Figure 5A), whereas patient RA004 the most (Figure 5D) heterogeneity. Patient RA005 showed the most heterogeneity in gene expression and protein abundance only between tumor L5d and tumors L2a/L2b/L5c (Figure 5C). Patient RA006 showed lower heterogeneity in copy number, gene expression, and protein abundance within three pairs of tumors (L20b/L5a, Li3c/Li1a, L12a/L3a) compared to other pairs (Figure 5B).
Figure 5.

Intra-Patient Multi-Omic Tumor Relationships

(A–E) Pearson correlation coefficients (PCCs) are shown on each axis across all common genes identified in copy number, gene expression, and protein abundance datasets between all tumors within patient RA003 (A), RA006 (B), RA005 (C), RA004 (D), and RA000 (E). Each circle represents the relationship between two tumors. Previously designated tumor clusters are assigned the same color. Colors are independently assigned for each patient.

(F) PCCs between tumors from each patient grouped by data type: copy number, gene expression, and protein abundance. p values for the difference in mean PCCs between data types are shown for each patient.

Next, we plotted PCCs within each patient for each data type. Protein heterogeneity was significantly greater than gene expression and copy-number alteration (CNA) heterogeneity within all patients (Figure 5F). We then performed pairwise comparison of the PCCs of each data type, including a separate analysis using exome copy-number data that was corrected for tumor purity (Figure S5; Table S6). We found a strong, positive linear correlation between CNA heterogeneity and protein heterogeneity for patients RA004 and RA006, but not for the other patients (Figures S5A, S5D, S5G, S5J, and S5M), providing evidence that CNAs can lead to protein heterogeneity in these patients. Gene expression heterogeneity was also associated with protein heterogeneity but only in patients RA000 and RA006 (Figures 5B and 5N). Together, these results demonstrate high heterogeneity in protein abundance between metastases of these patients that partly stems from heterogeneity in CNAs and gene expression.

Late-Event CNAs Contribute to Heterogeneity in Gene Expression and Protein Abundance

Next, we performed hierarchical clustering by chromosomal cytoband, gene expression, and protein abundance to further evaluate heterogeneity within each data type. Metastases from each patient clustered together for CNAs, gene expression, and protein abundance (Figures 6A and S6A–S6C). Metastases from patients RA004 and RA006 showed the lowest correlation in protein abundance (Figures S6D and S6E) and clear differences in CNAs (Figure 6A; Table S7). To explore the downstream effects of CNAs, we plotted gene expression and protein abundance ratios of genes within each chromosomal arm between metastatic lineages of each patient (Figures 6B and 6C; Table S8; Data S4). Arm-level CNAs within tumors of patients RA006 and RA004 corresponded with changes in gene expression and protein abundance of genes at the corresponding arm level. For example, copy-number differences in arm 4p between RA006 tumors corresponded with changes in expression and protein abundance (Figure 6B). Where there were no copy-number differences, such as in arm 7q in patient RA006 and arms 4p/7q of patient RA003, there were no corresponding changes in gene expression and protein abundance (Figure 6C).
Figure 6.

Copy-Number Heterogeneity Corresponds with Transcriptomic and Proteomic Heterogeneity

(A) Hierarchical clustering by copy number across the genome across all tumors from all patients (at cytoband resolution). Losses (purple) and gains (red) in log2 scale are depicted relative to mean ploidy. Mean ploidy is shown in the top row (rounded to nearest integer)..

(B and C) Copy-number differences in chromosomal arms 4p and 7q between tumors of patient RA006 (B) and patient RA003 (C) and corresponding changes in FPKM and protein abundance. Probability density plots show the log ratios of mean FPKM by chromosomal arm for sets of tumors as displayed. The dashed line on the x axis represents the ratio of 1 (or log ratio 0). For visualization purposes, the x axis was cut at log −1 and 1 for RNA and log −0.1 and 0.1 for protein. The y axis was cut at a probability density of 2..

(D) The phylogenetic tree depicts tumors of patient RA004 with corresponding copy number and RNA-seq FPKM of CCND1 for each tumor..

(E) Protein expression of CCND1 for tumors of patient RA004 as assessed by immunohistochemistry from tissue microarrays.

Heterogeneity in focal-level CNAs also corresponded with changes in RNA and protein. For example, CCND1 was highly amplified in patient RA004 tumors L2a, L3a, and L8b (Table S9), which corresponded with high gene and protein expression. On the other hand, tumors L1b and L1c in which there was minimal increase in CCND1 copy number and gene and protein expression were low (Figures 6D and 6E). Interestingly, among patient RA004 liver and kidney tumors, Li1b and K1, CCND1 was highly amplified with correspondingly high protein but moderate gene expression, suggesting tissue-specific discordance of gene and protein expression of select genes (Figures 6D and 6E). Next, we constructed circos plots (Data S5) and phylogenetic trees based on CNAs for each patient. Both arm- and focal-level CNAs largely occurred early in tumor development (i.e., truncal) in patients RA000, RA003, and RA005 (Figures 3 and S7A, S7B, and S7D) but occurred later in tumor development (i.e., shared and private) in patients RA004 and RA006 (Figures 3, S7C, and S7E). These results suggest that late, not early, CNAs likely contributed to the observed changes in gene expression and protein abundance between metastases of these patients. Differential focal and arm-level CNAs may reflect ongoing chromosomal instability as well as selective pressure during evolution of metastatic lineages.

Enrichment of Interferon Signaling Pathways in Tumors with High APOBEC3 Expression and Immune Heterogeneity

Next, we sought to decipher common gene sets or pathways within the RNA-seq and mass-spectrometry-based quantitative proteomics data that were heterogeneously enriched within each patient. Using an unbiased approach with single-sample gene set enrichment analysis (ssGSEA) (Barbie et al., 2009; Subramanian et al., 2005), we found interferon (IFN)-signaling pathways (related to possible activity of the IFNs: type I [IFN-α, IFN-β], type II [IFN-γ], and type III [IFN-λ1–4]), were the most significantly and differentially enriched pathways within patient RA003 (tumors L1 and L4a) and RA006 (tumors L20b, L5a, Li1a, and Li3c) (Figures 7A–7D) at both gene expression and protein abundance levels. No common outlier gene sets were identified for the negatively enriched pathways. Within the tumors from patients RA000, RA004, and RA005, no recurrent, common pathways were identified by GSEA of both the transcriptome and proteome (Table S9). The six tumors from patients RA003 and RA006 that were enriched in IFN-signaling pathways also had the highest expression of APOBEC3 region transcripts (Figure 4A). To validate these findings in a larger cohort, we interrogated the TCGA LUAD dataset. We found the expression of STAT1, a downstream effector of IFN-γ signaling, was higher in LUAD tumors with increased expression of both APOBEC3A and APOBEC3B (Figures S8A and S8B). Multiple other genes within IFN-α and IFN-γ pathways were also significantly associated with expression of APOBEC3A and APOBEC3B in the TCGA LUAD dataset (Table S10). To test whether APOBEC3A and APOBEC3B can be induced by IFNs, we treated three LUAD (A549, HCC4006, and H1975) and two immortalized normal lung epithelial cell lines (HBEC and HPL1D) with IFN-γ. These cell lines were chosen to represent major driver subtypes of LUAD (KRAS and EGFR) and normal lung epithelium. At baseline, expression of APOBEC3B was generally higher than expression of APOBEC3A. Treatment with IFN-γ led to a significant increase in expression of APOBEC3B, whereas expression of APOBEC3A increased significantly, but marginally, in only A549 and HCC4006 cells (Figure 7E). Thus, our results suggest IFN-signaling contributed, in part, by the tumor microenvironment, is a potential mechanism of heterogeneity of LUAD tumors with increased APOBEC3B transcript expression.
Figure 7.

Site-Specific Enrichment of Interferon Signaling Pathways, Immune Signature Heterogeneity, and the Effect of Interferon on Expression of APOBEC3 Genes among Lung Cancer and Epithelial Cell Lines

(A–D) Single-sample gene set enrichment (ssGSEA) analysis of transcriptome and proteome using the REACTOME databases are shown for tumors from patients RA003 (A and B) and RA006 (C and D). Significantly enriched interferon pathways (q < 0.05 for transcriptome, p < 0.10 for proteome) are colored red..

(E) APOBEC3A and APOBEC3B expression among lung cancer cell lines A549, HCC4006, and H1975 and immortalized normal lung epithelial cell lines HBEC and HPL1D treated with interferon-gamma. p values were calculated between time points as indicated for the significant changes using two-sided t tests. Data are shown as values for individual biological replicates (n = 3) and mean (red bars), normalized to endogenous controls and presented on the log2 scale.

(F and G) Immune signature scores within the transcriptome. (F) and proteome (G) are shown between all tumors of patients RA000, RA003, RA004, RA005, and RA006. Scores were normalized across all tumors separately for transcriptome and proteome. ES, enrichment score; IFN, interferon; A3A, APOBEC3A; A3B, APOBEC3B. Symbols denote comparisons between groups of tumors as indicated.

To further interrogate heterogeneity in the immune microenvironment between tumors of each patient in an unbiased manner, we analyzed the gene expression and protein abundance data using ssGSEA based on CIBERSORT immune genes (Newman et al., 2015) and an alternative immune scoring method (Aran et al., 2017) (Table S10). The overall immune signature score for tumors within each patient considerably varied between transcriptome and proteome in patients RA003 and RA005 (Figures 7F and 7G). Patients RA000 and RA004 showed low and high overall immune signature scores, respectively. In contrast, tumors from patient RA006 showed large and consistent differences in immune signature scores across both the transcriptome and proteome (high in L20b and L5a vs. low in L12a, L3a, Li1a, Li3c), demonstrating heterogeneous immune cell infiltration in the tumor microenvironment of this patient (Figures 7F and 7G).

DISCUSSION

Genomic, transcriptomic and proteomic analyses of tumors from multiple anatomic sites sampled through rapid autopsy offer a unique opportunity to comprehensively explore the biological processes that shape the evolution of metastatic tumors. Here, we have characterized the proteogenomic evolution of metastatic lung and thymic carcinoma through exome and transcriptome sequencing, CNA analysis, and unbiased quantitative mass spectrometry-based proteomics of 37 metastatic tumors acquired through rapid autopsy. Through this integrative analysis, we have uncovered insights into the mechanisms likely driving the mutational, transcriptomic, and proteomic landscape of these metastatic tumors. At the genomic level, we provide evidence that APOBEC mutagenesis is a driver of mutational heterogeneity in metastatic lung and thymic carcinoma tumors. APOBEC mutagenesis has been described as one of the most common mutational processes second only to “ageing” (Alexandrov et al., 2013). To date, however, within thoracic tumors, this process has been described mostly in primary tumors (Burns et al., 2013a, 2013b; de Bruin et al., 2014). These studies have shown APOBEC mutagenesis to be associated with subclonal mutations that occur late in the evolution of primary tumors and within spatially distinct regions (de Bruin et al., 2014; Jamal-Hanjani et al., 2017). In our study, we identified a subset of patients with high APOBEC mutagenesis in metastases, but not in the primary tumors, suggesting APOBEC mutagnesis can generate mutations late in the evolution of metastatic disease. Given that all patients in our cohort received prior treatment, we cannot exclude the possibility that therapy contributed to the observed findings. However, recent studies assessing tumors pre- and post-chemotherapy in multiple tumor types did not find an increase in overall mutational load or a significant increase in APOBEC signature mutations (Liu et al., 2017; Noorani et al., 2017). Moreover, the patients in our cohort with the highest level of APOBEC mutagenesis, RA003 and RA006, received the least therapy. Additionally, we demonstrated increased mutational heterogeneity with increasing APOBEC mutagenesis among the TRACERx cohort, which explored intra-tumor heterogeneity in primary lung cancer among patients without previous chemotherapy, further validating the results in our cohort of metastatic tumors (Figure 3H). While the existence of mutational heterogeneity in metastases has been previously described (Campbell et al., 2010; Yachida et al., 2010), the mechanisms remained unclear (Vogelstein et al., 2013). Our data suggest APOBEC mutagenesis can generate both putative driver and passenger mutations late in metastases, thereby generating inter-metastatic mutational heterogeneity that in some cases can be extreme. These results stand in contrast to recent genomic studies of the metastases of patients with pancreatic (Makohon-Moore et al., 2017) and prostate (Kumar et al., 2016) cancer, which have shown limited mutational heterogeneity and no significant APOBEC mutagenesis (Roberts et al., 2013). Both of these tumor types have shown no evidence of APOBEC mutagenesis within primary tumors highlighting the likely histologic specificity of this process. Ultimately, the clinical importance of APOBEC mutagenesis will be determined by the response of heterogeneous metastatic tumors—with and without APOBEC signature mutations—to chemotherapy, targeted agents and/or immunotherapy. Both APOBEC3A and APOBEC3B have been shown to localize to the nucleus (Lackey et al., 2013) leading to potent DNA damage (Taylor et al., 2013), deaminase activity and base substitutions in the genome (Burns et al., 2013a; Shinohara et al., 2012). Upregulation of APOBEC3B causes APOBEC signature mutations in vitro (Akre et al., 2016). Expression of APOBEC3A and APOBEC3B also has been associated with APOBEC signature mutations in primary tumors from multiple cancer types including LUAD (Burns et al., 2013a, 2013b; Chan et al., 2015; Leonard et al., 2013). However, it is unclear whether the same transcripts promote APOBEC mutagenesis in metastatic lung and thymic carcinoma tumors. In our set of metastatic tumors, we observed a strong correlation between expression of APOBEC3B and APOBEC3AB transcripts and APOBEC mutagenesis, suggesting expression of such transcripts may be a more dominant mechanism of APOBEC mutagenesis in metastatic thoracic tumors as opposed to earlier stage disease. These results are in line with recent work in breast cancer that has shown higher APOBEC3B expression in metastatic disease compared to early-stage primary tumors (Sieuwerts et al., 2017). Mutant TP53 has been previously associated with higher APOBEC signature mutations in breast cancer (Burns et al., 2013a) and there is recent evidence that TP53 can repress APOBEC3B expression through direct transcriptional regulation of its promoter (Burns et al., 2013a; Menendez et al., 2017; Periyasamy et al., 2017). Our results suggest mutant TP53 may be an important contributor of increased APOBEC3B and subsequent generation of APOBEC signature mutations in LUAD. In particular, we show mutant TP53 is associated with APOBEC hypermutator status in LUAD using three large-scale independent datasets. It is important to analyze APOBEC hypermutator and TP53 mutation status and the resultant mutational heterogeneity in future clinical trials. Expression of the APOBEC3AB transcript was captured in our study by the presence of the APOBEC3 germline variant, rs1262840, within thymic carcinoma patient RA006. This germline variant has been previously associated with increased APOBEC signature mutations in primary breast cancer tumors (Nik-Zainal et al., 2014). Whether this variant is also associated with high APOBEC mutagenesis and mutational heterogeneity within thymic carcinoma is unknown, as no previous multi-region sequencing study has been performed on this rare tumor type. Additionally, to our knowledge, apart from the current study, this variant has not been examined in relation to APOBEC mutagenesis in metastatic disease. Given that this germline variant can be easily tested utilizing blood DNA, our results warrant further testing of the association between this APOBEC3 germline variant with APOBEC mutagenesis and mutational tumor heterogeneity in thymic carcinoma as well as other metastatic tumor types. Our integrated CNA, RNA-seq, and quantitative mass spectrometry study demonstrates that late-event CNAs can be important drivers in the evolution of metastatic cancer through downstream changes in transcript and protein abundance. Early studies in yeast showed CNAs for a given gene lead to proportional increases in protein abundance (Hughes et al., 2000; Pavelka et al., 2010; Rancati et al., 2008; Torres et al., 2007). More recently, studies in primary tumors demonstrated variability in CNA to protein cis-effects (Mertins et al., 2016; Zhang et al., 2014a, 2016). In metastatic disease, multiple studies have reported late-event CNAs (Campbell et al., 2010; Ding et al., 2010; Gerlinger et al., 2014; Hieronymus et al., 2014; Robinson et al., 2015; Yates et al., 2015), but the effect of CNAs on transcript and protein abundance has not been examined. In one recent metastatic pancreatic cancer study, CNA differences among tumor suppressor genes were not evident at the protein level by IHC suggesting late-event CNAs can be stochastic changes rather than evolutionary selected events (Makohon-Moore et al., 2017). In the current study, all patients had some evidence of late-event CNAs. However, only patients with significant differences in late-event CNAs between tumors exhibited corresponding differences in transcript and protein abundance. In light of the recent association between copy-number heterogeneity and increased recurrence and death in early-stage NSCLC (Jamal-Hanjani et al., 2017), our results raise the question of whether late-event CNAs, through downstream effects on gene expression and protein abundance, can result in worse outcomes for a subset of patients with metastatic cancer. Proteomic heterogeneity induced, in part, by CNAs may also explain why chromosomal instability (CIN) has been associated with poor outcomes in cancer (Carter et al., 2006; Choi et al., 2009; Jamal-Hanjani et al., 2017; Walther et al., 2008). Importantly, proteomic heterogeneity in our set of metastatic tumors, was much higher than CNA and transcriptomic heterogeneity, suggesting other mechanisms, such as epigenetic and post-translational modifications, also may be important drivers of proteomic heterogeneity. Through our unbiased analysis of transcriptomic and proteomic data, we found enrichment of IFN signaling within the microenvironment of tumors of patients with the highest APOBEC3 region transcript expression. Moreover, we show that in LUAD and normal lung epithelial cell lines, APOBEC3B expression, and in some LUAD cell lines, APOBEC3A expression can be induced by IFNγ treatment. These data suggest IFN signaling within the tumor microenvironment may, in part, influence APOBEC3 region transcript expression and thereby contribute to heterogeneity in APOBEC signature mutations within the tumors of a given patient. We also found transcriptomic and proteomic heterogeneity in immune signatures within and between patients. Major advances have been made in the treatment of metastatic tumors, including LUAD and TC, through immunotherapies such as immune checkpoint blockade (Borghaei et al., 2015; Giaccone et al., 2018). Nonetheless, only a subset of patients responds and multiple metastases within a given patient may respond differently because of immune heterogeneity (Reuben et al., 2017). Even without immunotherapy, metastases within a patient may also have differing tumor immune microenvironments, as we demonstrate within TC patient RA006 and as has been recently shown within an ovarian cancer patient (Jiménez-Sánchez et al., 2017). We further demonstrate that, within a given patient, the tumor immune microenvironment may exhibit substantial differences between the transcript and protein expression, adding to the complexity of assessing the immune microenvironment. One of the strengths of our study is the comprehensive examination of tumor heterogeneity by integrating genomic (exome, CNA), transcriptomic (RNA-seq) and proteomic (global mass spectrometry analysis for protein abundance) data from multiple metastatic tumors procured through rapid autopsy. One of the limitations of our study is that all autopsy patients in this study were diagnosed at the late stage of metastatic disease. Hence, we were unable to conduct a complete temporal analysis of tumor evolution from early- to late-stage disease. The ongoing TRACERx study (Jamal-Hanjani et al., 2014, 2017) and corecruitment of those patients to the PEACE (Posthumous Evaluation of Advanced Cancer Environment) post-mortem study (Abbosh et al., 2017) will allow for better elucidation of the evolution primary tumor to metastatic advanced disease, including at the end of life. In conclusion, in this report, we present the heterogeneous genomic, transcriptomic, and proteomic landscape of metastatic lung and thymic carcinoma as well as identify possible mechanisms underlying such multi-level heterogeneity. High activity of the APOBEC3 enzymes, represented by transcript expression, and modulated by germline variation, mutant TP53, and the immune microenvironment, can greatly alter the genomic landscape between metastatic tumors of a given patient. Arm-level and focal CNAs occurring later in tumor evolution can generate significant downstream heterogeneity through effects on gene expression and protein abundance. Further studies by comprehensive analyses of multiple metastatic sites from larger patient populations, including different tumor types, are warranted to validate these mechanisms. Such an endeavor requires development of rapid autopsy programs, meticulous collection and processing of tumors from all possible sites of disease and integrated “omics” analyses. These tumor heterogeneity studies will be integral for evaluating the outcomes of ongoing clinical trials, developing new paradigms in clinical trial design, and, ultimately, to improve survival for patients with metastatic cancer.

STAR★METHODS

CONTACT FOR REAGENT AND RESOURCES SHARING

Further information and requests for reagents may be directed to and will be fulfilled by the Lead Contact, Udayan Guha (udayan.guha@nih.gov).

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Biospecimen Acquisition

Samples were obtained from five patients diagnosed with thoracic malignancies who underwent rapid autopsy. Informed consent for rapid autopsy was obtained under an IRB approved protocol 13-C-0131 (NCT01851395) entitled “A Pilot Study of Inpatient Hospice with Procurement of Tissue on Expiration in Thoracic Malignancies.” Patients previously treated at the NCI and with life expectancy less than 3 months were offered inpatient hospice treatment at the Clinical Center of the National Institutes of Health and upon death autopsies were initiated within 3 hours. Clinical information, including the sex, gender of each patient is available in Table S1. One patient, RA003, elected to receive end of life care at home and was subsequently transported to the NIH Clinical Center post-mortem. Prioritization of lesions removed at autopsy was based on CT scan performed within one month before death. All tumors within each patient were removed by an experienced pathologist and macro dissected to remove surrounding non-neoplastic tissue. Punch biopsy needles were used to obtain spatially distinct cores from each tumor. One-third of each tissue core sample was fixed in 10% buffered formalin, one-third in optimal cutting temperature compound (OCT) and the remaining tissue was immediately flash frozen in liquid nitrogen and stored at −80°C. For each tissue sample, a 5-μm section was taken to create a hematoxylin and eosin slide to visualize neoplastic cellularity using a microscope. For each patient, normal tissue, if available, and/or a blood sample was used as a normal control. DNA and RNA was isolated from approximately 30 mg of snap-frozen tumor tissue using the All Prep DNA/RNA Mini Kit (QIAGEN). RNA was partially degraded with an average RNA integrity number 5.17 but was comparable between organs of different patients and similar in quality to previous postmortem studies. To ensure adequate quality, samples RA003_L2f, RA006_LN2a, RA005_L4a were removed post-sequencing but before analyses due to low tumor content (less than 20 percent) based on Sequenza purity estimates.

METHOD DETAILS

Whole-exome sequencing data processing, variants calling, filtering and annotation

Whole-exome sequencing of tumor and normal samples was performed at a sequencing core at the NCI Frederick National Laboratory at the National Cancer Institute (NCI). Libraries were constructed and then sequenced as 2 × 126 nt paired-end reads with Illumina HiSeq2500 sequencers. Mean coverage depth was 161x (range 114x to 231x). Raw sequencing data in FASTQ format were aligned against the reference human genome (hg19) with BWA (Li and Durbin, 2009). The alignment BAM files were further processed following GATK’s best practices (McKenna et al., 2010) with Picard tools, namely MarkDuplicates, IndelRealigner, and BaseRecalibrator. Somatic variants were then called from the processed BAM files using Strelka (v1.0.10) (Saunders et al., 2012) with the default version of BWA configuration file. The identified somatic variants reported in the “passed” vcf files by Strelka were used for further analysis. Variants were functionally annotated using snpEff/snpSift version 3.4 (see URLs) with databases of GRCh37.70 and dbNSFP version 3.4, and the types of variants were filtered using snpSift (Cingolani et al., 2012). If a variant was also reported in one of the three public databases: 1000 Genomes Project, ExAC, and ESP-NHLBI with a MAF greater than 5%, the variant was removed. For each patient, variants identified by Strelka (Saunders et al., 2012) from all tumor regions were combined to get a unique variant list. Using this patient-specific list, if a variant in a particular tumor site was not called by Strelka, the Samtools mpileup was used to retrieve the reference and alternative reads coverage for each SNV site. If the site had > = 2 alternative reads and VAF > = 1%, the SNV was considered present in the tumor site. For short indels, if the variant site was not in the “passed” vcf file, the Strelka called “all” vcf file is used to retrieve the reference and alternative reads coverage; if missing in the “all” vcf file, the indel site was considered absent. Patient RA000 was previously known to have a KRAS G12C mutation based on molecular profiling. Although this mutation did not pass variant filtering, it was noted on manual review. Identified missense mutations were manually reviewed using the Integrative Genomics Viewer version 2.4 (Robinson et al., 2011; Thorvaldsdóttir et al., 2013).

Phylogenetic analysis

Phylogenetic analysis was conducted using Phangorn (Schliep, 2011) and phytools R packages with all identified variants (silent and non-silent) from all tumor sites in each patient after converting the mutation profile into binary format. The initial phylogenetic relationships between tumor regions for an individual patient was inferred using both the Maximum Parsimony and the Unweighted Pair Group Methods (UPGMA). Phylogenetic trees were then redrawn by hand in Adobe Illustrator with branch length proportional to the number of mutations specific to one tumor (private), two or more tumors (shared) or all tumors (trunk). Driver mutations and focal CNAs were added to the branches. All non-synonymous and synonymous mutations were used for tree construction. Phylogenetic trees were also constructed for each patient using the Treeomics computational tool (Reiter et al., 2017) using bootstrapping values from 1,000 samples except for patient RA004, which failed to run likely due to the large number of tumors. Signature analysis was performed for each individual tumor as well as trunks and each subsequent branch point for each tumor using deconstructSigs (Rosenthal et al., 2016). Mutations that were not signature 1, 2, 4, 5, or 13-type were labeled as “unclassified.” Mutational signature analysis was restricted to branches with at least 10 mutations. COSMIC mutational signatures were calculated for each branch using the R “deconstrucSigs” package (Rosenthal et al., 2016). Arm-level amplification and deletions were also added to previously generated phylogenetic trees for each patient (Figure S7). For these trees, branch lengths were redrawn for visualization purposes only.

Identification and classification of driver mutations

All identified nonsynonymous mutations were filtered to include only driver genes based on large-scale non-small cell lung cancer sequencing studies (Campbell et al., 2016; Ding et al., 2008; Govindan et al., 2012; Imielinski et al., 2012; Lawrence et al., 2014; Network, 2014; Weir et al., 2007) and in the COSMIC cancer gene census (downloaded June 2016). We classified all nonsynonymous mutations into the three categories. Category 1 ‘high-confidence driver mutations’ contained all disrupting mutations (nonsense, frameshift, splicing or ‘deleterious’ missense) in tumor suppressor genes or activating amino acid substitutions in non-small cell lung cancer oncogenes as described in lung cancer sequencing studies. Category 2 ‘putative driver mutations’ contained amino acid substitutions located at the same position or up to 5 amino acids away from a substitution present in COSMIC. Category 3 ‘low confidence driver mutations’ contained all other nonsilent mutations in genes that were present in the lists of cancer-related genes described above. Mutations were then analyzed using COSMIC to determine whether the amino acid substitution has been previously identified. Category 2 were further scored as ‘deleterious’ when at least two out of the three predictors classified the mutation as deleterious Functional prediction scores (SIFT, PolyPhen2, and Provean). All category 1 mutations were considered deleterious and category 3 mutations were not included as driver mutations in any analyses.

APOBEC germline deletion genotyping

Germline APOBEC3AB deletion was genotyped by a proxy SNP rs12628403 using a custom-designed TaqMan genotyping assay, as described previously (Middlebrooks et al., 2016). For patient RA006, the deletion status was also confirmed in all six tumors by Sanger sequencing, and by expression analysis.

qRT–PCR analysis

Lung cell lines A549, HCC4006, and H1975 and lung epithelial cell lines HBEC-3KT and HPL1D (Masuda et al., 1997) were grown on 6-well plates in triplicate until confluent, followed by treatment with IFNγ (1 ng/ml, R&D Systems) for 8 and 24 hours. Cells were lysed with RLT buffer supplemented with B-mercaptoethanol. Total RNA for cell lines and tumors was isolated with the QIAGEN All Prep DNA/RNA Mini Kit with on-column DNase I treatment. cDNA was prepared from equal amounts of total RNA for each sample with the RT2 first-strand cDNA kit and random hexamers with an additional DNA removal step (QIAGEN). Expression of APOBEC3A, APOBEC3B, and APOBEC3AB deletion and endogenous controls GAPDH and PPIA was measured in each cDNA with TaqMan expression assays from Thermo Fisher. Custom assays were used for APOBEC3B: (F: TGCTGGGAAAACTTTGTGTACAAT; R: ATG TGTCTGGATCCATCAGGTATCT; Probe: FAM-ATTCATGCCTTGGTACAAA), and APOBEC3AB (F: ATCATGACCTACGATGAATTT AAGCA; R: AGCACATTGCTTTGCTGGTG; Probe: FAM-CATTCTCCAGAATCAGGG), and commercial assay Hs00377444_m1 was used for APOBEC3A, 4326317E for GAPDH and 4326316E for PPIA (Thermo Fisher Scientific). Reactions were performed in four technical replicates on QuantStudio 7 (Life Technologies) using TaqMan Gene Expression buffer (Life Technologies); water and genomic DNA were used as negative controls for all assays. Expression was measured by Ct values (PCR cycle at detection threshold). Expression of APOBEC3A, APOBEC3B and APOBEC3AB was individually normalized by the geometric mean of endogenous controls (GAPDH and PPIA) based on relative quantification method as ΔCt = Ct (control) – Ct (target).

Analysis of APOBEC mutagenesis

APOBEC-signature mutation analysis for all autopsy tumor samples was determined using an R software package kindly provided by Dr. Dmitry A. Gordenin. We used two variables in the file *_sorted_sum_all_fisher_Pcorr.txt: the ‘tCw_to_G+tCw_to_T’ variable, which represents total counts of APOBEC-signature mutations, and the ‘APOBEC_Enrich’ variable, which accounts for statistical significance of enrichment and represents the level APOBEC mutagenesis pattern per sample. This second variable is more stringent, as many samples were not enriched at a statistically significant level and were classified as negative for APOBEC-signature mutations. We identified APOBEC ‘hypermutators’ as those with signature 2 + 13 mutations (TCGA and Broad datasets) or total APOBEC mutations (TRACERx and our dataset) exceeding 1.5 times the length of the interquartile range from the 75th percentile (Nik-Zainal et al., 2014). We also used the same R software package to determine RTCA and YTCA enrichment for patient RA006. A less stringent filtering of whole-exome variants was used to provide sufficient sample size for this analysis. A Benjamin-Hochberg P value of 0.05 was used as a threshold for significance, unless specified otherwise, and all tests were two-sided.

TCGA analyses

TCGA data for lung adenocarcinoma were downloaded directly from the Firehose pipeline of the Broad Institute. For gene expression, we used both RNA-SeqV1 (Reads Per Kilobase per Million, RPKM) or RNA-SeqV2 (RNA-Seq by Expectation Maximization, RSEM).

Copy Number Alteration Analysis

Copy number alteration (CNA) analysis was performed using MIP array technology (Affymetrix OncoScan FFPE Express 2.0) with 334,183 sequence tag site probes which were used to measure DNA copy number at different loci across the human genome. Copy number data were processed and using the Affymetrix OSCHP-SNP-FASST2 algorithm within the Nexus Copy Number Software, which corrects for tumor ploidy using median centering. We used a log2 ratio cut-off of ± 0.5 to define focal copy number amplifications and deletions and ± 0.25 to define arm-level copy number amplifications and deletions. To minimize overcalling heterogeneity of copy number alterations, we employed the following methods: 1) tumors without ± 0.5 focal amplification/deletion were included if they had at log2 ratio ± 0.2 and tumors without ± 0.25 arm-level amplification/deletion were included if they had a log2 ratio ± 0.10; 2) at least two tumors within a patient were required to have an amplification or deletion above the threshold of ± 0.5 for focal and ± 0.25 for arm; 3) an amplification/deletion was considered truncal if present in > 80% of the tumors within a given patient. Allele-specific focal copy number profiles were determined for primary tumors (available for three patients) using the Sequenza package. Circos plots were generated using segmented GISTIC-output file for all tumors using circos v0.69–4, for every track the min and max are set to −1 and 1 respectively, values between −0.2 and 0.2 are not shown in the figure (Mermel et al., 2011). Arm-level changes as depicted in the copy number phylogenetic trees were determined using GISTIC. We also determined allele-specific copy number, corrected for tumor ploidy and purity, from whole exome sequencing data using the FACETS package (Shen and Seshan, 2016).

RNA-sequencing and data processing

RNA-seq sequencing was performed on 31 out of 37 tumor sites. RNA-seq was done on Illumina HiSeq2500 platform to yield at least 100 million reads/sample using Illumina TruSeq V4 chemistry at 2 × 125 nt paired-end. Sequencing reads were aligned with TopHat version 2.0.13 (Trapnell et al., 2009) against the reference human genome hg19, with UCSC known gene transcripts as the gene model annotation. Expression on gene and isoform level was quantified with Cufflinks version 2.2.1 (Trapnell et al., 2012).

RNA-seq variant calling and mutation validation

For RNASeq variants calling, sequencing reads were first aligned to hg19 with STAR version 2.4.2a (Dobin et al., 2013) and then with a second pass alignment to the transcriptome generated by STAR for each patient. For each identified SNV in WES, its expression was confirmed by the presence of sequencing reads of the alternative allele assessed by Samtools mpileup on TopHat generated BAM files from RNASeq data, whereas alternative reads coverage for indels were extracted from vcf files generated by the GATK best practices variant calling on RNASeq (see URLs). 69% of whole exome variants had a minimum 1X RNA depth and of these expressed variants 59% were confirmed by RNA-seq (data not shown). 55% of whole exome variants had minimum of 5X RNA depth and of these expressed variants 69% were confirmed by RNA-seq (data not shown). Validation rates for different variant types across all tumor samples were similar (range 42% silent to 56% nonsense) (see Data S1).

RNA-seq data analysis

Cufflinks outputted FPKM values for each gene were normalized for all samples within each patient using limma package voom quantile method (Law et al., 2014). This expression data was used to predict enrichment scores among immune genes obtained from CIBERSORT for each sample (Newman et al., 2015) and then using single-sample GSEA (ssGSEA) from GenePattern. Using the R package “fgsea,” GSEA preranked we performed to determine enrichment scores for REACTOME pathways. Pathways with q-value less than 0.05 were considered significantly enriched. Principal component analysis (PCA) was used to combine clustered samples prior to conducting this analysis.

Protein Extraction

All but one tumor (RA004 – Li1a) had sufficient tissue for mass-spectrometry (MS)-based proteomic characterization. About 10–15 mg of tumor tissue fresh-frozen in liquid nitrogen was lysed in 400μl of urea lysis buffer (20 mM HEPES pH 8.0, 8 M urea, 1 mM sodium orthovanadate, 2.5 mM sodium pyrophosphate and 1 mM β-glycerophosphate) using a tissue lyser (QIAGEN). Lysates were centrifuged at 14,000 rpm at 4°C for 10 mins and the clear supernatants were transferred to new tubes. Protein concentrations were determined by the Modified Lowry method (BioRad).

Enzymatic Digestion

The protein lysate was reduced with 45 mM dithriothreitol (Sigma Aldrich, MO), alkylated with 100 mM iodoacetamide (Sigma Aldrich, MO), and subsequently digested with modified sequencing grade Trypsin (Promega, Madison, WI) at 30°C overnight. The digest was then acidified using 0.1% TFA and the peptides were desalted using solid phase extraction C18 column (Supelco, Bellefonte, PA), and vacuum dried in a centrifugal evaporator.

TMT-Labeling

TMT10plex amine reactive reagents (0.8 mg per vial) (Thermo Fisher Scientific) were resuspended in 41 μL of anhydrous acetonitrile (ACN) and all 41 μL of each reagent was added to each sample and mixed briefly on a vortexer. Reactions were incubated at room temperature for 1 h, and then quenched by the addition of 8 μL of 5% hydroxylamine for 15 min and then combined at equal amount. All tumor tissues of LUAD patients RA000, RA003, RA005 and RA006 were pooled together to make a reference channel and labeled with TMT10-126. In a separate TMT labeling experiment, tumor tissues from patient RA006 were pooled together to make a reference channel.

Basic reversed phase liquid chromatography (RPLC) fractionation

Basic RPLC separation was performed with a XBridge C18, 100 × 2.1 mm analytical column containing 5μm particles and equipped with a 10 × 2.1 mm guard column (Waters, Milford, MA) with a flow rate of 0.25 mL/min. The solvent consisted of 10 mM triethylammonium bicarbonate (TEABC) as mobile phase A, and 10 mM TEABC in ACN as mobile phase B. Sample separation was accomplished using the following linear gradient: from 0 to 1% B in 5min, from 1 to 10% B in 5min, from 10 to 35% B in 30min, and from 35 to 100% B in 5min, and held at 100% B for an additional 3min. A total of 96 fractions were collected during the LC separation in a 96-well plate in the presence of 12.5 μL of 1% formic acid. The collected fractions were concatenated into 12 fractions and dried in a vacuum centrifuge. One tenth of the peptides were injected directly for LC-MS/MS analysis.

LC-MS/MS analyses

Peptides separated/fractionated by basic reversed-phase chromatography were analyzed on an LTQ-Orbitrap Elite interfaced with an Ultimate™ 3000 RSLCnano System (Thermo Scientific, San Jose, CA). The dried peptides were loaded onto a nano-trap column (Acclaim PepMap100 Nano Trap Column, C18, 5 μm, 100 Å, 100 μm i.d. × 2 cm) and separated on an Easy-spray™ C18 LC column (Acclaim PepMap100, C18, 2 μm, 100 Å, 75 μm i.d. × 25 cm). Mobile phases A and B consisted of 0.1% formic acid in water and 0.1% formic acid in 90% ACN, respectively. Peptides were eluted from the column at 300 nL/min using the following linear gradient: from 4 to 35% B in 60min, from 35 to 45% B in 5min, from 45 to 90% B in 5min, and held at 90% B for an additional 5min. The heated capillary temperature and spray voltage were 275°C and 2kV, respectively. Full spectra were collected from m/z 350 to 1800 in the Orbitrap analyzer at a resolution of 120,000, followed by data-dependent HCD MS/MS scans of the fifteen most abundant ions at a resolution of 30,000, using 40% collision energy and dynamic exclusion time of 30 s.

Proteomic Data Analysis

Peptides and proteins were identified and quantified using the Maxquant software package (version 1.5.3.30) (Tyanova et al., 2016) with the Andromeda search engine (Cox and Mann, 2008). MS/MS spectra were searched against the Uniprot human protein database (May 2013, 38523 entries) and quantification was performed using default parameters for TMT10plex in MaxQuant. Corrected intensities of the reporter ions from TMT labels were obtained from the MaxQuant search. The relative ratios were calculated for each channel to the reference channel. These ratios were then used to predict enrichment scores of overall immune signatures obtained from CIBERSORT (Newman et al., 2015) and Xcell (Aran et al., 2017) using single-sample GSEA (ssGSEA) from GenePattern and for REACTOME pathways by GSEA preranked through the R package “fgsea.” Pathways with p value less than 0.10 were considered significantly enriched. Samples were similarly combined as described for the RNA-seq data analysis. Cufflinks outputted FPKM values for each gene were normalized for all samples within each patient using limma package voom quantile method.

Construction and Immunohistochemistry of Tissue Microarray

The physical construction of the TMA followed the guidelines previously used by the NCI Tissue Array Project. Each tumor from each autopsy patient was represented by 1 tumor core of 1mm that was taken from the original paraffin block. Serial 5μm sections were cut from the TMA block and used for immunohistochemical analysis. We used previously reported methods for immunohistochemical staining of TMAs (Hewitt, 2004).

Integrating copy number, gene expression and protein abundance

Pearson correlation coefficients (PCCs) were calculated across all common genes in copy number, gene expression and protein abundance data for each patient. Prior to calculating PCCs, gene expression data (RNA-seq FPKM) and protein abundance (protein ratios) were further normalized within each patient using the limma package with its voom quantile method. 3DPlots were created using the R package “scatterplot3d.” For arm-level analyses, normalized gene expression and protein abundance data was categorized by chromosomal arm. The mean of clusters of tumors, as determined previously by PCA, were calculated for both sets of data. Ratios were calculated between clusters and then log2 transformed. Probability density plots were generated with 1% outliers removed and x axis of plots were restricted to −1 to 1 (log2 scale) for gene expression and −0.1 and +0.1 (log2 scale) for protein abundance for visualization purposes.

QUANTIFICATION AND STATISTICAL ANALYSIS

All figures and graphs were generated using the “ggplot2” package available through the R statistical program. Linear regression, correlations and t tests were conducted though the R base packages. All tests were two-tailed and p values less than 0.05 were considered significant.

DATA AND SOFTWARE AVAILABILITY

The sequencing and genotype data have been deposited at the database of Genotypes and Phenotypes (dbGaP), which is hosted by the National Center for Biotechnology Information (NCBI). The MS proteomics data in this study have been deposited in the ProteomeXchange Consortium (http://proteomecentral.proteomeexchange.org) via the PRIDE partner repository. The accession numbers for the data reported in this paper are dbGaP: phs001432.v1.p1 and PRIDE: PXD012845. Additional analyses, data and code are available at: https://github.com/nitinroper/Rapid-Autopsy-NCI.
KEY RESOURCES TABLE
REAGENT or RESOURCESOURCEIDENTIFIER
Antibodies
CCND1AgilentCat#GA083
Biological Samples
Metastases collected by rapid autopsyNational Cancer Institute, Bethesda, Marylandhttps://clinicaltrials.gov/ct2/show/NCT01851395
Chemicals, Peptides, and Recombinant Proteins
IFNγR&D SystemsCat#285-IF-100
Critical Commercial Assays
HiSeq 2500 systemIlluminaN/A
Agilent SureSelect XT (All Exon V5 + UTR)IlluminaN/A
TruSeq Stranded Total RNA Library PrepIlluminaCat#20020596
TMT10plexThermo ScientificCat#90110
XBridge C18WatersN/A
LTQ-Orbitrap Elite interfaced with anUltimateTM 3000 RSLCnano SystemThermo ScientificN/A
Deposited Data
Processed data and code usedThis paperhttps://github.com/nitinroper/Rapid-Autopsy-NCI
Raw dataThis paperdbGaP: phs001432.v1.p1 and PRIDE: PXD012845
Experimental Models: Cell Lines
A549ATCCCat#CCL-185
HCC4006ATCCCat#CRL-2871
H1975ATCCCat#CRL-5908
HBEC3-KTATCCCat#CRL-4051
HPL1DMasuda et al., 1997; PMID: 9354455N/A
Oligonucleotides
APOBEC3B forward: TGCTGGGAAAAC TTTGTGTACAATMiddlebrooks et al., 2016; PMID: 27643540N/A
APOBEC3B reverse: ATGTGTCTGGAT CCATCAGGTATCTMiddlebrooks et al., 2016; PMID: 27643540N/A
APOBEC3B probe: FAM ATTCATGCC TTGGTACAAAMiddlebrooks et al., 2016; PMID: 27643540N/A
APOBEC3AB forward: ATCATGACCTA CGATGAATTTAAGCAMiddlebrooks et al., 2016; PMID: 27643540N/A
APOBEC3AB reverse: AGCACATTGCTTTGCTGGTGMiddlebrooks et al., 2016; PMID: 27643540N/A
APOBEC3AB probe: FAM-CATTCTCC AGAATCAGGGMiddlebrooks et al., 2016; PMID: 27643540N/A
APOBEC3A (Hs00377444_m1)Thermo Fisher ScientificN/A
GAPDHThermo Fisher ScientificCat#4326317E
PPIAThermo Fisher ScientificCat#4326316E
Software and Algorithms
PyClone v0.13.0Roth et al., 2014; PMID: 24633410https://shahlab.ca/projects/pyclone/
deconstructSigs v1.8.0Rosenthal et al., 2016; PMID: 26899170https://www.rdocumentation.org/packages/deconstructSigs/versions/1.8.0
TreeomicsReiter et al., 2017: PMID: 28139641https://github.com/johannesreiter/treeomics
Strelka 1.0.10Saunders et al., 2012; PMID: 22581179https://sites.google.com/site/strelkasomaticvariantcaller/home
STARDobin et al., 2013; PMID: 23104886https://github.com/alexdobin/STAR
CIBERSORTNewman et al., 2015; PMID: 25822800https://github.com/zomithex/CIBERSORT
xCellAran et al., 2017; PMID: 29141660https://github.com/dviraran/xCell
GenePatternSubramanian et al., 2005; PMID: 16199517https://software.broadinstitute.org/cancer/software/genepattern
FireBrowseN/Ahttp://firebrowse.org/
GISTIC 2.0Mermel et al., 2011; PMID: 21527027https://software.broadinstitute.org/cancer/cga/gistic
PhangornSchliep, 2011; PMID: 21169378https://www.thermofisher.com/us/en/home/industrial/mass-spectrometry/liquidchromatography-mass-spectrometry-lc-ms/lc-ms-systems/orbitrap-lc-ms.html; https://github.com/KlausVigo/phangorn
Maxquant v1.5.3.30Tyanova et al., 2016; PMID: 27809316https://maxquant.org/
  86 in total

1.  Widespread aneuploidy revealed by DNA microarray expression profiling.

Authors:  T R Hughes; C J Roberts; H Dai; A R Jones; M R Meyer; D Slade; J Burchard; S Dow; T R Ward; M J Kidd; S H Friend; M J Marton
Journal:  Nat Genet       Date:  2000-07       Impact factor: 38.330

2.  An APOBEC cytidine deaminase mutagenesis pattern is widespread in human cancers.

Authors:  Steven A Roberts; Michael S Lawrence; Leszek J Klimczak; Sara A Grimm; David Fargo; Petar Stojanov; Adam Kiezun; Gregory V Kryukov; Scott L Carter; Gordon Saksena; Shawn Harris; Ruchir R Shah; Michael A Resnick; Gad Getz; Dmitry A Gordenin
Journal:  Nat Genet       Date:  2013-07-14       Impact factor: 38.330

3.  The patterns and dynamics of genomic instability in metastatic pancreatic cancer.

Authors:  Peter J Campbell; Shinichi Yachida; Laura J Mudie; Philip J Stephens; Erin D Pleasance; Lucy A Stebbings; Laura A Morsberger; Calli Latimer; Stuart McLaren; Meng-Lay Lin; David J McBride; Ignacio Varela; Serena A Nik-Zainal; Catherine Leroy; Mingming Jia; Andrew Menzies; Adam P Butler; Jon W Teague; Constance A Griffin; John Burton; Harold Swerdlow; Michael A Quail; Michael R Stratton; Christine Iacobuzio-Donahue; P Andrew Futreal
Journal:  Nature       Date:  2010-10-28       Impact factor: 49.962

4.  Genomic landscape of non-small cell lung cancer in smokers and never-smokers.

Authors:  Ramaswamy Govindan; Li Ding; Malachi Griffith; Janakiraman Subramanian; Nathan D Dees; Krishna L Kanchi; Christopher A Maher; Robert Fulton; Lucinda Fulton; John Wallis; Ken Chen; Jason Walker; Sandra McDonald; Ron Bose; David Ornitz; Donghai Xiong; Ming You; David J Dooling; Mark Watson; Elaine R Mardis; Richard K Wilson
Journal:  Cell       Date:  2012-09-14       Impact factor: 41.582

5.  Integrative clinical genomics of advanced prostate cancer.

Authors:  Dan Robinson; Eliezer M Van Allen; Yi-Mi Wu; Nikolaus Schultz; Robert J Lonigro; Juan-Miguel Mosquera; Bruce Montgomery; Mary-Ellen Taplin; Colin C Pritchard; Gerhardt Attard; Himisha Beltran; Wassim Abida; Robert K Bradley; Jake Vinson; Xuhong Cao; Pankaj Vats; Lakshmi P Kunju; Maha Hussain; Felix Y Feng; Scott A Tomlins; Kathleen A Cooney; David C Smith; Christine Brennan; Javed Siddiqui; Rohit Mehra; Yu Chen; Dana E Rathkopf; Michael J Morris; Stephen B Solomon; Jeremy C Durack; Victor E Reuter; Anuradha Gopalan; Jianjiong Gao; Massimo Loda; Rosina T Lis; Michaela Bowden; Stephen P Balk; Glenn Gaviola; Carrie Sougnez; Manaswi Gupta; Evan Y Yu; Elahe A Mostaghel; Heather H Cheng; Hyojeong Mulcahy; Lawrence D True; Stephen R Plymate; Heidi Dvinge; Roberta Ferraldeschi; Penny Flohr; Susana Miranda; Zafeiris Zafeiriou; Nina Tunariu; Joaquin Mateo; Raquel Perez-Lopez; Francesca Demichelis; Brian D Robinson; Marc Schiffman; David M Nanus; Scott T Tagawa; Alexandros Sigaras; Kenneth W Eng; Olivier Elemento; Andrea Sboner; Elisabeth I Heath; Howard I Scher; Kenneth J Pienta; Philip Kantoff; Johann S de Bono; Mark A Rubin; Peter S Nelson; Levi A Garraway; Charles L Sawyers; Arul M Chinnaiyan
Journal:  Cell       Date:  2015-05-21       Impact factor: 41.582

6.  Genomic architecture and evolution of clear cell renal cell carcinomas defined by multiregion sequencing.

Authors:  Marco Gerlinger; Stuart Horswell; James Larkin; Andrew J Rowan; Max P Salm; Ignacio Varela; Rosalie Fisher; Nicholas McGranahan; Nicholas Matthews; Claudio R Santos; Pierre Martinez; Benjamin Phillimore; Sharmin Begum; Adam Rabinowitz; Bradley Spencer-Dene; Sakshi Gulati; Paul A Bates; Gordon Stamp; Lisa Pickering; Martin Gore; David L Nicol; Steven Hazell; P Andrew Futreal; Aengus Stewart; Charles Swanton
Journal:  Nat Genet       Date:  2014-02-02       Impact factor: 38.330

7.  Using Drosophila melanogaster as a Model for Genotoxic Chemical Mutational Studies with a New Program, SnpSift.

Authors:  Pablo Cingolani; Viral M Patel; Melissa Coon; Tung Nguyen; Susan J Land; Douglas M Ruden; Xiangyi Lu
Journal:  Front Genet       Date:  2012-03-15       Impact factor: 4.599

8.  Fast and accurate short read alignment with Burrows-Wheeler transform.

Authors:  Heng Li; Richard Durbin
Journal:  Bioinformatics       Date:  2009-05-18       Impact factor: 6.937

9.  TopHat: discovering splice junctions with RNA-Seq.

Authors:  Cole Trapnell; Lior Pachter; Steven L Salzberg
Journal:  Bioinformatics       Date:  2009-03-16       Impact factor: 6.937

10.  Association of a germline copy number polymorphism of APOBEC3A and APOBEC3B with burden of putative APOBEC-dependent mutations in breast cancer.

Authors:  Serena Nik-Zainal; David C Wedge; Ludmil B Alexandrov; Mia Petljak; Adam P Butler; Niccolo Bolli; Helen R Davies; Stian Knappskog; Sancha Martin; Elli Papaemmanuil; Manasa Ramakrishna; Adam Shlien; Ingrid Simonic; Yali Xue; Chris Tyler-Smith; Peter J Campbell; Michael R Stratton
Journal:  Nat Genet       Date:  2014-04-13       Impact factor: 38.330

View more
  39 in total

1.  Genomic Landscape and Immune Microenvironment Features of Preinvasive and Early Invasive Lung Adenocarcinoma.

Authors:  Chao Zhang; Jianjun Zhang; Fang-Ping Xu; Yin-Guang Wang; Zhi Xie; Jian Su; Song Dong; Qiang Nie; Yang Shao; Qing Zhou; Jin-Ji Yang; Xue-Ning Yang; Xu-Chao Zhang; Zhi Li; Yi-Long Wu; Wen-Zhao Zhong
Journal:  J Thorac Oncol       Date:  2019-08-22       Impact factor: 15.609

Review 2.  Cancer proteogenomics: current impact and future prospects.

Authors:  D R Mani; Karsten Krug; Bing Zhang; Shankha Satpathy; Karl R Clauser; Li Ding; Matthew Ellis; Michael A Gillette; Steven A Carr
Journal:  Nat Rev Cancer       Date:  2022-03-02       Impact factor: 60.716

Review 3.  Research on the influence of APOBEC family on the occurrence, diagnosis, and treatment of various tumors.

Authors:  Jing Yang; Jiali Hou; Mengxia Li
Journal:  J Cancer Res Clin Oncol       Date:  2022-10-12       Impact factor: 4.322

4.  Identification of a signature of evolutionarily conserved stress-induced mutagenesis in cancer.

Authors:  Luis H Cisneros; Charles Vaske; Kimberly J Bussey
Journal:  Front Genet       Date:  2022-09-06       Impact factor: 4.772

Review 5.  APOBEC and Cancer Viroimmunotherapy: Thinking the Unthinkable.

Authors:  Richard G Vile; Alan Melcher; Hardev Pandha; Kevin J Harrington; Jose S Pulido
Journal:  Clin Cancer Res       Date:  2021-02-08       Impact factor: 12.531

6.  Genomic evolutionary trajectory of metastatic squamous cell carcinoma of the lung.

Authors:  Arthur Krause; Luca Roma; Thomas Lorber; Tanja Dietsche; Valeria Perrina; David C Müller; Didier Lardinois; Christian Ruiz; Spasenija Savic Prince; Salvatore Piscuoglio; Charlotte K Y Ng; Lukas Bubendorf
Journal:  Transl Lung Cancer Res       Date:  2021-04

7.  APOBEC3B deletion polymorphism and lung cancer risk in the southern Chinese population.

Authors:  Xiaosong Ben; Dan Tian; Jiayu Liang; Min Wu; Fan Xie; Jinlong Zheng; Jingmin Chen; Qiaoyuan Fei; Xinrong Guo; Xueqiong Weng; Shan Liu; Xin Xie; Yuting Ying; Guibin Qiao; Chunxia Jing
Journal:  Ann Transl Med       Date:  2021-04

8.  Induction of APOBEC3 Exacerbates DNA Replication Stress and Chromosomal Instability in Early Breast and Lung Cancer Evolution.

Authors:  Subramanian Venkatesan; Mihaela Angelova; Clare Puttick; Haoran Zhai; Deborah R Caswell; Wei-Ting Lu; Michelle Dietzen; Panagiotis Galanos; Konstantinos Evangelou; Roberto Bellelli; Emilia L Lim; Thomas B K Watkins; Andrew Rowan; Vitor H Teixeira; Yue Zhao; Haiquan Chen; Bryan Ngo; Lykourgos-Panagiotis Zalmas; Maise Al Bakir; Sebastijan Hobor; Eva Grönroos; Adam Pennycuick; Ersilia Nigro; Brittany B Campbell; William L Brown; Ayse U Akarca; Teresa Marafioti; Mary Y Wu; Michael Howell; Simon J Boulton; Cosetta Bertoli; Tim R Fenton; Robertus A M de Bruin; Apolinar Maya-Mendoza; Eric Santoni-Rugiu; Robert E Hynds; Vassilis G Gorgoulis; Mariam Jamal-Hanjani; Nicholas McGranahan; Reuben S Harris; Sam M Janes; Jirina Bartkova; Samuel F Bakhoum; Jiri Bartek; Nnennaya Kanu; Charles Swanton
Journal:  Cancer Discov       Date:  2021-05-04       Impact factor: 38.272

9.  Preoperative clinical and tumor genomic features associated with pathologic lymph node metastasis in clinical stage I and II lung adenocarcinoma.

Authors:  Raul Caso; James G Connolly; Jian Zhou; Kay See Tan; James J Choi; Gregory D Jones; Brooke Mastrogiacomo; Francisco Sanchez-Vega; Bastien Nguyen; Gaetano Rocco; Daniela Molena; Smita Sihag; Prasad S Adusumilli; Matthew J Bott; David R Jones
Journal:  NPJ Precis Oncol       Date:  2021-07-21

10.  Interaction with the CCT chaperonin complex limits APOBEC3A cytidine deaminase cytotoxicity.

Authors:  Abby M Green; Rachel A DeWeerd; David R O'Leary; Ava R Hansen; Katharina E Hayer; Katarzyna Kulej; Ariel S Dineen; Julia H Szeto; Benjamin A Garcia; Matthew D Weitzman
Journal:  EMBO Rep       Date:  2021-08-04       Impact factor: 9.071

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.