Comparative virulotyping and phylogenomics of Escherichia coli isolates from urine samples of men and women suffering urinary tract infections.

OBJECTIVES: Escherichia coli strains are common pathogens that can cause urinary tract infections (UTI). This study aimed to assess E. coli phylogroups and virulence types in male and female UTI patients.
MATERIALS AND METHODS: In the present study, 160 uropathogenic E. coli (UPEC) isolates (from both sexes) were assigned to phylogroups/types and some extraintestinal virulence factors were detected within them by multiplex-PCR.
RESULTS: The isolates from women and men were predominantly distributed within phylogroup B2 and D, respectively. The presence of D2 phylotype was higher in men isolates than women, significantly (P=0.045). In male isolates papEF and sfa/focDE are more prevalent in B2 group than D, significantly (P=0.048; P=0.035). The prevalence of hly in B2 group is significantly higher than D (P=0.034) in female isolates.
CONCLUSION: This study highlighted different features of E. coli genotypes from phylogenetic and virulence point of view implicated in UTI's in both human genders.

Introduction

Escherichia coli (E. coli) strains belonging to enterobacteriaceae family are normal habitant of gastro-intestinal tract in the wide range of warm-blooded hosts. Many E. coli strains are harmless while some are pathogenic, meaning that they can cause illness, either diarrhea or infections in extraintestinal sites such as urinary tract infections (UTI) in human (1, 2). After respiratory infections, the UTI’s are the most common infectious problem in human resulting in serious sequelae if remain untreated and Uropathogenic E. coli (UPEC) is responsible for more than %80 of UTI’s (3, 4). E. coli strains based on some genetic markers (chuA, yjaA, and tspE4.C2) are divided into four main phylogenetic groups A, B1, B2 and D consisting of seven phylotypes: phylotypes A0 and A1 (group A); B1 (group B1); B22 and B23 (group B2); D1 and D2 (group D) (5). It is believed that groups B2 and D include the majority of virulent extraintestinal E. coli, whilst groups A and B1 primarily represent commensal characteristics (6, 7). On the other hand, UPEC strains have multiple virulence factors (VFs) that confer the potential for pathogenicity, invasion, and colonization of urinary tract sites such as P and S fimbriae, afimbrial adhesion molecules and hemolysin through pathogenicity islands (8). There are some evidences demonstrating that sex and gender can imply an important role in the formation of microbiota of human flora sites. Pathogenic species and phenotypic characteristics causing UTI’s are affected by such factors like gender (9-12). Accordingly, in the present study, relationships between the presence of selected virulence genes and the phylogroup of E. coli strains implicated in men and women UTI cases were evaluated to assess if there are genotypic differences between E. coli isolates in these two hosts.

Materials and Methods

One hundred and sixty E. coli strains were isolated from patients (25 - 45 years old/both sexes) suspected to suffering UTI based on urologist’s diagnosis referring to diagnostic laboratories according to the protocol described by Bonadio et al (13). Then stock cultures were prepared from the E. coli isolates and stored in Luria-Bertani broth (Sigma-Aldrich) with 15% (v/v) glycerol at -20 °C until genotyping.

Genomic DNA was extracted from E. coli strains with the rapid one-step extraction (ROSE) method (14) based on alkaline lysis of bacteria and phylogenetic group and phylotype of isolates were identified using a modified Triplex PCR-based assay optimized for detection of chuA, yjaA, and tspE4.C2 gene markers as previously described by Staji (15). Finally, the detection of four extraintestinal putative virulence genes (hly, iucD, sfa/focDE and pap) was carried out using a modified Tetraplex-PCR program as described by Staji et al previously (8). The primers sequences used in this study are present in Table 1.

Table 1

Polymerase chain reaction primers used to detect phylogenetic groups and extraintestinal virulence factors genes of E. coli in samples collected from male and female patients suffering UTI

Gene Name	Primer sequence (5’ to 3’)	Product size (bp)	Reference (5, 23)
chuA	GACGAACCAACGGTCAGGAT	279	Carlos et al., (2010)
	TGCCGCCAGTACCAAAGACA
yjaA	TGCCGCCAGTACCAAAGACA	211	,,
	ATGGAGAATGCGTTCCTCAAC
tspE4.C2	GAGTAAGTTCGGGGCATTCA	152	,,
	CGCGCCAACAAAGTATTACG
hly	AACAAGGATAAGCACTGTTCTGGCT	1177	Adib et al., (2014)
	ACCATATAAGCGGTCATTCCCGTCA
iucD	TACCGGATTGTCATATGCAGACCGT	602	,,
	AATATCTTCCTCCAGTCCGGAGAAG
Pap	GCAACAGCAACGCTGGTTGCATCA	336	,,
	AGAGAGAGCCACTCTTATACGGACA
Sfa/focDE	CTCCGCAGAACTGGGTGCATCTTA	410	,,
	CGCAGGAGTAATTACAAACCTGGCA

Differences in frequencies of phylogenetic groups and virulence markers among men and women isolates was evaluated using chi-squared tests (x2) on contingency tables and Fisher’s exact test with a significance level of P=0.05, using SPSS (version 21) software.

Results

A total of 160 E. coli isolates, 100 from females and 60 from male patients, were obtained from 240 urine samples (66.6%) of human cases suffering UTI, confirming that E. coli is dominant agent in development of urinary tract infections. All phylogenetic groups and phylotypes were found among isolates from both sex individuals in the general population, except for A0 phylotype which was absent in E. coli isolates from females (Table 2). Distribution of the phylogenetic group’s differed depending on the host sexuality. In females (n=100 strains), 46% of isolates belonged to group B2, 33% to group D, 13% to group A, and 8% to group B1. In male patients (n=60 strains), phylogroup B2 was predominant (48.3%) followed by phylogroups D (25%), A (20%) and group B1 (6.7%). Distribution of E. coli phylotypes are presented in Table 2 in detailed. Statistical analyses showed that there is no significant differences between distributions of phylogenetic groups in male and female isolates. Comparison of prevalence of phylotypes between both sexes shows that D2 phylotype is more prevalent in male isolates than females (P=0.045), significantly.

Table 2

Frequency of E. coli phylogenetic Types (PT) and virulence genes (%) in relation to PT among urinary E. coli isolates from human female and male UTI cases

Source	PT	No. Strains (%)	Virulence Genes (%)
			hly	iucD	Sfa/focDE	pap
Female UTI	A0	0	-	-	-	-
	A1	13 (13)	0	6 (12.75)	1 (2.3)	1
	B1	8 (8)	1 (6.7)	2 (4.2)	5 (11.6)	1
	B22	5 (5)	0	3 (6.4)	1 (2.3)	1
	B23	41 (41)	12 (80)	19 (40.5)	23 (53.5)	8
	D1	12 (12)	1 (6.7)	5 (10.6)	5 (11.6)	1
	D2	21 (21)	1 (6.7)	12 (25.5)	8 (18.6)	1
	Total	100 (100)	15 (100)	47 (100)	43 (100)	13 (100)
Male UTI	A0	2 (3.3)	0	0	0	0
	A1	10 (16.7)	0	5 (14)	0	0
	B1	4 (6.7)	0	2 (5.5)	1 (7.7)	1 (6.2)
	B22	3 (5)	0	2 (5.5)	0	1 (6.2)
	B23	26 (43.3)	4 (100)	20 (55.5)	11 (84.6)	12 (75)
	D1	10 (16.7)	0	5 (14)	0	1 (6.2)
	D2	5 (8.3)	0	2 (5.5)	1 (7.7)	1 (6.2)
	Total	60 (100)	4 (100)	36 (100)	13 (100)	16 (100)

The detection of virulence factors (hly; iucD; pap; sfa/focDE) using Multiplex-PCR revealed that 158 (98.75%) of all strains (n=160) were positive for at least 1 of the virulence genes tested; of these strains, 100 (100%) were female and 58 (96.6%) were male isolates. In the strains isolated from female patients, iucD and sfa/focDE were the most common virulence genes identified (47% and 43%, respectively), followed by hly (15%) and pap (13%). The only significant difference in the prevalence of virulence genes among female phylogroups showed that hly was significantly more prevalent in B2 compared to D phylogroup (P=0.034).

In the male strains, iucD, pap and sfa/focDE were the most common virulence genes detected, present in 36%, 16% and 13% of isolates, respectively, and followed by hly (4%). In the E. coli isolates related to male patients sfa/focDE and pap (P=0.035 and P=0.048, respectively) were significantly more prevalent in B2 phylogroup compared to D. The prevalence of virulence genes in E. coli phylogroups and phylotypes of human UTI’s are present in Table 2.

Statistical analyses on the prevalence of virulence factors between E. coli isolates, stratifying by host gender, showed that pap is more prevalent in male isolates (P=0.035) whereas sfa/focDE is more prevalent in female strains (P=0.006), significantly.

Discussion

E. coli is the predominant etiology of UTI and in this study a total of 160 E. coli isolates collected from the urine samples of female (62.5%) and male (37.5%) patients suffering from UTI caused by E. coli were examined to determine the phylogenetic group and phylotypes of each strains and the presence of the four extraintestinal pathogenic E. coli (ExPEC) related virulence genes. Finally, the distribution of phylogenetic characteristics and mentioned virulence genes were compared in E. coli strains of both sexes to investigate the differences in genotypes between the two sources.

All phylogenetic groups and subgroups were found among isolates from UTI’s and our results show that groups B2 (46.8%) and D (30%) are the most prevalent phylogenetic groups in E. coli strains implicated in human urinary tract infections (Table 2). These results are in parallel with some phylogenetic epidemiological studies about UPEC, as reported by Staji et al (8). It has been demonstrated that ExPEC strains usually belong to groups B2 and D. In our study about 23% of isolates belonged to groups A and B1. These findings are in accordance with the results of Bingen et al. and Pupo et al. demonstrating that the route of infection can be intestinal pathogenic E. coli and commensal strains (17, 18). Although there are some evidences about the impact of host gender on the pathogenic aspects of E. coli in UTIs (12) but there is no data about comparative phylogenomics of this pathogenic agent between male and female patients. The comparison of phylogenetic groups and phylotypes distribution between isolates from male and female cases demonstrated that the only significant difference is in D2 phylotype while it was more prevalent in male E. coli isolates from male UTI cases. The difference between D1 and D2 phylotypes is harboring tspE4.C2 genetic marker by D2 which its role in the pathogenesis is unclear (19). Any way considering tspE4.C2 as a virulence factor and higher distribution of this element in male UPEC, it can be concluded that UPEC strains in male patients are more virulent than female ones.

Detection of virulence genes in the strains from UTI’s shows the presence of isolates harboring a combination of hly, iucD, pap and sfa/focDE genes, which could implicate the presence of Pathogenicity Islands (PAI’s) – typical chromosomal traits of the UPEC strains (8, 20). As expected, the majority of urinary strains (98.7%) harbored extraintestinal virulence factor-encoding genes and only 2 isolates (1.2%) in our study were negative for the mentioned virulence genes. Previous studies have assessed the prevalence of E. coli strains showing multiple virulence factors patterns implicated in extra-intestinal infections and they have concluded that this prevalence is strongly associated with strains belonging to phylogroup B2 (21, 22). Comparison of the virulence factors distribution in E. coli phylogroups from male and female’s demonstrated that in women isolates hly is significantly more prevalent in B2 group versus D, while in men isolates sfa/focDE and pap genes are more prevalent in B2 versus D, significantly. UPEC possess a diverse array of adherence factors and fimbriae such as type 1, P, F1C/S and AFA fimbriae represent the primary mediators for colonization of the urinary tract. An important step in the onset and expansion of UTI is adhesion of E. coli to uroepithelial cells by P fimbriae. S fimbriae has also been shown to attach efficiently to the epithelial and endothelial cells of the lower human urinary tract. Studies have shown that papEF and sfa/focDE are essential for cystitis and/or pyelonephritis (16, 23, 24). In the present study it is observed that papEF is more prevalent in male isolates, while in female isolates sfa/focDE is dominant, significantly. These results show that in men and women UTI caused by E. coli, the type of adhesion and fimbriae may quite be different and this can be because of anatomic differences and fimberial receptors on the epithelial cells of urinary tract. Also the comparison of distribution of these two adhesins in B2 and D phylogroups of this both genders shows that there is no difference in the type of adhesins in female isolates, but in male isolates presence of papEF and sfa/focDE is dominant in B2 phylogroup versus D, significantly. These findings confer that UPEC having any type of related adhesins belonging to B2 and D groups may be able to onset UTI in women but E. coli strains with pap and sfa/focDE belonging to B2 are more prone to induce UTI in men.

Detection of iucD in E. coli isolates showed that 52% of tested strains are positive for this virulence factor, and assessment of this VF in different phylogroups showed that 82% of iucD are present in B2 and D groups. There was not any sex depended differences between distribution of iucD prevalence in E. coli isolates. About 48% of our isolates are lacking iucD, considering that ExPEC strains have evolved multiple strategies for sequestering iron from the host, probably they have other strategies for iron uptake from the host organs (25).

Conclusion

The results show that phylogroups B2 and D, are the major E. coli strains causing human urinary tract infections and strains causing such infections in different genders can vary in virulence genotypes, especially in type of adhesins for the colonization and onset of the infection. More work seems to be necessary for full genotyping of E. coli strains isolated from both sexes and assessment of antimicrobial resistance profile of such isolates from these two sources.