Muscularis Propria Macrophages Alter the Proportion of Nitrergic but Not Cholinergic Gastric Myenteric Neurons.

The enteric nervous system consists of more than a dozen types of neurons aggregated into networks of ganglia throughout the gastrointestinal tract, which regulate contractile activity, mucosal secretion, absorption, and local blood flow.1, 2 Mechanisms that contribute to remodeling of the enteric neuronal networks are of great interest. In the central nervous system, it has been suggested that microglia contribute to the fate, connectivity, and identity of neurons during development. Muscularis propria macrophages (MPM) within the enteric nervous system may have similar functions to microglia. Mice homozygous for the osteopetrosis mutation (Csf1) which do not have MPM, have more neurons in the small intestine and a higher proportion of gastric neurons that express nitric oxide synthase (NOS1). Myenteric neurons serve diverse functions that can be indicated by their morphology, projections and the expression of marker proteins that define their “chemical code.” This study finds a previously unidentified role for MPM in altering the chemical code of myenteric neurons.

Csf1 mice were maintained on a specialized liquid diet to keep their weight comparable with age-matched-wild type (WT) mice (Supplementary Figure 1A). In the myenteric plexus of WT mice, populations of MPM, absent in Csf1 mice (Supplementary Figure 1B and C, Supplementary Movie 1 and 2), were associated closely with neurons, suggesting functional interactions. We first tested whether the number of choline acetyltransferase+ (ChAT+) neurons was affected by the absence of MPM in Csf1 mice (Supplementary Table 1). The density of neurons, defined by Embryonic lethal, abnormal vision, Drosophila-like protein 3/4 (HuC/D) immunoreactivity, was similar between gastric regions in both WT and Csf1 mice (Figure 1A–C, Supplementary Figure 2A) (Mann–Whitney test, P = NS; N = 4), yet was higher in Csf1 mice than in WT mice (Figure 1D and E) (P < .01, Mann–Whitney test, n = 36 fields, N = 4). Likewise, the density of ChAT+ neurons was higher in Csf1 mice compared with WT mice (Figure 1D and E) (P < .001, Mann–Whitney test, n = 36 fields, N = 4). However, in contrast to an increase in the percentage of NOS1+ neurons, the percentage of ChAT+ neurons did not differ between Csf1 and WT mice (Figure 1D and E) (Mann–Whitney test, n = 36 fields, N = 4). This result suggests that the presence of macrophages alters the proportion of nitrergic but not cholinergic gastric myenteric neurons.

Supplementary Figure 1

( (B and C) Major histocompatibility complex class II (MHCII) macrophages (green) and Protein gene product 9.5 (PGP 9.5) fibers in smooth muscular layers (upper panels) and myenteric plexus (lower panels). The small panels show orthogonal views generated by projecting the z-series in the x (right) and on the y plane (above). Arrows point to macrophage/fiber interactions and squares show macrophage/fiber interactions in orthogonal views. PGP 9.5 immunoreactivity was unusually bright in the cell bodies of myenteric neurons in CSf1 mice when compared with WT tissues. Scale bars: (B) 20 μm, (C) 10 μm.

Figure 1

(Scale bar: 200 μm. (B) Images of HuC/D+ and ChAT+ neurons in the gastric regions of Csf1 mice. Scale bar: 50 μm. (C) Quantification of HuC/D+ and ChAT+ neurons in the gastric regions of Csf1 mice (Mann–Whitney test; P = NS). (D) Images of gastric HuC/D+ and ChAT+ neurons in WT and Csf1 mice. Scale bar: 60 μm. Arrow indicates typical HuC/D+ and ChAT+ co-expressing neurons. (E) Quantification of HuC/D+ and ChAT+ neurons in WT and Csf1 mice (n = 36 fields; N = 4 mice) (Mann–Whitney test; P < .01). (C and E) Bars and whiskers indicate means ± SD and points indicate individual fields for all panels.

Supplementary Figure 2

( (B) Percentage of myenteric neurons identified in Csf1 and WT mice. Table shows numbers per field and proportions of different types of myenteric neurons in Csf1 and WT mice.

Interestingly, in Csf1 mice, the combined percentages of NOS1+ (30%) and ChAT+ neurons (72%) exceeded 100% (Supplementary Figure 2B), indicating partial overlap between these markers. Therefore, we investigated whether the number of NOS1+ChAT+ double-labeled neurons was changed in Csf1 mice. In Csf1 mice, Nitric Oxide Synthase 1 (NOS1+) ChAT+ neurons were more numerous than in WT mice (Figure 2A and B) (Csf1: 7.8 ± 7.1 cells/field; WT, 1.7 ± 1.6 cells/field; 1-way analysis of variance; P < .001; n = 24; N = 4). This result suggests the ability of macrophages to not only modulate the neuronal number but also affect myenteric neuron differentiation. Enteric neurons are not required for bowel colonization by macrophages, but macrophages interact with neurons after birth, by expressing genes, such as bone morphogenetic protein 2 (BMP2), needed for macrophage-enteric neuron interaction and neuronal development. To test the intrinsic ability of resident macrophages to modify the neuronal chemical code by establishing functional interaction with neurons, we treated Csf1 with CSF1 (Colony Stimulating Factor 1) for 7 weeks to populate the stomach with macrophages (Figure 2C). In CSF1-treated Csf1 mice, the proportion of NOS1+ChAT+ neurons remained similar to the proportion of NOS1+ChAT+ neurons in Csf1 mice (Figure 2A–C) (1-way analysis of variance; n = 24; N = 4). We previously showed that repopulating macrophages in CSF1-treated Csf1 mice had a different phenotype from resident macrophages. Consistent with this observation, BMP2 was not expressed by macrophages isolated from CSF1-treated Csf1 mice (Antibodies and PCR primers listed in Supplementary Tables 2 and 3), whereas BMP2 was expressed by macrophages isolated from WT mice (Figure 2D and E) (Mann–Whitney test; P < .001; N = 4), as reported elsewhere.

Figure 2

(Images of NOS1Scale bar: 50 μm. Arrows show NOS1+ neurons that are also ChAT+. (B) Quantification of NOS1+ChAT+ double-labeled neurons. Points represent individual fields of view. Bars and whiskers indicate means ± SD (1-way analysis of variance; P < .01; N = 4). (C) Experimental model for CSF1 treatment. Fluorescence-activated cell sorter (FACS) strategy to isolate CD45+CD11b+F4/80+ macrophages from the gastric muscularis propria of WT (top) and CSF1-treated Csf1 mice (bottom). (E) BMP2 expression levels in macrophages isolated from Csf1 and WT mice (Mann–Whitney test; N = 3; P < .01).

During development, the chemical code of myenteric neurons changes and the overlap between NOS1 and ChAT decreases as neurons mature. Therefore, increased numbers of double-labeled myenteric neurons may reflect incomplete maturation of myenteric neurons in Csf1 mice. MPMs functionally interact with enteric neurons starting at 2 weeks of age, therefore the role of resident MPM in promoting myenteric neuron maturation likely happens early in life. Interestingly, MPMs that populate the gastric muscularis propria did not express BMP2, a cytokine important for establishing functional interactions between MPMs and neurons during development. Therefore, as previously suggested,4, 9 BMP2 may be required for the changes in NOS1 and ChAT expression associated with neuronal maturation.

Taken together, our results show a role for MPM in enteric neuronal maturation as indicated by the changes in chemical code in gastric myenteric neurons. The mechanisms by which MPM regulate neuronal numbers and chemical codes needs further investigation because it may be significant to the development or plasticity of the adult enteric nervous system and normal gastric function.

Supplementary Table 1

Sources of Commercial Antibodies Used in Immunohistochemistry Experiments

	Supplier	Final titer	Host	Clonality	Catalog number	Research resource initiative identifier
Primary antibody
Embryonic lethal, abnormal vision, Drosophila-like protein 3/4	Gift from Dr V. Lennon (Mayo Clinic)	1:500	Human			AB_2314657
NOS1	Millipore	0.33 μg/mL	Rabbit	Polyclonal	AB5380	AB_91824
ChAT	Millipore	1:100	Goat	Polyclonal	AB144P	AB_2079751
F4/80 direct conjugate	Thermo Fisher	0.4 μg/mL	Rat	Polyclonal	MF 48020	AB_10376287
Major Histocompatibility Complex II	eBioscience	1.0 μg/mL	Rat	Monoclonal	14-5321-81	AB_467560
Protein Gene Product 9.5	Thermo Fisher	1:400	Rabbit	Polyclonal	38-1000	AB_2533355
Secondary antibody
Cy3 anti-goat	Jackson ImmunoResearch	1.75 μg/mL	Donkey	Polyclonal	705-165-147	AB_2307351
Alexa Fluor–488 anti-rat	Jackson ImmunoResearch	2.33 μg/mL	Donkey	Polyclonal	712-545-150	AB_2340683
Cy3 anti-rabbit	Jackson ImmunoResearch	1.75 μg/mL	Donkey	Polyclonal	711-165-152	AB_2307443
Cy5 anti-human	Jackson ImmunoResearch	1.75 μg/mL	Donkey	Polyclonal	709-175-149	AB_2340539

Supplementary Table 2

List of Antibodies Used for Sorting Experiments and List of Primers Used for Quantitative Reverse-Transcription Polymerase Chain Reaction

Antibody	Fluorophore	Catalog number	Company
F4/80 monoclonal antibody (BM8)	Phycoerythrin--cyanine 5	15-4801-82	eBioscence
Anti-mouse CD11b	Alexa Fluor 488	53-0112-82	eBioscence
Anti-mouse CD45	Alexa Fluor 450	48-0451-82	eBioscence
Rat IgG2b K isotype control	APC	17-4031-81	eBioscence
Rat IgG2a K isotype control	PE-cyanine 7	25-4321-81	eBioscence

Supplementary Table 3

List of Primers used for RT-PCR

Gene symbol	Unigene title	Forward	Reverse
BMP2	Bone morphogenetic protein 2	GGTGATGGCTTCCTTGTACC	AGTGAGGCCCATACCAGAAG
Gapdh	Glyceraldehyde-3-phosphate dehydrogenase	Qiagen	Qiagen