Literature DB >> 30603692

An insight into the emergence of Acinetobacter baumannii as an oro-dental pathogen and its drug resistance gene profile - An in silico approach.

J Vijayashree Priyadharsini1, A S Smiline Girija2, A Paramasivam3.   

Abstract

BACKGROUND: Acinetobacter baumannii, a potential nosocomial pathogen has stealthily gained entry into the oral cavity. Their association with other pathogens like Pseudomonas aeruginosa in chronic and aggressive periodontitis cases is well documented. The magnitude of problem caused by A . baumannii could be attributed to resistance genes acquired by the organism. Since the microbiome of oral cavity is heterogeneous and complex, the transfer of genes from multidrug resistant A . baumannii may be a serious threat in infection control and management. In view of this fact, the present study aims to categorize and characterize drug resistant genes present in each of the 19 genomes of Acinetobacter Sp. selected for the study.
METHODS: About 19 genome sequences of Acinetobacter spp. with the predominance of different strains of A . baumannii was genotyped using in silico restriction digestion and pulse field gel electrophoresis (PFGE). Further, the prevalence of common drug resistant genes in the genome of various Acinetobacter spp. was recorded using in silico PCR analysis.
RESULTS: Based on the PFGE pattern, phylogenetic tree was constructed and the genomes were clustered into 6 genotypes. Genotype 4 (n = 8; 42.10%) and 5 (n = 6; 31.57%) were predominant, followed by genotypes 2 (n = 2; 10.52%), 1, 3 and 6 (n = 1; 5.26%). Three species were excluded from the list since they were negative for most of the drug resistant genes tested. Prevalence of drug resistant genes in each of the 16 genomes analysed found oxa-51, ISAba 1 and ADC 1 to be the major genes found in A . baumannii. Acinetobacter spp. belonging to genotypes 4 and 5 were found to harbour 6-10 and 2-8 potential drug resistant genes respectively.
CONCLUSION: The present study showed cluster of multi-drug resistant genes in genomes analysed, thus, warranting the need for antibiotic surveillance, alternate therapeutic measures and development of novel antimicrobials. An extensive study on the genes conferring drug resistance in this pathogen will open new avenues for battling the entry and spread of this pathogen in vulnerable patient groups.

Entities:  

Keywords:  Genetics; Microbiology

Year:  2018        PMID: 30603692      PMCID: PMC6304470          DOI: 10.1016/j.heliyon.2018.e01051

Source DB:  PubMed          Journal:  Heliyon        ISSN: 2405-8440


Introduction

A. baumannii, a Gram-negative cocco-bacilli has established itself as the most successful nosocomial pathogen within a short span of time with 2–10% of mortality rate recorded among patients with chronic urinary tract infections, bacteremia, pneumonia and critically ill patients in ICU [1]. The World Health Organization [WHO] have provided a red alert about the carbapenem resistant A. baumannii which secures its place under the “critical” category [2, 3]. An infamous fact about A. baumannii is its rapid evolution from multi-drug resistant [MDR] to extensively drug-resistant [XDR] form which has recently been escalated to pan-resistant [PDR] status [4]. Innate resistance together with the ability to accommodate extrinsic resistance factors has contributed to the resurgence of this pathogen with utmost potential [5]. The pathogen has been identified with much greater frequency in endodontic infections [6] along with other known dental pathogens. Prevalence of A. baumannii among patients with chronic or aggressive periodontitis is reported to be higher compared to the control group [7, 8]. The ability to form biofilm and resist desiccation is a key property of A. baumannii which makes it refractory to endodontic and periodontal treatments. The biofilms produced by the bacteria are also potential reservoirs of pathogens associated with pneumonia and chronic obstructive pulmonary disease [9, 10]. In a polymicrobial community, A. baumannii protects carbapenems-susceptible bacteria, thus aggravating the disease process during treatment with carbapenems [11]. Although reports on A. baumannii as a dental pathogen is minimal, the propensity of the pathogen to evolve with a drug resistant armour underscores the need for more research on this pathogen and its role in oral infections. Awareness about the evolution of this pathogen and its spread in the community settings should be monitored to avoid sudden outbreak. The present study on this nosocomial pathogen aims to comprehend the drug resistant genes [DR] in the genomes of Acinetobacter sp. using in silico tools. Although the strains used in the study are not representatives of Acinetobacter sp. from the oral cavity, they represent a small subset of the multi-drug resistant pathogen evolving in the community. Hence, the in silico analysis delimits to the information that is available in the database and provides an alert on the growing concerns about emerging pathogens in dentistry. An extensive epidemiological investigation including samples from dental specimens is required to prove the role of A. baumannii in the development of oral diseases.

Methods

Strains used in the study

Genomes of strains used in the present study as retrieved from NCBI [National Centre for Biotechnology Information] database are given in Table 1. A randomized subset comprising of nineteen isolates of genus Acinetobacter available in the database of in silico simulation tools for molecular biology experiments [http://insilico.ehu.es/PCR/] [12, 13] were used for drug resistant gene profiling.
Table 1

Genome sequences of Acinetobacter sp. used in the present study.

S.NORefSeqSpecies of AcinetobacterGenome size (Mb)Genes
1.NC_014259Acinetobacter Sp. DR14.123999
2.NC_005966Acinetobacter Sp. ADP13.593359
3.NC_010400Acinetobacter baumannii SDF3.42*
4.NC_017387Acinetobacter baumannii TCDC-AB07154.13*
5.NC_017162Acinetobacter baumannii 1656-2 chromosome3.93922
6.NC_010611Acinetobacter baumannii ACICU3.93839
7.NC_017847Acinetobacter baumannii MDR-TJ3.964071
8.NC_021726Acinetobacter baumannii BJAB071043.953910
9.NC_017171Acinetobacter baumannii MDR-ZJ063.993882
10.NC_021729Acinetobacter baumannii BJAB08683.903861
11.NC_018706Acinetobacter baumannii TYTH-13.953795
12.NC_021733Acinetobacter baumannii BJAB07154.003918
13.NC_009085Acinetobacter baumannii ATCC 179783.97*
14.NC_010410Acinetobacter baumannii AYE3.933900
15.NC_011595Acinetobacter baumannii AB307-02943.763544
16.NC_011586Acinetobacter baumannii AB00574.053971
17.NC_023028Acinetobacter baumannii ZW85-13.763712
18.NC_020547Acinetobacter baumannii D12797793.703564
19.NC_016603Acinetobacter pitti PHEA-23.863674

* Data not available.

Genome sequences of Acinetobacter sp. used in the present study. * Data not available.

PCR amplification

Primers for thirty seven commonly reported drug resistant genes were selected for the study and are summarized in Table 2. In silico characterization and amplification of resistant genes were performed using in silico simulation tools for molecular biology experiments [12, 13].
Table 2

Primers used in the present study.

TargetPrimer sequence (5′-3′)Amplicon size (bp)Reference
16S-23S rRNA ITS regionF: CATTATCACGGTAATTAGTGR: AGAGCACTGTGCACTTAAG208Chen et al., 2014 [38]
blaOxa-23 likeF: GATCGGATTGGAGAACCAGAR: ATTTCTGACCGCATTTCCAT501Woodford et al., 2006 [39]
blaOxa-24 likeF: GGTTAGTTGGCCCCCTTAAAR: AGTTGAGCGAAAAGGGGATT246Woodford et al., 2006 [39]
blaOxa-51 likeF: TAATGCTTTGATCGGCCTTGR: TGGATTGCACTTCATCTTGG353Woodford et al., 2006 [39]
blaOxa-58 likeF: AAGTATTGGGGCTTGTGCTGR: CCCCTCTGCGCTCTACATAC599Woodford et al., 2006 [39]
blaOxa-143 likeF: TGGCACTTTCAGCAGTTCCTR: TAATCTTGAGGGGGCCAACC149Higgins et al., 2010 [40]
blaVIMF: GTTTGGTCGCATATCGCAACR: AATGCGCAGCACCAGGATAG382Mendes et al., 2007 [41]
blaIMPF: GAATAGAATGGTTAACTCTCR: CCAAACCACTAGGTTATC188Mendes et al., 2007 [41]
blaGIMF: TCAATTAGCTCTTGGGCTGACR: CGGAACGACCATTTGAATGG72Mendes et al., 2007 [41]
blaNDM-1F: GGTTTGGCGATCTGGTTTTCR: CGGAATGGCTCATCACGATC621Nordmann et al., 2011 [42]
ISAba-1F: ATGCAGCGCTTCTTTGCAGGR: AATGATTGGTGACAATGAAG393H'eritier et al., 2006 [43]
ISAba-4F: ATTTGAACCCATCTATTGGCR: ACTCTCATATTTTTTCTTGG611Corvec et al., 2007 [44]
ISAba-125F: GGGTAATGCTCGTATCGTR: TAGACGTAGACGTGGTCA148Lopes and Amyes, 2012 [19]
blaTEMATGATGATTCAACATTTCCGCCAATGCTTAATCAGTGAGG858Verdet et al., 2006 [45]
blaSHVTTATCTCCCTGTTAGCCACCGATTTGCTGATTTCGCTCGG795Verdet et al., 2006 [45]
blaCTX-MCGCTTTGCGATGTGCAGACCGCGATATCGTTGGT550Messai et al., 2008 [46]
blaPERATGAATGTCATTATAAAAGCAATTTGGGCTTAGGGCAGAA925Kim et al., 2004 [47]
blaVEBCGACTTCCATTTCCCGATGCGGACTCTGCAACAAATACGC643Kim et al., 2004 [47]
blaGESATGCGCTTCATTCACGCACCTATTTGTCCGTGCTCAGG860Kim et al., 2004 [47]
blaADCCCGCGACAGCAGGTGGATATCGGCTGATTTTCTTGGTT420Ruiz et al., 2007 [48]
qnr AAGAGGATTTCTCACGCCAGGTGCCAGGCACAGATCTTGAC580Figueira et al., 2011 [49]
qnr BGGMATHGAAATTCGCCACTGTTTGCYGYYCGCCAGTCGAA246Figueira et al., 2011 [49]
qnr SGCAAGTTCATTGAACAGGGTTCTAAACCGTCGAGTTCGGCG428Figueira et al., 2011 [49]
aac6(Ib)TTGCGATGCTCTATGAGTGGCTACTCGAATGCCTGGCGTGTTT482Figueira et al., 2011 [49]
tet AGTAATTCTGAGCACTGTCGCCTGCCTGGACAACATTGCTT954Guardabassi et al., 2000 [50]
tet BCTCAGTATTCCAAGCCTTTGACTCCCCTGAGCTTGAGGGG414Guardabassi et al., 2000 [50]
intI 1CCTTCGAATGCTGTAACCGCACGCCCTTGAGCGGAAGTATC248Murinda et al., 2005 [51]
qacEΔ1GAGGGCTTTACTAAGCTTGCATACCTACAAAGCCCCACGC200Murinda et al., 2005 [51]
sul 1TCAGACGTCGTGGATGTCGCGAAGAACCGCACAATCTCG346Murinda et al., 2005 [51]
sul 2GCGCTCAAGGCAGATGGCATTGCGTTTGATACCGGCACCCGT293Frank et al., 2007 [52]
sul 3GGAAGAAATCAAAAGACTCAACCTAAAAAGAAGCCCATACC363Frank et al., 2007 [52]
intI 2GTAGCAAACGAGTGACGAAATGCACGGATATGCGACAAAAAGGT789Valenzuela et al., 2007 [53]
dfr A1GTGAAACTATCACTAATGGACCCTTTTGCCAGATTTG471Seputiene et al., 2010 [54]
dfr A5GCBAAAGGDGARCAGCTTTTMCCAYATTTGATAGC394Seputiene et al., 2010 [54]
dfr A7AAAATTTCATTGATTTCTGCATTAGCCTTTTTTCCAAATCT471Seputiene et al., 2010 [54]
dfr A8TTGGGAAGGACAACGCACTTACCATTTCGGCCAGATCAAC382Seputiene et al., 2010 [54]
dfr A12GGTGAGCARAAGATYTTTCGCTGGGAAGAAGGCGTCACCCTC309Seputiene et al., 2010 [54]
carOAAAGTATTACGTGTTTTAGTGTTACCAGTAGAAGTTTACACC750Mussi et al., 2005 [55]
Primers used in the present study.

Pulse field gel electrophoresis [PFGE]

PFGE digestion of the selected genome was carried out using Apa I restriction enzyme, which recognizes the site 5′-GGGCCC-3′ to produce cohesive end cleavage. The band pattern obtained after PFGE analysis was used to construct the phylogenetic tree [12, 13]. Lambda DNA ladder was used as a reference standard.

Results

Species confirmation

Acinetobacter baumannii was confirmed using 16S-23S ribosomal DNA intergenic spacer region which produced an amplicon size of 208bp upon in silico amplification using appropriate primers [Table 2]. Out of 19 genomes selected 16 were confirmed as Acinetobacter baumannii, one as A. pitti (G6) [NC_016603], one as A. oleivorans aka Acinetobacter sp. DR1 (G1) [NC_014259] and one as uncharacterized Acinetobacter sp. ADP1 (G2) [NC_005966] [Table 1].

Phylogenetic analysis

PFGE was used for the construction of the phylogenetic tree. The restriction enzyme Apa I was used to cleave genomic DNA sequence of the selected strains and the dendrogram was obtained from the band patterns. Six genotypes [G1- G6] were classified based on strain similarities and were clustered into each of the genotypes [Fig. 1]. Among the 6 genotypes [G], G4 was found to be the major genotype [n = 8; 42.1%] followed by G5 [n = 6; 31.57%], G2 [n = 2; 10.52%], G1, G3, G6 [n = 1; 5.26% each] [Fig. 1].
Fig. 1

Phylogenetic diversity of Acinetobacter sp. identified by in silico pulse field gel electrophoresis.

Phylogenetic diversity of Acinetobacter sp. identified by in silico pulse field gel electrophoresis.

PCR amplification of drug resistant genes

In silico amplification of common drug resistant genes [DR] revealed that out of 37 DR gene analysed, 15 genes showed the presence of amplicons distributed among 4 genotypes [2, 3, 4, 5]. bla was found to be the most prevalent gene in G4 [50%], G5 [37.5%] and G3 [6.25%] among all the 16 genomes analysed. Interestingly, Acinetobacter sp. belonging to G3, G4 and G5 genotypes were positive for bla [100%]. ISAba 1 and ADC 1 were also found to be present in all the strains of A. baumannii belonging to G4. qacEΔ1, sul 1 and sul 2 were predominant in G4 with a prevalence of 43.75%, 43.75%, and 37.5% respectively [Table 3]. About 12 different genes coding for drug resistance have been found in G4 and 5. A. baumannii [NC_021726] harbours the highest number of resistant genes when compared to the other isolates [Table 4]. In silico amplification of DR genes revealed that A. pitti [NC_016603], A. oleivorans aka Acinetobacter sp. DR1 [NC_014259] and uncharacterized Acinetobacter sp. ADP1 [NC_005966] did not produce any amplicon for the panel of genes selected for the study [Fig. 2].
Table 3

Frequency and distribution of drug resistant genes in the genotypes classified.

GenesGenotypeSpecific genotypeNFrequency of DR geneGenotype basedPercentage (%)OverallPercentage (%)
blaoxa-2348562.531.25
56116.76.25
blaoxa-513111006.25
48810050
56610037.5
blaoxa-584822512.5
ISAba148810050
5635018.75
ISAba1253111006.25
4822512.5
blaVEB56116.76.25
blaADC 148810050
56583.331.25
aac6(Ib)3111006.25
4867537.5
tet A56233.312.5
tet B3111006.25
48562.531.25
56116.76.25
qacEΔ13111006.25
48787.543.75
56233.312.5
sul 13111006.25
48787.543.75
56233.312.5
sul 24867537.5
56233.312.5
dfrA156116.76.25
carO2111006.25
48112.56.25
56233.312.5
Table 4

Number of drug resistant genes in each of the genotypes.

S.NORefSeqSpecies of AcinetobacterNumber of PCR positive DR genesGenotype2Genotype3Genotype4Genotype5
1.NC_010400Acinetobacter baumannii SDF1
2.NC_017387Acinetobacter baumannii TCDC-AB07156
3.NC_017162Acinetobacter baumannii 1656-2 chromosome6
4.NC_010611Acinetobacter baumannii ACICU8
5.NC_017847Acinetobacter baumannii MDR-TJ9
6.NC_021726Acinetobacter baumannii BJAB0710410
7.NC_017171Acinetobacter baumannii MDR-ZJ068
8.NC_021729Acinetobacter baumannii BJAB08689
9.NC_018706Acinetobacter baumannii TYTH-18
10.NC_021733Acinetobacter baumannii BJAB07158
11.NC_009085Acinetobacter baumannii ATCC 179784
12.NC_010410Acinetobacter baumannii AYE8
13.NC_011595Acinetobacter baumannii AB307-02942
14.NC_011586Acinetobacter baumannii AB00577
15.NC_023028Acinetobacter baumannii ZW85-15
16.NC_020547Acinetobacter baumannii D12797792
Fig. 2

Distribution of drug resistant genes in the strains belonging to different genotypes.

Frequency and distribution of drug resistant genes in the genotypes classified. Number of drug resistant genes in each of the genotypes. Distribution of drug resistant genes in the strains belonging to different genotypes.

Discussion

When reports on methicillin-resistant Staphylococcus aureus, vancomycin-resistant Enterococcus faecalis and multi-drug resistant Pseudomonas aeruginosa occupied a greater sector of the hospital acquired and community-based infections, a more potent pathogen emerged with mammoth abilities to combat almost all antibiotics of different generations. Acinetobacter baumannii, the critical pathogen, which was once considered to be opportunistic, has stealthily entered the oral cavity. Ignoring this pathogen and its drug-resistant gene repository would pose a serious threat while treating patients with soft tissue infections of the oral cavity. In line with the above facts, the present study was designed to characterize Acinetobacter sp. based on their PFGE pattern into genotypes and attribute frequencies of DR genes in each of the classified genotypes using computational tools. The results of 16S-23S ribosomal DNA intergenic spacer region [ITS] amplification was used to differentiate A. baumannii from other species such as A. pitti, A. oleivorans etc., which was coherent with the genotypic identification of Acinetobacter sp. from clinical samples [14]. The present in silico study showed 100% accuracy in detecting amplicons of ITS region specific for A. baumannii. PFGE was carried out to classify genotypes, which returned 2 major [G4 and G5] and 4 minor genotypes [G1, 2, 3, 6]. Development of resistance in pathogens to antimicrobials is threatening mankind. Intrinsic and extrinsic mechanisms act together to make the pathogen more and more potent against most of the available therapeutic drugs. Common drug resistant mechanisms identified in A. baumannii is associated with carbapenemase production. Beta-lactamases [Ambler class A] and oxacillinases [class D] are two major groups of enzymes responsible for resistance to carbapenems which is most commonly and abundantly used drug in healthcare settings. bla and bla are reported in earlier studies as dominant genes prevalent in A. baumannii [15, 16, 17, 18]. The present study also provides similar findings wherein 50% [n = 8], 37.5% [n = 6] and 6.25% [n = 1] of A. baumannii isolates belonging to G4, G5 and G3 exhibited the presence of bla genes respectively. An interesting finding in this study is that A. baumannii strain SDF was found to be PCR negative for an intrinsic bla gene. The probable reason might be the fact that this strain was isolated from the human body lice and is susceptible to almost all antibiotics [19]. ISAba1 belongs to class 1 integrons which is capable of transferring gene cassettes from one organism to the other. Interestingly, the presence of ISAba1 upstream of bla is known to increase the expression of the encoded enzyme by acting as a strong promoter. In the present study, 100% of strains belonging to G4 and 50% of G5 were found to possess ISAba1. bla was found in majority G4, G3 and one strain of G5, whereas bla was found in a few strains of G4. ampC type of beta-lactamase is naturally produced by Gram-negative bacteria. The enzyme is non-inducible and produced only at very low levels. In the presence of insertion elements, expression of ampC increases with the dissemination of genes thereby elevating the organism to a resistant state. The bla [Acinetobacter derived cephalosporinases] gene encodes ampC β-lactamase, which in the presence of insertion elements ISAba1 or ISAba125, overproduces the enzyme. A comparative study on the placement of ISAba1 or ISAba125 on the upstream of bla was carried out. It was found that expression of bla was 6-times more when compared to constitutively expressed bla with no upstream insertion element. The study also suggested the formation of hybrid gene which combines -10 promoter sequence of ISAba125 and -35 region of bla gene which conferred resistance to cephalosporins [20]. Numerous novel types of extended spectrum beta–lactamase have emerged globally from which VEB [for Vietnamese extended-spectrum beta–lactamase] family is one. The presence of bla has been inconsistent with high prevalence [21] recorded in certain geographical locations and completely absent in a few others [22]. The present study records only one strain [A. baumannii AYE] with bla [n = 1, 16.7%] in G5. Aminoglycoside-modifying enzyme [AME] encoded by aac6 [Ib] renders A. baumannii strains resistant to aminoglycosides including amikacin [23]. This gene is not only found in the chromosome but also found in plasmids, integrons, transposons, genomic islands etc., aac6 [Ib] was found in a few isolates in genotypes 3 [n = 1, 100%] and 4 [n = 6; 75%]. The DR genes tetA and tetB encodes factors specific to efflux pump proteins that scavenge tetracycline from the cells [24]. Tet genes are mostly plasmid encoded and can easily be transferred to other closely related species [25]. While tetA confers resistance towards tetra and doxycycline, tetB includes resistance to minocycline also [26]. Although tetA was found only in G5 [n = 2; 33.3%], tetB was more graciously distributed among G3 [n = 1; 100%], 4 [n = 4; 50%] and 5 [n = 16.7%] in the present study which were concordant with earlier report of Marti et al. 2006 [27], which recorded a prevalence of 13.6% of tetA and 66% of tetB. Another group of efflux system which enables A. baumannii to survive in the environment is the biocide efflux family, encoded by qac genes. qacEΔ1 genes are widely propagated and disseminated through plasmid-mediated class I integrons [28]. High prevalence of qacEΔ1 has been reported in clinical isolates of Acinetobacter making the organism resistant to both antibiotics as well as antiseptics [29]. The current study also records a high frequency of qacEΔ1 gene in the isolates analyzed, with 100%, 87.5% and 33.3% in genotypes 3, 4, and 5 respectively. Sulfonamides, dihydrofolic acid inhibitor, are commonly used in veterinary and clinical settings to treat bacterial and protozoal infections. Three vital genes coding for sulphonamide resistance namely sul1 [30] sul2 [31] and sul3 [32] are located in the 3′-conserved region of class 1 integron and non-conjugative plasmids. All these genes were initially identified in pathogens dwelling in the soil environment. A recent study by Khorsi et al. 2015 [33] reported a high prevalence of sul1 [36.17%] and sul2 [77.65%] in clinical specimens which are in contrast to the findings of the present study with an overall frequency of 62.5% for sul1 and 50% for sul2. A similar gene involved in the folate synthesis dfrA, dihydrofolate reductase mediates drug resistance to trimethoprim. It is one of the few DR genes associated with class II integrons [34]. Akrami et al. [35] and Nourbakhsh et al, 2017 [36], reported the frequency of dfrA1 to be around 77.1% and 63.7% which is very high compared to scores obtained from the present study which is 6.25%. This inconsistency can be attributed to the type, geographical location, association with disease, etc., of the isolates used in the study. carO is a carbapenem associated outer membrane protein [carO] which is a protein that selectively allows the uptake of amino acids and imipenem. Loss of membrane permeability [loss of carO] due to genetic alterations confers resistance towards the specific antibiotic imipenem [37]. Several studies have already established the modification of porins leading to antibiotic resistance. Zhao et al. 2015 [38] reported the prevalence of carO gene in clinical isolates of A. baumannii to be 64.2%. We report a much lesser frequency of carO, which was in the range of 6.25–12.5% distributed among various genotypes. Additionally, we found that three out of four strains with intact carO gene as detected by in silico PCR exhibited susceptibility (A. baumannii SDF) or resistance (A. baumannii ATCC 17978, D1279779) to only a few antibiotics (n = 2–4). In contrast, one strain, A. baumannii BJAB07104, which demonstrated PCR positivity for carO gene was found to harbour about ten genes encoding drug resistance. The paradox identified needs further investigation to justify the relationship between the integrity of membrane proteins and the mechanism of drug resistance. The alarming increase in the number of drug-resistant genes acquired by A. baumannii has made a significant impact in the community settings. On the other hand, the transfer of genes from the pathogen to other commensals intensifies the problem in treating diseases. Several characteristics of A. baumannii such as biofilm formation, ability to survive stressors, desiccation, makes it more suitable to gain entry into the oral cavity. Prosthetic devices, implants contaminated with the pathogen, may delay or even impede the treatment process. Since the oral cavity is loaded with a poly-microbial community, the ease of transfer of drug-resistant genes from one organism to other is remarkably high.

Conclusion

Intrinsic and extrinsic drug resistant mechanisms work parallely to produce a more stable and persistent strain of this pathogen. The remarkable drug-resistant profile of A. baumannii should not be overlooked as it may turn in to a greatest microbial menace in dentistry. Although the study addresses the major factors intended to be discussed, some of the limitations are [a] the phenotype and genotype correlation could not be performed due to lack of antimicrobial sensitivity data, [b] the sequences analysed by in silico method may not reflect the actual frequencies of DR genes in the clinical isolates of oral cavity, as the exposure and selective pressure influences the extrinsic drug-resistant phenotypes, [c] the frequencies of DR gene gives a crude estimate and does not represent all the emerging strains of A. baumannii and most importantly [d] these strains are not derived from oral infections. Nevertheless, this study with all its pros and cons focused has emphasized the fact that resurgence of antibiotic-resistant A. baumannii in community and emergence in dental settings could be a serious threat when ignored. Precautions should be taken to avoid the spread of this pathogen from the healthcare settings into the community or the environment.

Declarations

Author contribution statement

Vijayashree Priyadharsini Jayaseelan: Conceived and designed the experiments; Performed the experiments; Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper. Smiline Girija AS, Paramasivam Arumugam: Analyzed and interpreted the data; Contributed reagents, materials, analysis tools or data; Wrote the paper.

Funding statement

The authors received no funding from an external source.

Competing interest statement

The authors declare no conflict of interest.

Additional information

No additional information is available for this paper.
  52 in total

1.  Distribution and in-vitro transfer of tetracycline resistance determinants in clinical and aquatic Acinetobacter strains.

Authors:  L Guardabassi; L Dijkshoorn; J-M Collard; J E Olsen; A Dalsgaard
Journal:  J Med Microbiol       Date:  2000-10       Impact factor: 2.472

2.  In silico analysis of complete bacterial genomes: PCR, AFLP-PCR and endonuclease restriction.

Authors:  Joseba Bikandi; Rosario San Millán; Aitor Rementeria; Javier Garaizar
Journal:  Bioinformatics       Date:  2004-01-29       Impact factor: 6.937

3.  Emergence of DHA-1-producing Klebsiella spp. in the Parisian region: genetic organization of the ampC and ampR genes originating from Morganella morganii.

Authors:  Charlotte Verdet; Yahia Benzerara; Valérie Gautier; Olivier Adam; Zahia Ould-Hocine; Guillaume Arlet
Journal:  Antimicrob Agents Chemother       Date:  2006-02       Impact factor: 5.191

4.  Antimicrobial resistance and class 1 integrons in pathogenic Escherichia coli from dairy farms.

Authors:  Shelton E Murinda; Paul D Ebner; Lien T Nguyen; Alan G Mathew; Stephen P Oliver
Journal:  Foodborne Pathog Dis       Date:  2005       Impact factor: 3.171

5.  Acquisition of resistance to carbapenems in multidrug-resistant clinical strains of Acinetobacter baumannii: natural insertional inactivation of a gene encoding a member of a novel family of beta-barrel outer membrane proteins.

Authors:  María A Mussi; Adriana S Limansky; Alejandro M Viale
Journal:  Antimicrob Agents Chemother       Date:  2005-04       Impact factor: 5.191

Review 6.  Clinical impact and pathogenicity of Acinetobacter.

Authors:  M-L Joly-Guillou
Journal:  Clin Microbiol Infect       Date:  2005-11       Impact factor: 8.067

7.  A new sulfonamide resistance gene (sul3) in Escherichia coli is widespread in the pig population of Switzerland.

Authors:  Vincent Perreten; Patrick Boerlin
Journal:  Antimicrob Agents Chemother       Date:  2003-03       Impact factor: 5.191

8.  Partial characterization of a transposon containing the tet(A) determinant in a clinical isolate of Acinetobacter baumannii.

Authors:  Anna Ribera; Ignasi Roca; Joaquim Ruiz; Isidre Gibert; Jordi Vila
Journal:  J Antimicrob Chemother       Date:  2003-07-29       Impact factor: 5.790

9.  Outbreak of extended-spectrum beta-lactamase VEB-1-producing isolates of Acinetobacter baumannii in a French hospital.

Authors:  Laurent Poirel; Olivier Menuteau; Nathalie Agoli; Christian Cattoen; Patrice Nordmann
Journal:  J Clin Microbiol       Date:  2003-08       Impact factor: 5.948

10.  Nosocomial outbreak by Proteus mirabilis producing extended-spectrum beta-lactamase VEB-1 in a Korean university hospital.

Authors:  Ja-Young Kim; Yeon-Joon Park; Sang-Il Kim; Moon Won Kang; Seung-Ok Lee; Kyo-Young Lee
Journal:  J Antimicrob Chemother       Date:  2004-11-16       Impact factor: 5.790

View more
  3 in total

1.  Protein targets in red complex pathogens for catechin.

Authors:  T Cibikkarthik; A S Smiline Girija; J Vijayashree Priyadharsini
Journal:  Bioinformation       Date:  2021-12-31

2.  Genistein binding protein targets in dental pathogens.

Authors:  B Vivek Babu; A S Smiline Girija; J Vijayashree Priyadharsini
Journal:  Bioinformation       Date:  2021-12-31

3.  Detection of csgA gene in carbapenem-resistant Acinetobacter baumannii strains and targeting with Ocimum sanctum biocompounds.

Authors:  Saishree R Anchana; Smiline A S Girija; Shoba Gunasekaran; Vijayashree J Priyadharsini
Journal:  Iran J Basic Med Sci       Date:  2021-05       Impact factor: 2.699

  3 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.