Literature DB >> 30348978

Altered hippocampal gene expression and structure in transgenic mice overexpressing neuregulin 1 (Nrg1) type I.

Inga H Deakin1, Beata R Godlewska1, Mary A Walker1, Guo-Jen Huang2, Markus H Schwab3,4, Klaus-Armin Nave3, Amanda J Law1,5, Paul J Harrison6,7.   

Abstract

Transgenic mice overexpressing the type I isoform of neuregulin 1 (Nrg1; NRG1) have alterations in hippocampal gamma oscillations and an age-emergent deficit in hippocampus-dependent spatial working memory. Here, we examined the molecular and morphological correlates of these findings. Microarrays showed over 100 hippocampal transcripts differentially expressed in Nrg1tg-type I mice, with enrichment of genes related to neuromodulation and, in older mice, of genes involved in inflammation and immunity. Nrg1tg-type I mice had an enlarged hippocampus with a widened dentate gyrus. The results show that Nrg1 type I impacts on hippocampal gene expression and structure in a multifaceted and partly age-related way, complementing the evidence implicating Nrg1 signaling in aspects of hippocampal function. The findings are also relevant to the possible role of NRG1 signaling in the pathophysiology of schizophrenia or other disorders affecting this brain region.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 30348978      PMCID: PMC6197224          DOI: 10.1038/s41398-018-0288-2

Source DB:  PubMed          Journal:  Transl Psychiatry        ISSN: 2158-3188            Impact factor:   6.222


Introduction

Neuregulin 1 (Nrg1; NRG1) is a growth factor, signaling via Erbb3 and Erbb4 receptor tyrosine kinases. Nrg1 plays diverse roles in the development, plasticity, and diseases of the nervous system[1-5]. Its pleiotropy arises, in part, from a family of structurally and functionally distinct isoforms (types I to VI), transcribed from different 5’ exons[6]. In humans, allelic variation can affect NRG1 isoform expression[7-9], and polymorphisms in NRG1 may be a risk gene for schizophrenia[10-12], although this has not been confirmed in genome-wide association studies[13]. The type I isoform is affected in schizophrenia, with increased expression in hippocampus[7] and prefrontal cortex[14] compared with controls, and representing one of the abnormalities of NRG1-ErbB4 signaling observed in the disorder[15-18]. Reflecting the interest in the functional and pathological roles of NRG1 type I, a transgenic mouse selectively overexpressing this isoform (Nrg1tg-type I) was created[19], and shown to have alterations in myelination[20] and some aspects of behavior[21], including an age-emergent deficit in hippocampus-dependent spatial working memory[22]. Nrg1tg-type I mice also exhibit a reduced frequency of carbachol-induced hippocampal gamma oscillations[22]. These findings complement a broad body of evidence linking Nrg1 to hippocampal function and plasticity[23-28]. Differing phenotypic profiles are seen in other genetic mouse models of Nrg1, highlighting the existence of isoform-specific properties[29-34]. In the current study we examined two other aspects of the hippocampus in Nrg1tg-type I mice: its transcriptome, and its structure, in comparison with wildtype (wt) littermates. Because of the age-dependent features of the hippocampal phenotype observed previously, the transcriptomic analysis was performed at two ages.

Materials and methods

All experiments were conducted in accordance with the United Kingdom Animals (Scientific Procedures) Act, 1986, and had local ethical approval.

Generation and genotyping of Nrg1tg-type I mice

The generation and genotyping of the Nrg1tg-type I mice has been described[19]. The mice overexpress Nrg1 type I (β1a-isoform) under a Thy-1 promoter, with robust overexpression in multiple brain regions, including the hippocampus, with no alteration in Nrg1 types II or III[20,21]. The experiments reported here were performed in F6-F9 generations of backcross of heterozygous Nrg1tg-type I males with wt C57BL/6 J females, comparing Nrg1tg-type I mice with their wt littermates.

Microarrays and quantitative real-time PCR (RT-qPCR)

Two microarray experiments were performed, one in ‘young adult’ mice (2.5–4 months), the other in ‘old’ mice (14–15 months). Each comprised 24 animals, 6 of each genotype and sex.

RNA extraction and preparation for microarrays

Brains were frozen in isopentane cooled on dry ice. The left hemisphere was placed into RNAlater®-ICE Frozen Tissue Transition Solution (Ambion) at − 20 °C for 18 h, after which the hippocampus was dissected and homogenized in Qiazol in a TissueLyser (Qiagen). Total RNA was extracted and purified with RNeasy lipid tissue Mini kits (Qiagen) according to manufacturer’s protocol. In total, 300 ng RNA was used for amplification and labeling with Illumina® TotalPrep™ RNA Amplification Kit (Ambion). Complementary RNA (cRNA) quality was determined with an Agilent 2100 Bioanalyser (Agilent Technologies, Palo Alto, CA). A total of 1.5 µg cRNA from each brain was hybridized to an Illumina Mouse WG-6 v1.1 (young mice) or v2 (old mice) chip according to manufacturers’ protocol and scanned with a BeadStation 500 machine.

Microarray analysis

Standard quality control measures were performed with the BeadStudio program (Illumina, CA), including subtracting the background from each array from the raw signal intensity of each probe type. The raw signal intensity data underwent variance stabilizing normalization, which is a generalized log2 transformation of the signal. A quantile standardization procedure was used to centralize the mean signal in the distribution (i.e., of all the probes) and to equalize the variance between mice. Further quality control was performed such as hierarchical clustering and box plots of normalized intensity (robust multichip average; RMA) values for each chip. A linear model with an empirical Bayes t-statistic was fitted to the data to generate lists of significant effects of genotype, using the Limma program[35]. We corrected for multiple testing with the Benjamini–Hochberg false discovery rate to give an adjusted p value[36]. The criteria for differential expression were an adjusted p value < 0.05 and an absolute (unlogged RMA) fold change in expression (FC) > 1.5. Differentially expressed probe lists were condensed into lists of differentially expressed transcripts, including known splice variants, identified with PubMed basic local alignment search tool (BLAST). Probes with no accession number were identified by nucleotide sequence with PubMed Nucleotide BLAST. Results from each array were compared with obtain lists of genes that were differentially expressed in NRG1tg-type I mice at both ages, or only at one of the two ages. These three lists of genes were used for further investigation with Ingenuity Pathways Analysis (IPA; Ingenuity Systems), which generated networks of up to 35 genes based on their known functional links[37].

RT-qPCR

Hippocampal RNA was treated with 1 μl (1 unit) RQ1 RNase-free DNAse (Promega) and 0.6 μl (24 units) RNasin ribonuclease inhibitor (Promega) at 37 °C for 30 min and then heated to 72 °C for 10 min. DNAse-treated RNA was reverse-transcribed using 1 μl (200 units) MMLV reverse transcriptase, Promega), 1xMMLV buffer, 0.8 μl of 10 mM dNTPs, 0.6 μl (24 units) RNasin, 0.6 μl of 10 mM oligoDTs. The reaction mix was incubated at 42 °C for 1 h and then heated to 72 °C for 10 min. The reverse-transcribed RNA (complementary DNA; cDNA) was diluted with nuclease-free water and stored at − 80 °C. TaqMan assays were ordered from Applied Biosystems (Npy, Mm00445771_m1; Gfap, Mm01253034_m1; Inhba, Mm00434339_m1; Cntfr, Mm00516697_m1; C1qa, Mm00432142_m1; Rbbp4, Mm00771401_g1). Bdnf was detected using pan-BDNF primers and a TaqMan probe (Forward, 5′-GGGTCACAG CGGCAGATAAA-3′, Reverse 5′-GCCTTTGGATACCGGGACTT-3′; Probe, TCTGGCGGGACGGTCACAGTCCTA)[38]. Bdnf v1-specific probes[39] were: Forward, 5′-CACATTACCTTCCTGCATCTGTTG-3′, reverse 5′-ACCATAGTAAGGAAAAGGATGGTCAT-3′, probe AAGCCACAATGTTCCACCAG. The PCR reaction mix included 15 ng cDNA, 1xTaqMan Universal PCR Master Mix (Applied Biosystems) and the assay in a final volume (with nuclease-free water) of 15 μl in 384-well plates. Nrg1 mRNA was quantified using a SyBr green assay, with the primers designed so that the PCR product would span the exon boundary between the type I-specific exon and the immunoglobulin-like domain, and checked in the BLAST database for binding specificity (Forward, 5′-AAGGGGAAGGGCAAGAAGAA-3′, Reverse 5′-TCTTTCAATCTGGGAGGCAAT-3′; Eurogentech). The reaction mix for Nrg1 type I was 1xSyBr Green Mix, 15 ng cDNA, 200 nM of each primer and nuclease-free water up to a final volume of 15 μl. Standard curves of pooled cDNA from all samples were set up in triplicate with the starting amount of cDNA ranging from 100 ng to 0.54 pg (Nrg1), 5 pg (Npy), 0.01 ng (Gfap), or 0.39 ng (Inhba, Cntfr, C1qa, Rbbp4). The R2 of all standard curves was > 0.99. All experimental samples fell within the standard curve. Samples were run in triplicate on the same plate as the standard curve. No-template controls and RT-negative controls were also run in triplicate to test for any contamination of the reaction mix or cDNA, respectively. Cycling conditions for all qRT-PCR reactions were 50 °C for 2 min, 95 °C for 10 min and then 40 repeats of 95 °C for 15 seconds to denature and 60 °C for 1 min.

Morphology and histology

Snap-frozen brains from 10-month-old wt and Nrg1tg-type I mice were coronally cryosectioned at 20 μm thickness. Hippocampal area was measured by point counting on multiple cresyl violet-stained sections throughout the dorsoventral extent, and hippocampal volume estimated using Cavalieri’s theorem as described[40]. Whole brain volume was estimated in the same way. We also measured the cross-sectional area of subfields (dentate gyrus, CA3, CA1) by manual tracing using a Nikon Eclipse 3600 microscope coupled to an MCID Elite image analysis system (Interfocus, Haverhill, UK). Other sections were immunostained for parvalbumin (PV27, 1:100; Swant, Switzerland), detected with diaminobenzidine, by standard methods. All measurements were made blind to genotype.

Results

The hippocampal transcriptome of Nrg1tg-type I mice: age-related effects on genes involved in myelination, neurotransmission, and immunity

Nrg1 impacts upon the expression of many individual genes[1,3]. Here we used microarrays as an unbiased method to identify transcripts and networks altered in the hippocampus of Nrg1tg-type I mice. Adopting a stringent statistical approach, and with a 1.5-fold change threshold, we identified over 100 differentially expressed genes, of which ~ 80% were increased in Nrg1tg-type I mice compared with wt (Fig. 1a, and Supplementary Tables 1–3). Thirty-eight transcripts were altered in the same direction at both ages (Supplementary Table 1), 20 were differentially expressed only in the young adult (2.5–4 month) Nrg1tg-type I mice (Supplementary Table 2) and 54 only in old (14–15 month) Nrg1tg-type I mice (Supplementary Table 3). Eight transcripts were selected for qPCR validation, based on the microarray results as well as what was known about their functions and interactions with Nrg1 (Fig. 1b–d; and Table 1).
Fig. 1

Hippocampal gene expression in Nrg1tg-type I mice.

a Genes meeting the criteria described in text for differential expression in young (yellow) or old (blue) adult Nrg1tg-type I mice, or Nrg1tg-type I mice of both ages (orange). b–d examples of RT-qPCR validation of transcripts from each group. b Npy mRNA, increased in Nrg1tg-type I mice of both ages; c Cntfr mRNA, decreased in young but not old adult Nrg1tg-type I mice; d C1q mRNA, increased in old but not young adult Nrg1tg-type I mice. Statistics for the data shown in panels b–d are given in Table 1. e An IPA network of transcripts differentially expressed in old but not young adult Nrg1tg-type I mice. The network comprises nodes (genes) and their biological relationships shown by interconnecting lines. Red nodes are transcripts with increased expression, and the green nodes are transcripts with lower expression, in the old Nrg1tg-type I mice, compared with their age-matched wt controls. Increasing color intensity indicates a greater fold change. White nodes show genes that are functionally related to the other differentially expressed genes in the network and added by IPA. Solid lines between nodes indicate a direct interaction between them and dashed lines indicate indirect relationships. A continuous line denotes “binding only”; pointed line, “acts upon” and blunt ended line, “inhibits”. For gene symbols and names, see Supplementary Table 4. For additional IPA networks identified in one or both age groups of Nrg1tg-type I mice, see Supplementary Tables 1–3 and Supplementary Figures 1–4

Table 1

Quantitative RT-PCR validation of differentially expressed genes in Nrg1tg-type I mice

Young adult (2.5–4 months)Old (4–15 months)
MicroarrayqRT-PCRMicroarrayqRT-PCR
AccessionGeneFC p FC p FC p FC p
NRG1 type I8.602.62E-198010.001NANA4660.001
NM_023456.2NPY2.221.01E-052.00.0052.469.93E-062.60.001
NM_010277GFAP1.591.69E-03NCNC1.621.42E-021.50.036
NM_007540.3BDNF v11.654.12E-043.50.0012.768.00E-07NCNC
NM_008380.1Inhba2.284.83E-06NCNCNCNC2.70.001
NM_016673.1Cntfr−1.865.66E-03−3.40.068NCNCNCNC
NM_007572C1qaNCNCNCNC1.606.14E-041.40.032
NM_009030Rbbp4NCNCNCNC−1.896.14E-04NCNC

NA: probe not present on array. NC: no significant change. The statistical approach to the microarray data is described in text; p values for qRT-PCR are from unpaired t tests (two-tailed) comparing transgenic and wt mice of each age group

Hippocampal gene expression in Nrg1tg-type I mice.

a Genes meeting the criteria described in text for differential expression in young (yellow) or old (blue) adult Nrg1tg-type I mice, or Nrg1tg-type I mice of both ages (orange). b–d examples of RT-qPCR validation of transcripts from each group. b Npy mRNA, increased in Nrg1tg-type I mice of both ages; c Cntfr mRNA, decreased in young but not old adult Nrg1tg-type I mice; d C1q mRNA, increased in old but not young adult Nrg1tg-type I mice. Statistics for the data shown in panels b–d are given in Table 1. e An IPA network of transcripts differentially expressed in old but not young adult Nrg1tg-type I mice. The network comprises nodes (genes) and their biological relationships shown by interconnecting lines. Red nodes are transcripts with increased expression, and the green nodes are transcripts with lower expression, in the old Nrg1tg-type I mice, compared with their age-matched wt controls. Increasing color intensity indicates a greater fold change. White nodes show genes that are functionally related to the other differentially expressed genes in the network and added by IPA. Solid lines between nodes indicate a direct interaction between them and dashed lines indicate indirect relationships. A continuous line denotes “binding only”; pointed line, “acts upon” and blunt ended line, “inhibits”. For gene symbols and names, see Supplementary Table 4. For additional IPA networks identified in one or both age groups of Nrg1tg-type I mice, see Supplementary Tables 1–3 and Supplementary Figures 1–4 Quantitative RT-PCR validation of differentially expressed genes in Nrg1tg-type I mice NA: probe not present on array. NC: no significant change. The statistical approach to the microarray data is described in text; p values for qRT-PCR are from unpaired t tests (two-tailed) comparing transgenic and wt mice of each age group Genes upregulated at both ages in the NRG1tg-type I mice included neuropeptide Y (Npy), brain-derived neurotrophic factor (Bdnf), and glial fibrillary acidic protein (Gfap). Consistent with the Npy mRNA data, Npy-immunoreactive hippocampal interneurons were markedly more prominent in the Nrg1tg-type I mice (not shown). The Bdnf mRNA increase affected the V1 isoform selectively. IPA generated two networks with scores corresponding to significance values of p = 10−31 and p = 10−25 (Supplementary Figs. 1 and 2). Network 1 included, as well as Npy and Bdnf, several transcripts involved in neurotransmission and implicated in schizophrenia, such as dopamine D1 and D4 receptors (Drd1 and Drd4). Of the genes differentially expressed in young but not old Nrg1tg-type I mice, three were involved in myelination (myelin basic protein (Mbp), myelin oligodendrocyte glycoprotein (Mog), and myelin-associated oligodendrocytic basic protein). IPA generated a network that included Mog and Mbp (p = 10−35; Supplementary Fig. 3). Genes overexpressed in old but not young Nrg1tg-type I mice (Supplementary Table 3) included many with immune and inflammatory functions, and IPA generated two highly significant networks (p = 10−37 and p = 10−34; one is shown in Fig. 1e, the other in Supplementary Fig. 4). In particular, the network shown in Fig. 1e includes many upregulated HLA and major histocompatibility complex (MHC) genes (Supplementary Table 4).

Nrg1tg-type I mice have altered hippocampal morphology

As shown in Fig. 2a, the hippocampus was enlarged (by ~ 25%) in Nrg1tg-type I mice, with brain volume unchanged. In terms of individual subfields, the only difference observed in Nrg1tg-type I mice was that the dentate gyrus granule cell layer was wider than in wt mice; this was primarily in the infra-pyramidal (external) blade rather than the supra-pyramidal (internal) blade (Fig. 2b, c). The density of PV + interneurons was unchanged in each subfield measured (Fig. 2d).
Fig. 2

Hippocampal morphology in Nrg1tg-type I mice.

a Hippocampal volume is increased in Nrg1tg-type I mice (n = 10) compared with wt (n = 9; two-tailed unpaired t test, t = 3.249, df = 17, p = 0.006), but whole brain volume is unchanged. b The width of the dentate gyrus granule cell layer is increased in Nrg1tg-type I mice in the infra-pyramidal blade (n = 6 in each group; two-tailed unpaired t test, t = 4.126, df = 10, p = 0.002) but not in the supra-pyramidal blade. c Illustration of the data in b, showing the wider infra-pyramidal blade (IPB) in a Nrg1tg-type I mouse compared with a wt mouse. The supra-pyramidal blade (SPB) is also shown, with CA3 in between. d The density of parvalbumin (PV)-immunoreactive cells did not differ in Nrg1tg-type I mice (n = 10) compared with wt (n = 12). Bars in a, b, and d show mean and standard deviation. All data in this Figure come from 10-month-old mice

Hippocampal morphology in Nrg1tg-type I mice.

a Hippocampal volume is increased in Nrg1tg-type I mice (n = 10) compared with wt (n = 9; two-tailed unpaired t test, t = 3.249, df = 17, p = 0.006), but whole brain volume is unchanged. b The width of the dentate gyrus granule cell layer is increased in Nrg1tg-type I mice in the infra-pyramidal blade (n = 6 in each group; two-tailed unpaired t test, t = 4.126, df = 10, p = 0.002) but not in the supra-pyramidal blade. c Illustration of the data in b, showing the wider infra-pyramidal blade (IPB) in a Nrg1tg-type I mouse compared with a wt mouse. The supra-pyramidal blade (SPB) is also shown, with CA3 in between. d The density of parvalbumin (PV)-immunoreactive cells did not differ in Nrg1tg-type I mice (n = 10) compared with wt (n = 12). Bars in a, b, and d show mean and standard deviation. All data in this Figure come from 10-month-old mice

Discussion

Mice selectively overexpressing the type I isoform of Nrg1 show differences in hippocampal function and age-emergent deficits in hippocampus-dependent behavior[22]. Here, we report that these changes are accompanied by an altered profile of gene expression which differs between young adult (2.5–4 month) and old (14–15 month) Nrg1tg-type I mice, and by an increase in hippocampal volume.

The hippocampal molecular and morphological profile of Nrg1tg-type I mice

Nrg1tg-type I mice exhibited differential expression of a number of genes (Fig. 1; Table 1; Supplementary Figures 1–4; Supplementary Tables 1–3). Of the genes overexpressed in Nrg1tg-type I mice at both ages, several are noteworthy. In particular, five transcripts (Npy, Gfap, Bdnf, Drd1, and Drd4) were part of the most significant gene network and all had been linked previously to Nrg1. The fact they were upregulated in both age cohorts, which were studied separately and with different versions of the microarray chip, strengthens the robustness of the findings. Npy is expressed by a subpopulation of hippocampal interneurons, bistratified and ivy cells, which impose a strong inhibitory influence on pyramidal cell dendrites[41,42]. Its marked upregulation in the Nrg1tg-type I mice (Fig. 1b) is of interest for several reasons. First, it provides another hint that interneurons are affected and may contribute to the oscillatory and circuitry alterations that underlie the phenotype of the mice[41-44]. Second, Npy is anti-epileptic[45-47], and enhanced Npy expression may help prevent the epileptiform predisposition of Nrg1tg-type I mice[22] progressing to overt seizure activity. Third, the Npy mRNA elevation may be related to the morphological finding of a widened dentate gyrus. Preliminary data show an increase of hilar cells immunoreactive for doublecortin, a marker of newly formed neurons, in the Nrg1tg-type I mice (I.H.D. and P.J.H., unpublished observations), suggesting that the enlarged dentate gyrus might reflect increased adult neurogenesis—a process stimulated by Npy[48-50], and influenced by Nrg1[51]. Whether the persisting upregulation of Gfap mRNA in Nrg1tg-type I mice (Table 1) is also indicative of enhanced cell proliferation—as many neural precursors express Gfap[52]—remains to be seen; it might also be a remnant of the developmental role of Nrg1-ErbB signaling in neuron–astrocyte differentiation[53,54]. Bdnf is a regulator of hippocampal plasticity and function[55], and its elevated expression may have many manifestations in the Nrg1tg-type I mice, including a contribution to their spatial working memory deficit[22,56]. Finally, the upregulation of Drd1 and Drd4 mRNAs complements evidence that hippocampal Drd4 mediates Nrg1-induced reversal of LTP[24], and that Nrg1 application produces acute[57] and sustained[58] increases in dopamine release and dopamine neuron firing[59]. Another Nrg genetic mouse model also shows dopamine receptor alterations[60]. The gene expression differences that occurred in the old but not young Nrg1tg-type I were striking, comprising many immune and inflammatory genes, such as HLA-DR, MHC class II CD74, and complement C1q. Similar changes have been reported in old vs. young wt rodents and in this respect there may be an ‘accelerated aging’ phenotype in Nrg1tg-type I mice[61-64]. C1q, like other complement factors, is also involved in neuronal and synaptic function[65-67] and dysfunction[68-70] and brain aging[71]. As such, the altered expression of the genes in the older Nrg1tg-type I mice may represent molecular correlates of, and might contribute to, their age-emergent memory impairment. Fewer genes were differentially expressed in the young but not old Nrg1tg-type I mice, and they were primarily myelin-related. This is not unexpected, in that Nrg1 is a critical player in myelination[72,73]. Although the type I isoform has hitherto been implicated primarily in peripheral myelination[19,74,75], these mice do show hypermyelination of small diameter axons in the central nervous system[20]. The upregulation of myelin-related transcripts in the Nrg1tg-type I mice may be a molecular indication that this process is also occurring in the hippocampus; any resulting hypermyelination may in turn contribute to the hippocampal volume increase. However, this remains speculative; indeed, more generally, the processes that link the morphological and molecular alterations reported here remain unknown. The altered transcriptomic profile of the Nrg1tg-type I mice highlights an issue that pertains broadly to genetically modified animals: their phenotypes need not arise solely from the targeted gene(s) but also from the cascade of molecular changes which the manipulation induces. Moreover, these effects are not static but vary with age, and illustrate the value of going beyond the 3–6 month time-point at which characterization is often completed, even though capturing the temporal dynamic and longitudinal profile is demanding of resources and time.

Implications for NRG1 in schizophrenia

The evidence mentioned earlier showing Nrg1-dopamine interactions, and the increased D1 and D4 receptor expression seen here is notable, given that dopaminergic abnormalities are a final common pathway in schizophrenia pathophysiology[76], and alterations in both receptors have been reported in the disorder[77,78]. The MHC complex is strongly implicated in schizophrenia[79], in part through the complement C4 gene[80], and several[81-84] though not all[85] studies report elevated expression of many immune and inflammatory genes, including C1q, especially in older, chronically ill patients[86], reminiscent of the gene expression changes being restricted to the old Nrg1tg-type I mice. There is also some evidence for direct links between NRG1, immune function, and schizophrenia[87-89]. However, there is less congruence when other findings are considered. Thus, in schizophrenia, in contrast to findings in the Nrg1tg-type I mice, hippocampal myelin-related transcripts are decreased[90], hippocampal volume is unchanged or reduced[91], and there is a lower density of hippocampal PV + neurons[92]. Thus, although the phenotype of Nrg1tg-type I mice may be seen as overlapping to an extent with that of schizophrenia, the differences are at least as striking as the similarities. One specific factor to consider is that the magnitude of overexpression in the Nrg1tg-type I mouse is far greater than the increased NRG1 type I expression reported in schizophrenia. More generally, these considerations draw attention to the need for cautious interpretation and extrapolation from any genetic mouse model to the human syndrome. Nevertheless, the results extend the evidence that Nrg1 type I is functional in the hippocampus, and hence may play a role in any disease in which its expression in this brain region is altered. Supplementary Materials
  90 in total

1.  Hippocampal and cognitive aging across the lifespan: a bioenergetic shift precedes and increased cholesterol trafficking parallels memory impairment.

Authors:  Inga Kadish; Olivier Thibault; Eric M Blalock; Kuey-C Chen; John C Gant; Nada M Porter; Philip W Landfield
Journal:  J Neurosci       Date:  2009-02-11       Impact factor: 6.167

2.  Hippocampal gene expression changes during age-related cognitive decline.

Authors:  Traci L Pawlowski; Linda L Bellush; Amy W Wright; Jon P Walker; Robert A Colvin; Matthew J Huentelman
Journal:  Brain Res       Date:  2008-12-25       Impact factor: 3.252

3.  Combined gene overexpression of neuropeptide Y and its receptor Y5 in the hippocampus suppresses seizures.

Authors:  Casper R Gøtzsche; Litsa Nikitidou; Andreas T Sørensen; Mikkel V Olesen; Gunnar Sørensen; Søren H O Christiansen; Mikael Ängehagen; David P D Woldbye; Merab Kokaia
Journal:  Neurobiol Dis       Date:  2011-08-22       Impact factor: 5.996

4.  Brain-derived neurotrophic factor (BDNF) overexpression in the forebrain results in learning and memory impairments.

Authors:  Carla Cunha; Andrea Angelucci; Angela D'Antoni; Mate D Dobrossy; Stephen B Dunnett; Nicoletta Berardi; Riccardo Brambilla
Journal:  Neurobiol Dis       Date:  2008-11-27       Impact factor: 5.996

Review 5.  New insights into the role of brain-derived neurotrophic factor in synaptic plasticity.

Authors:  Emily G Waterhouse; Baoji Xu
Journal:  Mol Cell Neurosci       Date:  2009-07-03       Impact factor: 4.314

6.  Neuregulin 1-erbB signaling is necessary for normal myelination and sensory function.

Authors:  Suzhen Chen; Miguel Omar Velardez; Xavier Warot; Zhao-Xue Yu; Shyra J Miller; Didier Cros; Gabriel Corfas
Journal:  J Neurosci       Date:  2006-03-22       Impact factor: 6.167

Review 7.  Neuregulin-1 and schizophrenia in the genome-wide association study era.

Authors:  Md Shaki Mostaid; David Lloyd; Benny Liberg; Suresh Sundram; Avril Pereira; Christos Pantelis; Tim Karl; Cynthia Shannon Weickert; Ian P Everall; Chad A Bousman
Journal:  Neurosci Biobehav Rev       Date:  2016-06-06       Impact factor: 8.989

Review 8.  The glial nature of embryonic and adult neural stem cells.

Authors:  Arnold Kriegstein; Arturo Alvarez-Buylla
Journal:  Annu Rev Neurosci       Date:  2009       Impact factor: 12.449

Review 9.  Cellular targets for neuropeptide Y-mediated control of adult neurogenesis.

Authors:  Maria Concetta Geloso; Valentina Corvino; Valentina Di Maria; Elisa Marchese; Fabrizio Michetti
Journal:  Front Cell Neurosci       Date:  2015-03-16       Impact factor: 5.505

10.  Elevated peripheral expression of neuregulin-1 (NRG1) mRNA isoforms in clozapine-treated schizophrenia patients.

Authors:  Md Shaki Mostaid; Ting Ting Lee; Gursharan Chana; Suresh Sundram; Cynthia Shannon Weickert; Christos Pantelis; Ian Everall; Chad Bousman
Journal:  Transl Psychiatry       Date:  2017-12-11       Impact factor: 6.222

View more
  5 in total

1.  NMDA Receptors Regulate Neuregulin 2 Binding to ER-PM Junctions and Ectodomain Release by ADAM10 [corrected].

Authors:  Detlef Vullhorst; Andres Buonanno
Journal:  Mol Neurobiol       Date:  2019-06-25       Impact factor: 5.590

2.  Temporal Dynamics of the Neuregulin-ErbB Network in the Murine Prefrontal Cortex across the Lifespan.

Authors:  Clare Paterson; Brooke Cumming; Amanda J Law
Journal:  Cereb Cortex       Date:  2020-05-14       Impact factor: 5.357

Review 3.  Regulation of Synaptic Development by Astrocyte Signaling Factors and Their Emerging Roles in Substance Abuse.

Authors:  Christopher D Walker; W Christopher Risher; Mary-Louise Risher
Journal:  Cells       Date:  2020-01-26       Impact factor: 6.600

4.  Overexpression of neuregulin 1 in GABAergic interneurons results in reversible cortical disinhibition.

Authors:  Yao-Yi Wang; Bing Zhao; Meng-Meng Wu; Xiao-Li Zheng; Longnian Lin; Dong-Min Yin
Journal:  Nat Commun       Date:  2021-01-12       Impact factor: 14.919

5.  Neuregulin 3 rs10748842 polymorphism contributes to the effect of body mass index on cognitive impairment in patients with schizophrenia.

Authors:  Yongjie Zhou; Yuhuan Li; Yujie Meng; Jiesi Wang; Fengchun Wu; Yuping Ning; Yi Li; Ryan M Cassidy; Zezhi Li; Xiang Yang Zhang
Journal:  Transl Psychiatry       Date:  2020-02-11       Impact factor: 6.222

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.