Literature DB >> 30296949

Engineering of glycerol utilization in Gluconobacter oxydans 621H for biocatalyst preparation in a low-cost way.

Jinxin Yan1, Jing Xu1,2, Menghao Cao1, Zhong Li1, Chengpeng Xu1, Xinyu Wang1, Chunyu Yang1, Ping Xu3, Chao Gao1, Cuiqing Ma4.   

Abstract

BACKGROUND: Whole cells of Gluconobacter oxydans are widely used in various biocatalytic processes. Sorbitol at high concentrations is commonly used in complex media to prepare biocatalysts. Exploiting an alternative process for preparation of biocatalysts with low cost substrates is of importance for industrial applications.
RESULTS: G. oxydans 621H was confirmed to have the ability to grow in mineral salts medium with glycerol, an inevitable waste generated from industry of biofuels, as the sole carbon source. Based on the glycerol utilization mechanism elucidated in this study, the major polyol dehydrogenase (GOX0854) and the membrane-bound alcohol dehydrogenase (GOX1068) can competitively utilize glycerol but play no obvious roles in the biocatalyst preparation. Thus, the genes related to these two enzymes were deleted. Whole cells of G. oxydansGOX1068GOX0854 can be prepared from glycerol with a 2.4-fold higher biomass yield than that of G. oxydans 621H. Using whole cells of G. oxydansGOX1068GOX0854 as the biocatalyst, 61.6 g L-1 xylonate was produced from 58.4 g L-1 xylose at a yield of 1.05 g g-1.
CONCLUSION: This process is an example of efficient preparation of whole cells of G. oxydans with reduced cost. Besides xylonate production from xylose, other biocatalytic processes might also be developed using whole cells of metabolic engineered G. oxydans prepared from glycerol.

Entities:  

Keywords:  Biocatalysis; Gluconobacter oxydans 621H; Glycerol; Xylonate

Mesh:

Substances:

Year:  2018        PMID: 30296949      PMCID: PMC6174558          DOI: 10.1186/s12934-018-1001-0

Source DB:  PubMed          Journal:  Microb Cell Fact        ISSN: 1475-2859            Impact factor:   5.328


Background

Gluconobacter oxydans is capable of incompletely oxidizing a large variety of carbohydrates and alcohols [1-3]. Whole cells of G. oxydans have been widely used in production of a variety of compounds such as vitamin C, dihydroxyacetone (DHA), xylonate and gluconate [4-8]. Traditionally, G. oxydans is cultivated in complex media with high concentrations of sorbitol and yeast extract [9]. The high biocatalyst manufacturing cost might hamper the scale-up application of G. oxydans in biotransformation. To cope with this problem, several studies were carried out to prepare whole cells of G. oxydans from other carbon sources. For example, the membrane-bound glucose dehydrogenase (GDHK) in G. oxydans 621H was disrupted, and the mutant strain was laboratory-evolved with glucose as the sole carbon source and yeast extract as the nitrogen source. Whole cells of the evolved strain grown on a low concentration of glucose exhibited similar catalytic efficiency with the wild-type strain cultured on high concentrations of sorbitol [10]. Glycerol is an inevitable waste generated during the production of biofuels such as bioethanol and biodiesel [11-15]. Approximately 1 kg of crude glycerol is produced during the production of 9 kg of biodiesel [16]. The global annual production of glycerol is estimated to reach approximately 4.2 million tons in 2020 (OECD/FAO 2012) [17]. The existing market for industrial application of glycerol is only 1 million tons/year [13]. Therefore, it is desirable to develop new processes that can convert glycerol into high-value products such as DHA and glycerate [18, 19]. Besides an attractive substrate for the production of value-added products [19-21], glycerol can also be used as a cheap carbon source to culture various microbes (Additional file 1: Table S1). Whole cells prepared from glycerol can be used in lipids extraction (oil-accumulating microbes) or biocatalysis processes (microbes with different enzymes) [22-25]. G. oxydans 621H is able to utilize glycerol as the energy source in complex media and producing glycerate and DHA as the glycerol oxidation products [26-29]. Preparing whole cells of G. oxydans as biocatalysts using glycerol as the sole carbon source in mineral salts media is desirable for industrial processes. In this study, the glycerol utilization mechanism of G. oxydans 621H was elucidated. Then, a mutant strain that can grow with low glycerol consumption but high yield of biomass was constructed (Fig. 1). Whole cells of the mutant strain were prepared from glycerol and then used in the biotransformation of xylose into xylonate, an important platform chemical with versatile applications [30, 31].
Fig. 1

Scheme for the efficient preparation of whole-cell biocatalyst of G. oxydans 621H from biofuel-industry generated glycerol

Scheme for the efficient preparation of whole-cell biocatalyst of G. oxydans 621H from biofuel-industry generated glycerol

Results and discussion

G. oxydans 621H can grow in mineral salts media with glycerol

Up to 73 g L−1 sorbitol is usually required for the growth of G. oxydans in complex media [32]. In order to reduce the culturing costs, the growth of G. oxydans 621H in mineral salts media containing 10 g L−1 various carbon sources including glycerol, sorbitol, glucose, fructose, xylose, pyruvate, and lactate was firstly studied. As shown in Fig. 2, G. oxydans 621H can grow in mineral salts media with glycerol, sorbitol, or glucose as the sole carbon source. After culture for 24 h, ∆OD was 0.63 when G. oxydans 621H was grown in glycerol, which was higher than that of the strain cultured in sorbitol and glucose. Growth of G. oxydans in medium containing glucose proceeds in two metabolic phases [33]. The fluctuation of ∆OD when G. oxydans 621H was grown in glucose might be due to the switch of different metabolic phases.
Fig. 2

Growth of G. oxydans 621H in mineral salts media containing 10 g L−1 of different carbon sources. Growth (ΔOD600 nm) was calculated as the final OD reached at 12 h (black); 24 h (red); and 36 h (blue) minus the initial OD at 600 nm. The error bars represent the standard deviations of three independent experiments

Growth of G. oxydans 621H in mineral salts media containing 10 g L−1 of different carbon sources. Growth (ΔOD600 nm) was calculated as the final OD reached at 12 h (black); 24 h (red); and 36 h (blue) minus the initial OD at 600 nm. The error bars represent the standard deviations of three independent experiments

There are three potential pathways related to glycerol metabolism

The robust growth of G. oxydans 621H on glycerol was accompanied by the rapid consumption of glycerol and the accumulation of a large amount of DHA and a trace amount of glycerate (Fig. 3). After 24 h of culture, 10.8 ± 0.07 g L−1 of glycerol were consumed and the OD600 nm of G. oxydans reached around 0.9. DHA gradually accumulated to a final concentration of 9.26 ± 0.07 g L−1. The yield of DHA was 0.86 g g−1 glycerol, indicating that glycerol was majorly oxidized to DHA during the growth of G. oxydans 621H.
Fig. 3

Growth of G. oxydans 621H and its derivatives in mineral salts medium with 10 g L−1 of glycerol as the sole carbon source. Cell density a, glycerol b, DHA c, and glycerate d were assayed. (Black square) G. oxydans 621H, (red circle) G. oxydans ∆GOX1068, (blue triangle) G. oxydans ∆GOX0854, (pink inverted triangle) G. oxydans ∆GOX2088 and (green diamond) G. oxydans ∆GOX1068∆GOX0854. The error bars represent the standard deviations of three independent experiments

Growth of G. oxydans 621H and its derivatives in mineral salts medium with 10 g L−1 of glycerol as the sole carbon source. Cell density a, glycerol b, DHA c, and glycerate d were assayed. (Black square) G. oxydans 621H, (red circle) G. oxydansGOX1068, (blue triangle) G. oxydansGOX0854, (pink inverted triangle) G. oxydansGOX2088 and (green diamond) G. oxydansGOX1068GOX0854. The error bars represent the standard deviations of three independent experiments As shown in Table 1, three putative enzymatic systems related to glycerol metabolism have been annotated in the genome of G. oxydans 621H [34]. Glycerol can be catalyzed to glyceraldehyde by membrane-bound alcohol dehydrogenase that consists of two subunits (GOX1067 and GOX1068), and then glyceraldehyde will be oxidized to glycerate by aldehyde dehydrogenase. Glycerol can also be converted into DHA by the major polyol dehydrogenase that consists of two subunits, GOX0854 and GOX0855. There is also a glycerol utilization operon that consists of glpD encoding a glycerol-3-phosphate dehydrogenase (GOX2088), glpF encoding a glycerol transporter (GOX2089), glpK encoding a glycerol kinase (GOX2090), and glpR encoding a transcriptional regulatory protein (GOX2087). Glycerol can be transported into cells through GlpF, phosphorylated by GlpK to produce glycerol-3-phosphate (G3P) and G3P will then be dehydrogenated by GlpD to dihydroxyacetone phosphate (DHAP). DHAP will finally be channeled into central metabolism [35-37].
Table 1

Genes related to glycerol utilization in G. oxydans 621H

GeneLocus tagProteinFunction
adhAB GOX1067-1068Alcohol dehydrogenase cytochrome c subunitDehydrogenation of primary alcohols
sldAB GOX0854-0855Glycerol dehydrogenaseOxidation of glycerol to  DHA
glpR GOX2087Glycerol-3-phosphate regulon repressorTranscription regulation
glpD GOX2088Glycerol-3-phosphate dehydrogenaseOxidation of G3P to DHAP
glpF GOX2089Glycerol uptake facilitator proteinTransporter activity
glpK GOX2090Glycerol kinasePhosphorylation of glycerol to G3P
Genes related to glycerol utilization in G. oxydans 621H

GlpD is indispensable for glycerol metabolism of G. oxydans 621H

To identify the roles of these three enzymatic systems in glycerol metabolism and biomass production of G. oxydans 621H, four mutant strains including G. oxydansGOX1068, G. oxydansGOX0854, G. oxydansGOX2088, and G. oxydansGOX1068GOX0854 were constructed (Additional file 2: Fig. S1). G. oxydansGOX0854 lost the ability to produce DHA, confirming that the major polyol dehydrogenase is responsible for DHA production. G. oxydansGOX1068 produced 0.85 ± 0.06 g L−1 of glycerate but G. oxydansGOX1068GOX0854 could not produce any glycerate, indicating that the membrane-bound alcohol dehydrogenase is responsible for glycerate production. As shown in Fig. 3a, only G. oxydansGOX2088 could not grow in mineral salts medium with glycerol. Thus, the glycerol utilization operon is the sole system that is indispensable for biomass production from glycerol. On the other hand, the cells of G. oxydansGOX2088 inoculated in the medium had polyol dehydrogenase activity and thus could consume glycerol and produce DHA with a low rate. Membrane-bound dehydrogenases are necessary for the utilization of certain substrates as the sole carbon source only if the substrate cannot be assimilated directly by G. oxydans. For example, G. oxydans can not directly utilize mannitol. G. oxydans first oxidizes mannitol into fructose by the membrane-bound polyol dehydrogenase, then fructose can serve as a direct carbon source for the organism [38]. As shown in Fig. 3a, mutant of the membrane-bound dehydrogenases (the major polyol dehydrogenase and the alcohol dehydrogenase) only decreased the growth rate of G. oxydans 621H, but the biomass yield of G. oxydansGOX1068GOX0854 was higher than other strains when glycerol was used as the sole carbon source. The presence of membrane-bound dehydrogenases can increase the growth rate of G. oxydans 621H through efficient energy generation by feeding electrons from the glycerol oxidation directly into electron transport chain. However, the glycerol oxidation process would also decrease the amount of glycerol that can enter the central metabolic pathway through glycerol utilization operon. G. oxydans 621H, G. oxydansGOX1068, G. oxydansGOX0854, and G. oxydansGOX1068GOX0854 were cultured in mineral salts medium with glycerol for 48 h, then the yields of biomass and products were assayed (Table 2). The biomass yield of G. oxydansGOX1068GOX0854 from glycerol was 0.199 ± 0.018 g dry cell weight (DCW) g−1, which was higher than that of other strains. No production of DHA and glycerate could be detected during the culture of G. oxydansGOX1068GOX0854. Thus, preparing whole cells of G. oxydansGOX1068GOX0854 as the biocatalyst from glycerol may be more economic feasible than other strains.
Table 2

Biomass and product yields of G. oxydans and its derivatives in mineral salts medium with 10 g L−1 of glycerol as the sole carbon source

StrainYield of cell (g DCW g−1)Yield of DHA (mol mol−1)Yield of glycerate (mol mol−1)
WT0.029 ± 0.0010.987 ± 0.0310.006 ± 0.0
∆GOX20880.003 ± 0.0011.072 ± 0.0210.012 ± 0.001
∆GOX10680.032 ± 0.0010.994 ± 0.0460.002 ± 0.0
∆GOX08540.069 ± 0.0050.0 ± 0.00.744 ± 0.039
∆GOX1068∆GOX08540.199 ± 0.0180.0 ± 0.00.0 ± 0.0

Data are the mean ± standard deviations (SDs) from three parallel experiments. The yields of DHA, glycerate and biomass of G. oxydans and its derivatives were calculated based on concentrations of the products and consumed glycerol

Biomass and product yields of G. oxydans and its derivatives in mineral salts medium with 10 g L−1 of glycerol as the sole carbon source Data are the mean ± standard deviations (SDs) from three parallel experiments. The yields of DHA, glycerate and biomass of G. oxydans and its derivatives were calculated based on concentrations of the products and consumed glycerol

G. oxydans ∆GOX1068∆GOX0854 has membrane-bound glucose dehydrogenase activity

Eight known and at least two unknown membrane-bound dehydrogenases genes have been annotated in the genome of G. oxydans 621H [38, 39]. These membrane-bound dehydrogenases can oxidize a wide range of compounds and can be used in various biocatalysis processes. Although G. oxydansGOX1068GOX0854 lost two membrane-bound dehydrogenases catalyzing DHA and glycerate production, whole cells of the strain might be used in other chemicals production. For instance, the membrane-bound glucose dehydrogenase (GOX0265) has the ability to oxidize glucose, xylose, galactose, mannose, allose, and arabinose [38-40]. To identify the applicability of the whole cells of G. oxydansGOX1068GOX0854 prepared from glycerol, the membrane-bound glucose dehydrogenase catalyzed xylose oxidation was selected as an example for further study. Dehydrogenase activities toward glucose and xylose in crude cell extracts of G. oxydans 621H and G. oxydansGOX1068GOX0854 were assayed. As shown in Table 3, the glucose dehydrogenase activities of G. oxydans 621H cultured in the traditional complex medium with 18.4 g L−1 of yeast extract and 73 g L−1 of sorbitol (Y-S medium) toward glucose and xylose were similar to that of G. oxydansGOX1068GOX0854 cultured in mineral salts medium with 10 g L−1 of glycerol (M-G medium).
Table 3

Enzymatic activities of G. oxydans 621H and G. oxydans ∆GOX1068∆GOX0854 cultured in different media

StrainDehydrogenase activity towards glucose (mU mg−1)Dehydrogenase activity towards xylose (mU mg−1)
Y-SM-GY-SM-G
WT667.38 ± 23.83260.95 ± 8.92136.76 ± 2054.49 ± 4.63
∆GOX1068∆GOX0854894.73 ± 53.81641.88 ± 2.95127.06 ± 2.4879.81 ± 9.24

Data are the mean ± standard deviations (SDs) from three parallel experiments

Y-S medium, complex medium with 18.4 g L−1 of yeast extract and 73 g L−1 of sorbitol

M-G medium, mineral salts medium with 10 g L−1 of glycerol

Enzymatic activities of G. oxydans 621H and G. oxydansGOX1068GOX0854 cultured in different media Data are the mean ± standard deviations (SDs) from three parallel experiments Y-S medium, complex medium with 18.4 g L−1 of yeast extract and 73 g L−1 of sorbitol M-G medium, mineral salts medium with 10 g L−1 of glycerol

Whole cells of G. oxydans ∆GOX1068∆GOX0854 can be prepared with low glycerol consumption

When G. oxydansGOX1068GOX0854 was cultured in mineral salts medium with 10 g L−1 of glycerol, the glycerol consumed is less than 2 g L−1 (Fig. 3b). Thus, G. oxydans 621H and G. oxydansGOX1068GOX0854 were cultured in mineral salts medium with different concentrations of glycerol and the growth of the strains was assayed (Additional file 3: Fig. S2). G. oxydansGOX1068GOX0854 could grow to similar OD600 nm and exhibited similar dehydrogenase activity toward xylose in mineral salts medium with 2, 5, 10, and 20 g L−1 of glycerol (Fig. 4a and Additional file 4: Fig. S3). The culture system with 2 g L−1 of glycerol as the substrate exhibited relatively high biomass yield (Fig. 4b). Under identical conditions, the biomass yield of G. oxydansGOX1068GOX0854 (0.161 ± 0.002 g DCW g−1) was 2.4-fold higher than that of G. oxydans 621H (0.067 ± 0.002 g DCW g−1) (Additional file 5: Fig. S4). Whole cells of G. oxydansGOX1068GOX0854 can be prepared with a low glycerol consumption (2 g L−1) and may decrease the biocatalyst preparation cost.
Fig. 4

Growth of G. oxydans ∆GOX1068∆GOX0854 in mineral salts medium containing different concentrations of glycerol. a Cell density, (black square) 1 g L−1, (red circle) 2 g L−1, (blue triangle) 5 g L−1, (green inverted triangle) 10 g L−1, (pink left-pointing triangle) 20 g L−1. Consumption of glycerol could be found in Additional file 3: Figure S2. b The dry cell weight (red) and biomass yield (black) of G. oxydans ∆GOX1068∆GOX0854 in mineral salts medium containing different concentrations of glycerol. The yield of G. oxydans ∆GOX1068∆GOX0854 was calculated based on concentrations of the cells and added glycerol. Calculation of dry cell weight: g DCW L−1 = 0.3896 × ∆OD600 nm − 0.0004. The error bars represent the standard deviations of three independent experiments

Growth of G. oxydansGOX1068GOX0854 in mineral salts medium containing different concentrations of glycerol. a Cell density, (black square) 1 g L−1, (red circle) 2 g L−1, (blue triangle) 5 g L−1, (green inverted triangle) 10 g L−1, (pink left-pointing triangle) 20 g L−1. Consumption of glycerol could be found in Additional file 3: Figure S2. b The dry cell weight (red) and biomass yield (black) of G. oxydansGOX1068GOX0854 in mineral salts medium containing different concentrations of glycerol. The yield of G. oxydansGOX1068GOX0854 was calculated based on concentrations of the cells and added glycerol. Calculation of dry cell weight: g DCW L−1 = 0.3896 × ∆OD600 nm − 0.0004. The error bars represent the standard deviations of three independent experiments

Xylonate can be produced from xylose using whole cells of G. oxydans ∆GOX1068∆GOX0854

Production of xylonate from xylose was used to assay the biocatalytic performance of whole cells of G. oxydans 621H and G. oxydansGOX1068GOX0854 prepared from 2 g L−1 glycerol. Biocatalysis was conducted at 30 °C in 20 mM potassium phosphate buffer (pH was adjusted to 7.0) with 60 g L−1 of xylose as the substrate and 7.8 g DCW L−1 of whole cells of G. oxydans 621H and G. oxydansGOX1068GOX0854 as the biocatalysts. As shown in Fig. 5, after 30 h of biotransformation, up to 61.6 g L−1 xylonate was produced at a yield of 1.05 g g−1 by G. oxydansGOX1068GOX0854. The specific yield of xylonate per unit cells was 7.90 g xylonate/g DCW. Xylonate at a final concentration of 57.4 g L−1 was produced with a yield of 0.99 g g−1 by G. oxydans 621H. The specific yield of xylonate per unit cells was 7.36 g xylonate/g DCW.
Fig. 5

Conversion of xylose into xylonate using whole cells of G. oxydans 621H and G. oxydans ∆GOX1068∆GOX0854 prepared from the mineral salts medium with 2 g L−1 glycerol as the sole carbon source. (Black square) xylose consumption of G. oxydans 621H, (red circle) xylose consumption of G. oxydans ∆GOX1068∆GOX0854, (blue triangle) xylonate formation of G. oxydans 621H, (pink inverted triangle) xylonate formation of G. oxydans ∆GOX1068∆GOX0854. The error bars represent the standard deviations of three independent experiments

Conversion of xylose into xylonate using whole cells of G. oxydans 621H and G. oxydansGOX1068GOX0854 prepared from the mineral salts medium with 2 g L−1 glycerol as the sole carbon source. (Black square) xylose consumption of G. oxydans 621H, (red circle) xylose consumption of G. oxydansGOX1068GOX0854, (blue triangle) xylonate formation of G. oxydans 621H, (pink inverted triangle) xylonate formation of G. oxydansGOX1068GOX0854. The error bars represent the standard deviations of three independent experiments Typically, whole cells of G. oxydans could be used as the biocatalysts in the industrial applications. Increased biomass yields from carbon sources used would lower the production costs of the biocatalysts. Therefore, various studies have aimed at increases of the biomass yields of G. oxydans 621H in complex media by metabolic engineering [9, 10, 41]. This study was the first study that focused on the construction of G. oxydans to lower the production cost in mineral salts medium. Glycerol, a chemical generated during the biofuel production, is a comparably cheap carbon source that can support the growth of G. oxydans 621H in mineral salts medium. Three enzymes’ systems related to glycerol metabolism including the major polyol dehydrogenase, the membrane-bound alcohol dehydrogenase, and the glycerol-3-phosphate dehydrogenase were predicted in genome of G. oxydans 621H [34]. Their possible biological functions have been tentatively studied through gene deletion (Fig. 6). Complementation of these genes in the related mutant strains might further demonstrate their functions in the glycerol metabolism of G. oxydans 621H.
Fig. 6

Scheme of xylonate production using metabolic engineered G. oxydans 621H. The pathway marked with blue color indicated the glycerol utilization pathway used for biomass production. The pathways marked with yellow color were deleted to increase the glycerol channeled into central metabolism. The pathway marked with pink color indicated the xylonate production from xylose using the membrane-bound glucose dehydrogenase. The pathways marked with green color indicated remaining membrane-bound dehydrogenases could be used in other oxidative biotransformation processes. bo, cytochrome bo ubiquinol oxidase, bd, cytochrome bd ubiquinol oxidase. Membrane-bound dehydrogenases transfer electrons to ubiquinone to form the reduced cofactor ubiquinol (QH2), which is oxidized by bo and bd to generate an electron gradient for energy production. 1, alcohol dehydrogenase (GOX1067 and GOX1068); 2, aldehyde dehydrogenase (GOX0585, GOX0586 and GOX0587); 3, polyol dehydrogenase (GOX0854 and GOX0855); 4/5, uncharacterized PQQ-depending dehydrogenase; 6, inositol dehydrogenase (GOX1857); 7, d-lactate dehydrogenase (GOX1253); 8, glucose dehydrogenase (GOX0265); 9, gluconate dehydrogenase (GOX1230, GOX1231 and GOX1232); 10, sorbitol dehydrogenase (GOX2094, GOX2095, GOX2096 and GOX2097). DHA dihydroxyacetone, G3P glycerol-3-phosphate, DHAP dihydroxyacetone phosphate, GAP glyceraldehyde-3-phosphate, GlpF glycerol uptake facilitator protein, GlpK glycerol kinase, GlpD glycerol-3-phosphate dehydrogenase, EMP Embden–Meyerhof–Parnas pathway

Scheme of xylonate production using metabolic engineered G. oxydans 621H. The pathway marked with blue color indicated the glycerol utilization pathway used for biomass production. The pathways marked with yellow color were deleted to increase the glycerol channeled into central metabolism. The pathway marked with pink color indicated the xylonate production from xylose using the membrane-bound glucose dehydrogenase. The pathways marked with green color indicated remaining membrane-bound dehydrogenases could be used in other oxidative biotransformation processes. bo, cytochrome bo ubiquinol oxidase, bd, cytochrome bd ubiquinol oxidase. Membrane-bound dehydrogenases transfer electrons to ubiquinone to form the reduced cofactor ubiquinol (QH2), which is oxidized by bo and bd to generate an electron gradient for energy production. 1, alcohol dehydrogenase (GOX1067 and GOX1068); 2, aldehyde dehydrogenase (GOX0585, GOX0586 and GOX0587); 3, polyol dehydrogenase (GOX0854 and GOX0855); 4/5, uncharacterized PQQ-depending dehydrogenase; 6, inositol dehydrogenase (GOX1857); 7, d-lactate dehydrogenase (GOX1253); 8, glucose dehydrogenase (GOX0265); 9, gluconate dehydrogenase (GOX1230, GOX1231 and GOX1232); 10, sorbitol dehydrogenase (GOX2094, GOX2095, GOX2096 and GOX2097). DHA dihydroxyacetone, G3P glycerol-3-phosphate, DHAP dihydroxyacetone phosphate, GAP glyceraldehyde-3-phosphate, GlpF glycerol uptake facilitator protein, GlpK glycerol kinase, GlpD glycerol-3-phosphate dehydrogenase, EMP Embden–Meyerhof–Parnas pathway The major polyol dehydrogenase and the membrane-bound alcohol dehydrogenase play no obvious roles in biocatalyst preparation but can decrease the glycerol channeled into biomass production. Thus, these two enzymes were deleted and the result strain G. oxydansGOX1068GOX0854 only has the glycerol utilization operon and can efficiently transform glycerol into biomass with high yield and low glycerol consumption (Fig. 6). Eight known and two unknown membrane-bound dehydrogenases were predicted in G. oxydans 621H [38, 39]. Except to the major polyol dehydrogenase and the membrane-bound alcohol dehydrogenase involved in DHA and glycerate production, the activity of the membrane-bound dehydrogenases involved in other desired industrial applications might not be interfered. For example, production of xylonate from xylose with the membrane-bound glucose dehydrogenase was achieved using whole cells of the mutant strain prepared from glycerol. This biocatalyst might also be used in other oxidative biotransformation processes depending on the membrane-bound dehydrogenases of the strain.

Conclusions

In this study, we develop a biocatalyst preparation process for G. oxydans 621H using biofuel’s byproduct glycerol as the carbon source in mineral salts medium. Two glycerol oxidation enzymes were deleted in G. oxydans 621H and the double knock-out strain could utilize glycerol with a higher biomass yield than that of the wild-type strain. Using the whole cells of the mutant strain as the biocatalyst, 61.6 g L−1 xylonate was produced from xylose in 30 h with high yield and high productivity. This research provides a low-cost and a renewable strategy for low cost production of whole-cell biocatalyst of G. oxydans, which may be used in various biocatalytic processes.

Methods

Bacterial strains and culture conditions

The strains, plasmids and primers used in this study are listed in Table 4. G. oxydans 621H and its derivatives were cultured in a complex medium containing 73 g sorbitol, 18.4 g yeast, 1.5 g (NH4)2SO4, 1.5 g KH2PO4 and 0.47 g MgSO4·7H2O in 1 L of distilled water. A mineral salt medium containing 0.2 g l-glutamine, 2 g (NH4)2SO4, 0.2 g MgSO4·7H2O, 2.2 g KH2PO4, 0.2 g Na2HPO4, 5 mg nitrilotriacetic acid, 30 mg EDTA, 11 mg FeSO4·7H2O, 9 mg ZnSO4·7H2O, 0.6 mg CoCl2·6H2O, 2 mg MnCl2·4H2O, 0.6 mg CuSO4·5H2O, 9 mg CaCl2·2H2O, 0.08 mg NaMoO4·2H2O, 1 mg H3BO3, 0.2 mg KI, 0.5 mg calcium pantothenate, 0.4 mg nicotinic acid, 0.4 mg p-aminobenzoic acid, and different carbon sources in 1 L of distilled water were also used [42]. G. oxydans strains were grown at 30 °C and 200 rpm in 250 mL baffled Erlenmeyer flasks. E. coli strains were cultivated at 37 °C in Luria–Bertani medium (yeast 5 g L−1, tryptone 10 g L−1, NaCl 10 g L−1) at 37 °C and 180 rpm on a rotary shaker. Antibiotics were used when necessary at the following concentrations: kanamycin at 50 μg mL−1, ampicillin at 100 μg mL−1 and 50 μg mL−1 cefoxitin.
Table 4

Strains, plasmids and primers used in this study

NameRelevant characteristicaReference
Strain
 G. oxydans 621HG. oxydans DSM2343, wild type, CefrDSMZb
 ∆GOX1068gox1068 deletion strain of G. oxydans 621HThis study
 ∆GOX0854gox0854 deletion strain of G. oxydans 621HThis study
 ∆GOX1068∆GOX0854gox1068 and gox0854 deletion strain of G. oxydans 621H, CefrThis study
 ∆GOX2088gox2088 deletion strain of G. oxydans 621HThis study
 E. coli DH5αF supE44lacU169 (φ80 lacZM15) hsdR17 recA1 endA1 gyrA96 thi1 relA1 λNovagen
 E. coli HB101F mcrB mrr hsdS20(rBmB) recA13 supE44 ara14 galK2 lacY1 proA2 rpsL20(Smr) xy15 λ-leu mtl1; used for triparental mating as the helper strainInvitrogen
Plasmid
 pK18mobsacBSuicide plasmid, oriColE1 Mob+, lacZα, sacB, KmrSchäfer et al.
 pK18mobsacB-∆GOX1068pK18mobsacB with partial gox1068 of G. oxydans 621H for deletionThis study
 pK18mobsacB-∆GOX0854pK18mobsacB with partial gox0854 of G. oxydans 621H for deletionThis study
 pK18mobsacB-∆GOX1068∆GOX0854pK18mobsacB with partial gox1068 and gox0854 of G. oxydans 621H for deletionThis study
 pK18mobsacB-∆GOX2088pK18mobsacB with partial gox2088 of G. oxydans 621H for deletionThis study
Primers
 QGOX1068.fCCAGAATTCGATGACTTCTGGTCTACTGAC (EcoRI)This study
 QGOX1068.rTAAGGATCCTCAGGGGTGATCCGCGGTCG (BamHI)This study
 GOX1068up.r.GAGCAGAACGTCTGAGTTGGTCGTGGCGTAThis study
 GOX1068down.fTACGCCACGACCAACTCAGACGTTCTGCTCThis study
 QGOX0854.fCCAGAATTCGATGCGCAGATCCCATCTTCT (EcoRI)This study
 QGOX0854.rTATAAGCTTTCAGCCCTTGTGATCAGGCA (HindIII)This study
 GOX0854up.r.GCCCCACGGACCATTCTGGCACTCTGCTGCThis study
 GOX0854down.fGCAGCAGAGTGCCAGAATGGTCCGTGGGGCThis study
 GOXQ2088.fCGCGGATCCATGTCATCGATTCACGAGGTTTCA (BamHI)This study
 QGOX2088.rCCCAAGCTTTCAGGCGACGTTCTGACGTGCGA (HindIII)This study
 GOX2088up.r.CGAAAACCGACAGGAAGCCGGCTGTCCTGCThis study
 GOX2088down.fGCAGGACAGCCGGCTTCCTGTCGGTTTTCGThis study

aCefr and Kmr were represented Cefoxitin resistance and Kanamycin resistance, respectively

bDSMZ, Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany

Strains, plasmids and primers used in this study aCefr and Kmr were represented Cefoxitin resistance and Kanamycin resistance, respectively bDSMZ, Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany

General molecular biological techniques

Molecular biological techniques were carried out using standard protocols [43]. Genomic DNA of G. oxydans 621H was extracted through the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA). Polymerase chain reaction (PCR) primers were obtained from Sangon (Shanghai, China). Restriction enzymes were obtained from Thermo Fisher Scientific (USA). T4 DNA ligase and fastPfu DNA polymerase were purchased from MBI (USA) and Transgen Biotech (China), respectively. G. oxydans 621H was transformed via a triparental mating method as described previously [39, 44]. All the constructed strains were validated by DNA sequencing done by Sangon (Shanghai, China).

Deletion of genes in G. oxydans 621H

Genes of G. oxydans 621H were deleted using the pK18mobsacB system as described previously [45]. Briefly, the homologous arms upstream and downstream of the target GOX1068 gene were amplified by PCR with the genomic DNA of G. oxydans 621H as the template, and the primers GOX1068up.f/GOX1068up.r and GOX1068down.f/GOX1068down.r. Then they were fused together by the recombinant PCR using primers GOX1068up.f/GOX1068down.r, which contained EcoRI and BamHI restriction enzyme sites, respectively (Table 4). The generated fusion construct and pK18mobsacB [46], a mobilizable plasmid that does not replicate in G. oxydans, were digested with EcoRI and BamHI, and then linked by using T4 DNA ligase to form pK18mobsacB-∆GOX1068. The plasmid was transferred into G. oxydans via a triparental mating method [44]. E. coli DH5α harboring pK18mobsacB-∆GOX1068 was used as the donor strain, E. coli HB101 harboring the plasmid pRK2013 was used as the helper strain, and G. oxydans 621H was used as the recipient strain. The first crossover cells containing the integration of the plasmid pK18mobsacB-∆GOX1068 into the chromosome of G. oxydans 621H were selected on the complex medium agar plate supplemented with 50 μg mL−1 kanamycin, 50 μg mL−1 cefoxitin, and 0.1% (vol/vol) acetic acid [45]. The second crossover cells were singled out by culture on the complex medium plates containing 10% (w/v) sucrose. Other mutants of G. oxydans 621H were generated by using the same procedure and primers listed in Table 4. All mutants were verified by PCR and sequencing.

Enzymatic activity assays

The oxidation of glucose and xylose in G. oxydans 621H was majorly catalyzed by membrane-bound glucose dehydrogenase, which can be assayed using DCPIP as the electron acceptor [38]. Cells of G. oxydans 621H and its derivatives were collected, washed, and then resuspended in phosphate-buffered saline (pH 7.4 PBS) supplemented with 10% v/v glycerol and 1.0 mM phenylmethylsulfonyl fluoride (PMSF), and lysed by sonication on ice. Cell debris was removed through centrifugation (13,000 rpm, 20 min). The activities of membrane bound glucose dehydrogenase were assayed by monitoring the change in absorbance at 600 nm corresponding to the reduction of DCPIP with a UV/visible spectrophotometer (Ultrospec 2100 pro, Amersham Biosciences, USA). The reaction was carried out in 0.8 mL of pH 7.4 PBS, containing 20 mM PMS, 50 mM DCPIP, 25 mM glucose or xylose and 40 μL crude cell extracts.

Production of xylonate from xylose through whole-cell biotransformation

G. oxydans ΔGOX1068GOX0854 were cultivated in mineral salts medium with 2 g L−1 glycerol at 30 °C and 200 rpm for 36 h. The cells were harvested, washed twice with PBS (pH 7.4), and then resuspended in the same buffer. The biotransformation reactions were carried out at 30 °C and 150 rpm in 20 mM potassium phosphate buffer (pH was adjusted to 7.0) containing 7.8 g DCW L−1 of whole cells of G. oxydans 621H or G. oxydansGOX1068GOX0854 and 60 g L−1 of xylose. Samples were taken every 3 h and centrifuged at 13,000 rpm for 5 min before being analyzed.

Analytical methods

The biomass was evaluated by determination of optical density (OD) at 600 nm with a UV/visible spectrophotometer. Optical densities of whole cells were converted to DCW as Y = 0.3896 × OD600 nm − 0.0004. The protein concentration was determined by the Lowry procedure using bovine serum albumin as the standard [47]. The samples obtained from the biotransformation experiment were filtered through a 0.22 μm filter prior to high-performance liquid chromatography (HPLC) analysis. Glycerol, glycerate, and DHA were quantified using an Aminex HPX-87H column (300 × 7.8 mm; Bio-Rad, USA) equipped with a RID-10A refractive index detector. Xylonate was quantified by an Aminex HPX-87H column (300 × 7.8 mm; Bio-Rad, USA) equipped with a SPD-M20A photodiode array detector at 210 nm. The analysis was carried out at 55 °C using 10 mM H2SO4 as the eluent at a flow rate of 0.4 mL min−1. Xylose was analyzed using an Aminex HPX-87P column (300 × 7.8 mm; Bio-Rad, USA) equipped with a RID-10A refractive index detector at 65 °C and the mobile phase was deionized water at a flow rate of 0.6 mL min−1. A series of injections of standard substances in the range of 0–10 g L−1 was used to obtain calibration curves. Additional file 1: Table S1. Price comparison of different carbon sources. Additional file 2: Fig. S1. PCR confirmation of the disruption of genes. a. adhB (GOX1068); b. sldA (GOX0854); c.  adhB and sldA (GOX1068GOX0854); d.  glpd (GOX2088). M: 5K Marker; WT: the genomic DNA of wild-type G. oxydans 621H; +: pK18mobsacB-ΔGOX0854 (b), pK18mobsacB-ΔGOX2088 (d); -:H2O. Additional file 3: Fig. S2. Consumption of substrate of G. oxydans ΔGOX1068ΔGOX0854 in mineral salts medium containing different concentrations of glycerol. (Black square) 1 g L−1, (red circle) 2 g L−1, (blue triangle) 5 g L−1, (green inverted triangle) 10 g L−1, (pink left-pointing triangle) 20 g L−1. Additional file 4: Fig. S3. Dehydrogenase activity toward xylose of G. oxydans ΔGOX1068ΔGOX0854 cultured in mineral salts medium containing different concentrations of glycerol. Additional file 5: Fig. S4. The dry cell weight and biomass yield of G. oxydans 621H in mineral salts medium containing different concentrations of glycerol. Dry cell weight (red), biomass yield (black). The biomass yield was calculated based on concentrations of the cells and added glycerol. Calculation of dry cell weight: g DCW L−1 = 0.3896 × ΔOD600 nm − 0.0004.
  42 in total

1.  Expression of Vitreoscilla hemoglobin enhances cell growth and dihydroxyacetone production in Gluconobacter oxydans.

Authors:  Minghua Li; Jian Wu; Jinping Lin; Dongzhi Wei
Journal:  Curr Microbiol       Date:  2010-04-01       Impact factor: 2.188

2.  A modification of the Lowry procedure to simplify protein determination in membrane and lipoprotein samples.

Authors:  M A Markwell; S M Haas; L L Bieber; N E Tolbert
Journal:  Anal Biochem       Date:  1978-06-15       Impact factor: 3.365

3.  Process optimization and analysis of product inhibition kinetics of crude glycerol fermentation for 1,3-Dihydroxyacetone production.

Authors:  Pritam Kumar Dikshit; Susant Kumar Padhi; Vijayanand S Moholkar
Journal:  Bioresour Technol       Date:  2017-07-27       Impact factor: 9.642

4.  Enhancement of 1,3-Dihydroxyacetone Production from Gluconobacter oxydans by Combined Mutagenesis.

Authors:  Xi Lin; Sha Liu; Guangrong Xie; Jing Chen; Penghua Li; Jianhua Chen
Journal:  J Microbiol Biotechnol       Date:  2016-11-28       Impact factor: 2.351

5.  Enhanced production of dihydroxyacetone from glycerol by overexpression of glycerol dehydrogenase in an alcohol dehydrogenase-deficient mutant of Gluconobacter oxydans.

Authors:  Ming-hua Li; Jian Wu; Xu Liu; Jin-ping Lin; Dong-zhi Wei; Hao Chen
Journal:  Bioresour Technol       Date:  2010-06-23       Impact factor: 9.642

6.  Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum.

Authors:  A Schäfer; A Tauch; W Jäger; J Kalinowski; G Thierbach; A Pühler
Journal:  Gene       Date:  1994-07-22       Impact factor: 3.688

Review 7.  Industrial production of L-ascorbic Acid (vitamin C) and D-isoascorbic acid.

Authors:  Günter Pappenberger; Hans-Peter Hohmann
Journal:  Adv Biochem Eng Biotechnol       Date:  2014       Impact factor: 2.635

8.  Biotransformation of glycerol to dihydroxyacetone by recombinant Gluconobacter oxydans DSM 2343.

Authors:  Cornelia Gätgens; Ursula Degner; Stephanie Bringer-Meyer; Ute Herrmann
Journal:  Appl Microbiol Biotechnol       Date:  2007-05-12       Impact factor: 4.813

9.  Kinetic analysis of dihydroxyacetone production from crude glycerol by immobilized cells of Gluconobacter oxydans MTCC 904.

Authors:  Pritam Kumar Dikshit; Vijayanand S Moholkar
Journal:  Bioresour Technol       Date:  2016-06-15       Impact factor: 9.642

10.  High cell density fermentation of Gluconobacter oxydans DSM 2003 for glycolic acid production.

Authors:  Guodong Wei; Xuepeng Yang; Tula Gan; Wenyu Zhou; Jinping Lin; Dongzhi Wei
Journal:  J Ind Microbiol Biotechnol       Date:  2009-05-12       Impact factor: 3.346

View more
  1 in total

Review 1.  Recent progress in the microbial production of xylonic acid.

Authors:  Débora Trichez; Clara Vida G C Carneiro; Melissa Braga; João Ricardo M Almeida
Journal:  World J Microbiol Biotechnol       Date:  2022-06-07       Impact factor: 3.312

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.