Literature DB >> 30041652

An evaluation of multidrug-resistant Escherichia coli isolates in urinary tract infections from Aguascalientes, Mexico: cross-sectional study.

Flor Y Ramírez-Castillo1, Adriana C Moreno-Flores1, Francisco J Avelar-González2, Francisco Márquez-Díaz3, Josée Harel4, Alma L Guerrero-Barrera5.   

Abstract

BACKGROUND: Uropathogenic n class="Species">Escherichia coli (UPEC) are one of the main bacteria causing urinary tract infections (UTIs). The rates of UPEC with high resistance towards antibiotics and multidrug-resistant bacteria have increased dramatically in recent years and could difficult the treatment.
METHODS: The aim of the study was to determine multidrug-resistant bacteria, antibiotic resistance profile, virulence traits, and genetic background of 110 E. coli isolated from community (79 isolates) and hospital-acquired (31 isolates) urinary tract infections. The plasmid-mediated quinolone resistance genes presence was also investigated. A subset of 18 isolates with a quinolone-resistance phenotype was examined for common virulence genes encoded in diarrheagenic and extra-intestinal pathogenic E. coli by a specific E. coli microarray.
RESULTS: Female children were the group most affected by UTIs, which were mainly community-acquired. Resistance to trimethoprim-sulfamethoxazole, ampicillin, and ampicillin-sulbactam was most prevalent. A frequent occurrence of resistance toward ciprofloxacin (47.3%), levofloxacin (43.6%) and cephalosporins (27.6%) was observed. In addition, 63% of the strains were multidrug-resistant (MDR). Almost all the fluoroquinolone (FQ)-resistant strains showed MDR-phenotype. Isolates from male patients were associated to FQ-resistant and MDR-phenotype. Moreover, hospital-acquired infections were correlated to third generation cephalosporin and nitrofurantoin resistance and the presence of kpsMTII gene. Overall, fimH (71.8%) and fyuA (68.2%), had the highest prevalence as virulence genes among isolates. However, the profile of virulence genes displayed a great diversity, which included the presence of genes related to diarrheagenic E. coli. Out of 110 isolates, 25 isolates (22.7%) were positive to qnrA, 23 (20.9%) to qnrB, 7 (6.4%) to qnrS1, 7 (6.4%) to aac(6')lb-cr, 5 (4.5%) to qnrD, and 1 (0.9%) to qnrC genes. A total of 12.7% of the isolates harbored blaCTX-M genes, with blaCTX-M-15 being the most prevalent.
CONCLUSIONS: Urinary tract infection due to E. coli may be difficult to treat empirically due to high resistance to commonly used antibiotics. Continuous surveillance of multidrug resistant organisms and patterns of drug resistance are needed in order to prevent treatment failure and reduce selective pressure. These findings may help choosing more suitable treatments of UTI patients in this region of Mexico.

Entities:  

Keywords:  CTX-M; Fluoroquinolone-resistant; Multidrug-resistant; Plasmid-mediated quinolone resistance (PMQR); Urinary tract infection

Mesh:

Substances:

Year:  2018        PMID: 30041652      PMCID: PMC6057003          DOI: 10.1186/s12941-018-0286-5

Source DB:  PubMed          Journal:  Ann Clin Microbiol Antimicrob        ISSN: 1476-0711            Impact factor:   3.944


Background

Escherichia coli is an important cause of n class="Disease">extra-intestinal infections, enteric disease, and systemic infections in humans and animals. Uropathogenic Escherichia coli (UPEC), one of the members of the extra-intestinal pathogenic E. coli (ExPEC) is a predominant pathogen causing urinary tract infections (UTIs) [1]. UPEC is one of the main causes of community (80–90%) and nosocomial-acquired UTIs (30–50%) [2]. These strains harbor a variety of virulence factors that allow them to establish an infection, including adhesins, toxins, host defense avoidance mechanisms and multiple iron acquisition systems [3]. UTIs are one of the most common bacterial infections worldwide. It has been estimated that 150 million UTIs occur per year worldwide [4]. ExPEC strains are responsible for an estimated 40,000 deaths and at least $2.6 billion of expenses in healthcare treatment in the United States alone [5]. In Mexico, 3’648,784 cases were reported on 2015 [6]. Although these n class="Disease">infections are treatable, the increasingly accelerated rates or multi-drug resistant organisms (MDRO) lead to complication, treatment failure and increased rates of mortality and morbidity [7]. The enhanced prevalence and global spread of extended-spectrum beta-lactamase (n class="Gene">ESBL) genes [8] such as CTX-M enzymes that are associated to multidrug-resistant (MDR) phenotypes and fluoroquinolones resistance, has become a major concern [9, 10]. Quinolones are broad-spectrum antibiotics and very important in the treatment of a wide range of diseases, especially urinary tract infections. Quinolone resistance is mainly caused by chromosomal mutations in the quinolone resistance-determining region (QRDR) of gyrase (gyrA and gyrB) and topoisomerase (parC and parE) genes, but also is caused by plasmid-mediated quinolone resistance (PMQR) which include: the pentapeptide repeat family Qnr proteins (QnrA, QnrB, QnrS, QnrC and QnrD) [11], the variant of the aminoglycoside-acetyltransferase modifying enzyme, AAC(6′)-lb-cr [12], and the efflux pumps QepA and OqxAB [13-15]. Although PMQR genes confer only low-level of resistance to quinolones [16] they could spread horizontally among Enterobacteria and facilitate the selection of resistant mutants as well as the selection of additional resistance mechanisms, enabling bacteria to become fully resistant [8, 17]. The emergence of MDR E. coli causing n class="Disease">urinary tract infections with high virulence potential is alarming. In Mexico, a high rate of resistance against quinolones has been observed in environmental, diarrheagenic [18], and pediatric clinical isolates [19]. MDR phenotype of UPEC has also been shown [20, 21]. However, lack of sufficient data on virulence spectrum and MDR-UPEC isolates from community and hospital infections hinders the infections control and management efforts. The aim of this study was to determine the occurrence of MDR-phenotype, antibiotic resistance profile, virulence traits, and genetic background of E. coli isolates from community and hospital-acquired UTIs from Mexico.

Methods

Escherichia coli isolation

This study was conducted on a total of one hundred and ten urine cultures collected from patients suspected to have an UTI (urine samples contained bacterial counts to ≥ 105 CFU/ml) and sought attention in the Centenario Hospital Miguel Hidalgo, in Aguascalientes, Mexico during the period June to November 2012. n class="Species">Patient’s ages ranged from neonatal to 91 years. Only one non-duplicated E. coli isolate per culture was considered. Patients from whom E. coli was isolated at least 48 h after admission were considered to have a hospital-acquired infection, all other infections were considered to be community-acquired [22]. To isolate E. coli, serial decimal dilutions of the sample were prepared in 0.85% NaCl, and were used to inoculate MacConkey agar plates which were incubated overnight at 37 °C. All the isolates were screened by PCR for the uidA gene as confirmation (Table 1). The E. coli isolates were stored at − 80 °C in Luria–Bertani broth and 20% (vol/vol) glycerol.
Table 1

Oligonucleotides used in this study

Oligonucleotide nameTarget geneOligonucleotide 5′ ➔ 3′Amplification product (bp)References
E. coli marker
 uidA-forward uidA ATGTGCTGTGCCTGAACC450[60]
 uidA-reverseATTGTTTGCCTCCCTGCTG
Virulence genes for extra-intestinal pathogenic E. coli
 papC-forward papC GACGGCTGTACTGCAGGGTGTGGCG350[61]
 papC-reverseATATCCTTTCTGCAGGGATGCAATA
 SfaSf sfaS GTGGATACGACGATTACTGTG240[62]
 SfaSrCCGCCAGCATTCCCTGTATTC
 Afaf afa/dra GGCAGAGGGCCGGCAACAGGC592[62]
 AfarCCCGTAACGCGCCAGCATCTC
 FyuAf fyuA TGATTAACCCCGCGACGGGAA880[62]
 FyuArCGCAGTAGGCACGATGTTGTA
 yfcV-forward yfcV ACATGGAGACCACGTTCACC292[63]
 yfcV-reverseGTAATCTGGAATGTGGTCAGG
 Vat-forward vat TCAGGACACGTTCAGGCATTCAGT1100[63]
 Vat-reverseGGCCAGAACATTTGCTCCCTTGTT
 KpsMIIf kpsMT II GCGCATTTGCTGATACTGTTG272[62]
 KpsMIIrCATCCAGACGATAAGCATGAGCA
Quinolone resistance genes
 gyrA11753 gyrA GTATAACGCATTGCCGC251[64]
 gyrA12004TGCCAGATGTCCGAGAT
 EC-PAR-A parC CTGAATGCCAGCGCCAAATT189[65]
 EC-PAR-BGCGAACGATTTCGGATCGTC
 qnrA-forward qnrA TCAGCAAGAGGATTTCTCA605[66]
 qnrA-reverseGGCAGCACTATTACTCCCA
 qnrB-forward qnrB GATCGTGAAAGCCAGAAAGG469[12]
 qnrB-reverseACGATGCCTGGTAGTTGTCC
 qnrS-forward qnrS ACGACATTCGTCAACTGCAA417[12]
 qnrS-reverseTAAATTGGCACCCTGTAGGC
 qnrC-forward qnrC GGGTTGTACATTTATTGAATC447[64]
 qnrC-reverseTCCACTTTACGAGGTTCT
 qnrD-forward qnrD CGAGATCAATTTACGGGGAATA582[27]
 qnrD-reverseAACAAGCTGAAGCGCCTG
 qepA-forward qepA CTGCAGGTACTGCGTCATG403[67]
 qepA-reverseCGTGTTGCTGGAGTTCTTC
 aac-forwardacc-(6′)-lbTTGCGATGCTCTATGAGTGGCTA482[26]
 aac-reverseCTCGAATGCCTGGCGTGTTT
Beta-lactamase resistant genes
 blaTEM-forward bla TEM GAGTATTCAACATTTTCGT857[30]
 blaTEM-reverseACCAATGCTTAATCAGTGA
 blaSHV-forward bla SHV TCGCCTGTGTATTATCTCCC768[30]
 blaSHV-reverseCGCAGATAAATCACCACAATG
 blaOXA-1-forward bla OXA-1 GCAGCGCCAGTGCATCAAC198[30]
 blaOXA-1-reverseCCGCATCAAATGCCATAAGTG
 blaOXA-7-forward bla OXA-7, -9 AGTTCTCTGCCGAAGCC591[30]
 blaOXA-7-reverseTCTCAACCCAACCAACCC
 blaPSE-4-forward bla PSE-4 CTGCTCGTATAGGTGTTTCC705[30]
 blaPSE-4-reverseTCGCATCATTTCGCTCTTC
 blaCTX-M-3-f bla CTX-M-3 AATCACTGCGTCAGTTCAC701[30]
 blaCTX-M-3-rTTTATCCCCCACAACCCAG
 blaCTX-M-forward bla CTX-M AAGGCGTTTTGACAGACTATT920This study
 blaCTX-M-reverseGGTGACGATTTTAGCCGC
Oligonucleotides used in this study

Antimicrobial susceptibility test

Susceptibility to antimicrobial agents was determined by the agar dilution method as recommended by the standards of Clinical Laboratory Standards Institute [23]. The following antimicrobial agents were tested: n class="Chemical">ampicillin, ampicillin–sulbactam, amoxicillin–clavulanic acid, piperacillin–tazobactam, cefazolin, cefotaxime, ceftazidime, ceftriaxone, cefepime, amikacin, gentamicin, tobramycin, netilmicin, imipenem, ertapenem, trimethoprim–sulfamethoxazole, ciprofloxacin, levofloxacin and norfloxacin. E. coli ATCC 25922 was included in each assay as a negative control.

Determination of phylo-groups

Phylo-grouping was determined by PCR as previously described by Clermont et al. [24]. E. coli strains H10407 (phylo-group A), E22 (phylo-group B1), n class="Species">CFT073 (phylo-group B2), ECOR 70 (phylo-group C), O42 (phylo-group D), EDL933 (phylo-group E) and ECOR 36 (phylo-group F), were taken as positive controls. Water was used as negative control. All strains controls were kindly provided by Laboratoire de référence pour Escherichia coli, EcL, Faculté de Médecine Vétérinaire, Université de Montréal.

Detection of virulence factors

Escherichia coli isolates from n class="Disease">urinary tract infections were screened for the presence of commonly detected UPEC virulence genes including: fyuA, fimH, sfaS, afa/dra, papC, agn43, yfcV, vat, hlyA, cnf1and kpsMTII. Primers and controls used in this study are listed in Tables 1 and 2.
Table 2

PCR control strains used in this study

Control strainPositive gene (s)
J53pMG252 qnrA
J53pMG298 qnrB
J53pMG306 qnrS
Salmonella SA20042859aac(6′)-Ib
CFT073 uidA, papC, fyuA, chuA, kpsMTII, yfcV
J96 sfaS
UTI89 vat
R455 bla OXA-1
R6 K bla TEM
HB101 bla SHV
pMG202 bla OXA-7, -9
pMON711 bla PSE-4
CCRI-2167 bla CTX-M
PCR control strains used in this study

Characterization of resistance genes and mutations

Screening for plasmid mediated quinolone resistance (PMQR) genes, including qnrA, qnrB, qnrS, qnrC, n class="Gene">qnrD, qepA, and acc(6′)-lb genes was performed as previously described [13, 25–28]. The qnrC, qnrD and aac (6′)-Ib cr variants were identified sequencing the PCR products. The quinolone resistance determining regions (QRDR) of gyrA and parC genes were amplified and sequenced on both strands and predicted peptide sequences were compared to the corresponding gene from the MG1655 genome as described by Namboodiri et al. [29]. Beta-lactams genes detection including blaTEM, blaSHV, blaOXA, blaPSE and blaCTX-M were carried out by PCR amplification using specific primers [30]. Amplicons from all of the blaCTX-M positive isolates were sequenced. The nucleotide sequences obtained were aligned and further analyzed by comparison to sequences from a catalogue of beta-lactamases (http://www.lahey.org/studies/).

DNA microarray analysis

Microarray hybridizations were performed using E. coli maxivirulence version 3.1 microarray as previously described [31]. It allows the detection of 348 virulence genes and 98 antibiotic resistance genes and variants. DNA extraction and hybridizations were performed as described previously [32]. Each isolate was assigned to a specific n class="Species">E. coli pathotype according to its virulence gene profile and based on the classification published in previous papers [31, 33].

Statistical analysis

Categorical variables were compared using Pearson’s Chi square or Fisher’s exact test as appropriate. Continuous variables were compared using Mann–Whitney U test (STATISTICA V. 10, StatSoft, United States). p values less than 0.05 were considered statistically significant.

Results

Patient demographics

During the period of study, females (86 samples, 78.2%) were the most affected group of patients (p < 0.05) as compared to males (24 samples, 21.8%). Most of the UTIs were detected in community obtained samples (79 samples, 71.8%). Thirty-one samples were recovered from hospital-acquired n class="Disease">infections (28.2%). E. coli isolated from female patients were correlated with community-acquired UTIs (p = 0.0297). No differences among the prevalence of E. coli isolated from male patients among community- and hospital-acquired infections were found (54.2% vs 45.8%, respectively). Maximum number of cases was found in female children in the age group of 2–10 years (34 samples, 39%, p = 0.0372, Table 3).
Table 3

Patients with urinary tract infections, n (%)

Age groupAll patients, n = 110 (%)Male, n = 24 (%)Female, n = 86 (%) *p Hospital-acquired, n = 31 (%)Community-acquired, n = 79 (%) *p
0–117 (15.5)6 (25.0)11 (12.8)0.14345 (16.1)12 (15.2)0.9024
2–1038 (34.5)4 (16.7)34 (39.5) 0.0372 9 (29.0)29 (36.7)0.4462
11–2012 (10.9)1 (4.2)11 (12.8)0.23082 (6.5)10 (12.7)0.3475
21–307 (6.4)2 (8.3)5 (5.8)0.65481 (3.2)6 (7.6)0.3983
31–406 (5.5)1 (4.2)5 (5.8)0.75331 (3.2)5 (6.3)0.5191
41–505 (4.5)0 (0.0)5 (5.8)0.22661 (3.2)4 (5.1)0.6772
51–606 (5.5)2 (8.3)4 (4.7)0.48243 (9.7)3 (3.8)0.2218
61–707 (6.4)3 (12.5)4 (4.7)0.16363 (9.7)4 (5.1)0.3724
> 7112 (10.9)5 (20.8)7 (8.1)0.07776 (19.4)6 (7.6)0.0751

* Italic number shown statistical significant values

Patients with n class="Disease">urinary tract infections, n (%) * Italic number shown statistical significant values

Antibiotic resistance and MDR profiles in E. coli isolates

High frequencies of resistance were observed toward trimethoprim–sulfamethoxazole (72.7%), ampicillin (70.9%), n class="Chemical">ampicillin–sulbactam (55.5%), piperacillin–tazobactam (55.5%), ciprofloxacin (47.3%), and levofloxacin (43.6%). From the twenty different antibiotic tested, all isolates were susceptible to carbapenems (ertapenem and imipenem, Table 4). Eighty-seven percent of the isolates were resistant to at least one antimicrobial agent, and 63.3% (70 isolates) were multidrug-resistant (MDR). MDR isolates were resistant to ampicillin (85.7%), trimethoprim–sulfamethoxazole (84.3%), ampicillin–sulbactam (77.1%), piperacillin–tazobactam (77.1%) and ciprofloxacin (70%, Table 4). A total of 94.2% (49/52 isolates) of FQ-resistant strains showed MDR-phenotype. A similar distribution of FQ-resistant isolates was found in the same at hospital as community-acquired infections, except for norfloxacin, which was higher among community-acquired infections (20.3% vs 6.5%, Table 4). Distribution of ciprofloxacin and levofloxacin resistance was significantly higher among male than female gender (70.8, 66.7%, p = 0.0089, 0.0314 vs 40.7, 37.2%, respectively, Table 4).
Table 4

Antibiotic and multidrug resistance of the UPEC’s isolates, n (%)

AntibioticsTotal isolates, n = 110 (%)MDR, n = 70 (%)Male, n = 24 (%)Female, n = 86 (%) *p Hospital-acquired, n = 31 (%)Community-acquired, n = 79 (%) *p
Amikacin11 (10.0)11 (15.9)4 (16.7)7 (8.1)1 (3.2)10 (12.7)
Gentamicin31 (28.2)29 (41.4)11 (45.8)20 (23.3)0.029710 (32.3)21 (26.6)
Tobramycin21 (19.1)21 (30.0)10 (41.7)11 (12.8)0.00159 (29.0)12 (15.2)
Netilmicin6 (5.5)5 (7.1)2 (8.3)4 (4.7)2 (6.5)4 (5.1)
Ampicillin78 (70.9)60 (85.7)20 (83.3)58 (67.4)24 (77.4)54 (68.4)
Ampicillin–sulbactam61 (55.5)54 (77.1)15 (62.5)46 (53.5)18 (58.1)43 (54.4)
Amoxicillin–clavulanic acid26 (23.6)23 (32.9)5 (20.8)21 (24.4)6 (19.4)20 (25.3)
Piperacillin–tazobactam61 (55.5)54 (77.1)15 (62.5)46 (53.5)18 (58.1)43 (54.4)
Cefazolin46 (41.8)45 (64.3)15 (62.5)31 (36.0)0.020216 (51.6)30 (38.0)
Cefotaxime20 (18.2)20 (28.6)5 (20.8)15 (17.4)6 (19.4)14 (17.7)
Ceftazidime27 (24.5)27 (38.6)13 (54.2)14 (16.3)0.000112 (38.7)15 (19.0)0.0306
Ceftriaxone30 (27.3)30 (42.9)14 (58.3)16 (18.6)0.000113 (41.9)17 (21.5)0.0305
Cefepime29 (26.4)29 (41.4)14 (58.3)15 (17.4)0.000112 (38.7)17 (21.5)
Trimethoprim–sulfamethoxazole80 (72.7)59 (84.3)18 (75.0)62 (72.1)24 (77.4)56 (70.9)
Ciprofloxacin52 (47.3)49 (70.0)17 (70.8)35 (40.7)0.008915 (48.4)37 (46.8)
Levofloxacin48 (43.6)45 (64.3)16 (66.7)32 (37.2)0.031413 (41.9)35 (44.3)
Norfloxacin18 (16.4)18 (25.7)3 (12.5)15 (17.4)2 (6.5)16 (20.3)
Nitrofurantoin14 (12.7)12 (17.1)5 (20.8)9 (10.5)4 (12.9)10 (12.7)0.0002
Ertapenem0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)
Imipenem0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)0 (0.0)

* Only statistical significant values are shown

Antibiotic and multidrug resistance of the UPEC’s isolates, n (%) * Only statistical significant values are shown Co-resistance phenotype between cephalosporins and n class="Chemical">beta-lactams towards fluoroquinolones was frequently observed [(amoxicillin–clavulanic acid (p = 0.0004), cefazolin (p = 0.0299), cefotaxime (p = 0.0001), ceftriaxone (p = 0.0002) and, cefepime (p = 0.0015)]. Trimethoprim–sulfamethoxazole and cephalosporins [cefotaxime (p = 0.0232) and ceftazidime (p = 0.0001)] also showed a co-resistance. Overall, hospital-acquired isolates were slightly more resistant than community-acquired isolates (33.1% vs 28.7%, respectively). Both hospital and community-acquired isolates showed higher resistance towards ampicillin (77.4% vs 68.4%) and trimethoprim–sulfamethoxazole (77.4% vs 70.9%). UPEC isolates from hospital-acquired n class="Disease">infections were associated to ceftazidime (p = 0.0306), ceftriaxone (p = 0.0305), and nitrofurantoin (p = 0.0002) resistance phenotype (Table 4). MDR-phenotype was equally distributed among community-acquired (64.5%) and hospital-acquired (61.3%) isolates. Moreover, MDR-phenotype was associated to male infections (83.33%, p = 0.02329). MDR-phenotype (69.6%) as well as the FQ-resistant phenotype (69.6%, p = 0.0008) was also prevalent among older adults (> 60 years old).

Phylogenetic characterization, virulence genes, and their association to MDR-phenotype

All seven phylogenetic lineages (A, B1, B2, C, D, E and F) and cryptic clades were found on the 110 urinary E. coli isolates. The phylo-groups D (23.6%) and A (19.1%) were the most commonly found, followed by B1 (15.5%), C (13.6%), B2 (11.8%), F (10%), cryptic clades (5.5%) and phylo-group E (0.9%). The different phylo-groups and cryptic clades were distributed in both hospital and community settings, except the phylo-group E which was only distributed in the hospital-acquired n class="Disease">infections. MDR strains were distributed into all phylogenetic-groups: 26% (16/70) to A, 17.1% (12/70) to D, 15.7% (11/70) to B1, 12.9% (9/70) to C, 11.4% (8/70) to B2 and F, and 6.7% (5/70) to cryptic clades. Phylo-group D was significantly associated to MDR-phenotype (p = 0.0339) as well as FQ-resistant phenotype (26%, p = 0.0173). Phylo-groups B2 and D were more common among community-acquired isolates (18.2, 9.1%) than hospital-acquired isolates (5.5, 2.7%), as well as in females (20.9, 7.3%) than in males (4.5, 2.7%) but not significantly associations were found. Overall, fimH (71.8%), fyuA (68.2%), and agn43 (54.5%) were the virulence genes with the highest distributions among isolates, while afa/dra (8.2%) and cnf1 (2.7%) had the lowest. Others virulence genes tested had the following distribution: chuA, 49.1%; papC, 42.7%; kpsMTII, 37.3%; vat, 20%; yfcV, 20%; sfaS 10%, and hlyA, 9.1% (Table 5). Isolates from hospital-acquired n class="Disease">infections presented slightly more prevalence of virulence genes than community-acquired infections (35.2% vs 30.2%). Prevalence of fyuA (71.0% vs 67.1%), papC (48.4% vs 40.5%), yfcV (25.8% vs 55.7%), hlyA (12.9% vs 7.6%), cnf1 (3.2% vs 2.5%), kpsMTII (58.1% vs 29.1%) and chuA (51.6% vs 48.1%) were higher among UPEC isolated from hospital-acquired than community-acquired infections. However, only the kpsMTII was significantly associated with hospital-acquired isolates (58.1% vs 29.1%, p = 0.0047, Table 5). Comparing male vs female patients, isolates from females had a higher mean of virulence genes compared those isolates from male origin (21.5% vs 7.9%, respectively). Moreover, the yfcV was significantly more associated to male infections (41.7%, p = 0.0026). The presence of the chuA gene was associated to UPEC isolated from children (p = 0.0483). Furthermore, the presence of vat was associated to UPEC isolates from adults (p = 0.0153).
Table 5

Distribution of virulence genes among UPEC strains, n (%)

Virulence genesTotal isolates, n = 110 (%)MDR, n = 70 (%)Male, n = 24 (%)Female, n = 86 (%) *p Hospital-acquired, n = 31 (%)Community-acquired, n = 79 (%) *p
fyuA 75 (68.2)46 (65.7)14 (58.3)61 (70.9)22 (71.0)53 (67.1)
fimH 79 (71.8)51 (72.9)20 (83.3)59 (68.6)21 (67.7)58 (73.4)
sfaS 11 (10)6 (8.6)2 (8.3)9 (10.5)2 (6.5)9 (11.4)
afa/dra 9 (8.2)5 (7.1)0 (0.0)9 (10.5)2 (6.5)7 (8.9)
papC 47 (42.7)27 (38.6)12 (50.0)35 (40.7)15 (48.4)32 (40.5)
agn43 60 (54.5)39 (55.7)14 (58.3)46 (53.5)16 (51.6)44 (55.7)
yfcV 22 (20)15 (21.4)10 (41.7)12 (14.0)0.00268 (25.8)14 (17.7)
vat 22 (20)13 (18.3)7 (29.2)15 (17.4)6 (19.4)16 (20.3)
hlyA 10 (9.1)7 (10.0)4 (16.7)6 (7.0)4 (12.9)6 (7.6)
cnf1 3 (2.7)2 (2.9)1 (4.2)2 (2.3)1 (3.2)2 (2.5)
kpsMTII 41 (37.3)25 (35.7)9 (37.5)32 (37.2)18 (58.1)23 (29.1)0.0047
chuA 54 (49.1)32 (45.7)11 (45.8)43 (50.0)16 (51.6)38 (48.1)

* Only statistical significant values are shown

Distribution of virulence genes among UPEC strains, n (%) * Only statistical significant values are shown Virulence genes fimH (72.9%), fyuA (65.7%), agn43 (55.7%) and chuA (45.7%, Table 5), were highly distributed among MDR strains. However none virulence genes were significantly associated to MDR-phenotype or FQ-resistant isolates. Nevertheless, fimH (69.2%), fyuA (67.3%) and chuA (57.7%) were highly distributed among n class="Chemical">FQ-resistant bacteria.

Identification of virulence, and antimicrobial resistance genes by microarray analysis

Microarray analysis was done on 18 E. coli isolates belonging to the phylo-groups B2, D and F. Overall, 145 virulence and 40 antimicrobial resistance genes among the 315 and 82 genes and variants investigated were detected at least once in one or more of the isolates. The total number of virulence genes per isolate ranged from 18 to 63 genes. The median number of the virulence genes per isolate was 35. Microarray hybridizations demonstrated that all the n class="Species">E. coli isolates tested possessed virulence genes related to a pathotype including ExPEC and diarrheagenic E. coli (DEC). The total number of antimicrobial resistance genes per isolate ranged from 0 to 21 genes with a median number of 6.5 genes. Since the microarray carries a large set of virulence factors, numerous incomplete ExPEC that would normally be missed in a PCR-based assay were found. Thus, various unusual gene combinations were discovered, such as ExPEC pathogenic profiles with assorted EPEC genes coding for the type III secretion system 2 proteins ErpJ and SpaS (gene eprJ and epaS, respectively). Moreover, detection of virulence (mean 39.0 ± 16.9) and antimicrobial resistance (mean 9.0 ± 1.9) genes were higher on hospital-acquired UTIs isolates compared to community-acquired infections (Table 6). Higher frequency of virulence genes was found among isolates retrieved from females compared to those from males (36.25 ± 17.04 mean vs 31.66 ± 13.00 mean, respectively), as well as those isolates from children vs adults (36.58 ± 7.4 mean vs 26.6 ± 16.39 mean, respectively). In addition, antimicrobial resistance genes were also detected on higher ratios among isolates retrieved from males compared to those from females (7.88 ± 5.53 mean vs 4.0 ± 3.03 mean, respectively); a similar situation was observed when strains isolates from children vs those from adults were compared (14.60 ± 5.79 mean vs 4.4 ± 2.60 mean, respectively). Interestingly, the maximum number of antimicrobial resistance genes was found among UPEC isolates from children.
Table 6

Virulence and antimicrobial resistance genes detected by microarray analysis exclusively among E. coli B2, D and F isolates from UTIs patients

Type of infection
Hospital-acquired (n = 4)Community-acquired (n = 14)
Virulence genes (mean)3932
Antimicrobial resistance genes (mean)96
Phylo-groupsB2 (n = 2) and D (n = 2)B2 (n = 9), D (n = 3) and F (n = 2)
Virulence genes function
 ResistanceblaTEM, blaOXA-1, blaPSE-1, blaCTX-M-15, blaCMY-2, mphA, ant(3″)-Ia (aadA1), aac(3)-IIa (aacC2), tet(A), tet(B), tet(30), tet(R), sulI sulII, qnrA, aac(6′)-Ib-cr, class 1 integronblaTEM, blaOXA-1, blaOXA-9, blaPSE-1, blaCTX-M-15, blaCTX-M-12, blaOXY/K1, ant(3″)-Ia (aadA1), aac(3)-IIa (aacC2), aac(3)-IV, aph(3′)-Ia (aphA1), aph(3′)-IIa (aphA2), aph3 (strA), dhfrI, dhfrVII, catI, sulI, sulII, tet(A), tet(B), tet(30), mphA, class 1 integron, class 2 integron
 AdhesinsafaD, afaD8, afaE1, afaE2, afaE5, bfpA, fimC, ibeB, csgA, csgE, f165(1)A, fimA, fimH, iha, lpfA(O113), papA(10), papA(11), papA(16), papA(8), papC, papGI2, fitA, sfaHII, sfaDafaE1, afaE2, afaE5, cofA, lpfA2, fimC, csgA, csgE, csuA, F17b-A, F17d-A, facA, lpfA1, fimA, iha, lpfA(O113), lpfA, papA(8), papA(9), papA(10), papA(12), papA(13), papA(15), papA(40), papA(48), papC, papGII, papGIV, fitA, sfaHII, sfaA
 Colcins and microsinscvaC, mchBcda, ce1a, cib, cvaC, mcbA.
 Toxins Sat astA, astA(2), cdtB-4, cnf1, sat
 Iron acquisition or transport systemchuA, fepC, fyuA, iroN, iroN(2), irp1, irp2, iucD, iutA, iutA(2), iutA(UPEC), sitA, sitDchuA, fepC, fimH, fyuA, iroN(2), irp1, irp2, iucD, iutA, iutA(2), iutA(UPEC), sitA, sitD
 Capsular and somatic antigenskpsMTII, neuCkpsMTII, neuA, neuC
 Locus of enterocyte effacement (LEE) eae(delta) eae(lambda), espG, esta1
 ETT2 elementseivG, eprJeivG, eprJ, epaS
 Haemolysins and hemagglutininshlyA, hlyE, hra1bmaE, hlyA, hlyE, hra1.
 Various functionsagn43, capU, ccdB, deoK, fliC, gad, iss, iss(3), malX, ompA, ompT, ompT(2), senB, traTagn43, capU, ccdB, ibeA, ibeB, deoK, eaf, fliC, fliC(H7), gad, invX, iss, iss(3), malX, ompA, ompT, ompT(2), senB, traT
 Newly recognized or putative E. coli virulence genesartJ, b1121, b1432, gimB(orf1), mviM, mviN, shf, usp, virKartJ, b1121, mviM, mviN, set, shf, usp, virK
Virulence and antimicrobial resistance genes detected by microarray analysis exclusively among E. coli B2, D and F isolates from UTIs n class="Species">patients

Distribution of plasmid-mediated quinolone resistance genes, and ESBL genes

Overall, 22% of the isolates were positive for qnrA (25 isolates), 20.9% (23 isolates) to qnrB, 6.4% (7 isolates) to qnrS1, 0.9% (1 isolates) to qnrC, 4.5% (5 isolates) to qnrD, and 6.4% (7 isolates) to aac(6′)-Ib-cr (Table 7). None isolates were positive to n class="Gene">qepA gene. Isolates were taken to sequencing to obtain information on the QRDRs of the gyrA and parC genes, respectively. The sequencing results for the QRDR of gyrA and parC are summarized in Table 8. Only one isolate tested had no mutations in the QRDRs of gyrA and parC since was sensitive to ciprofloxacin (CIP), levofloxacin (LEV), and norfloxacin (NOR). The double mutations in Ser-83 → Leu and Asp-87 → Tyr or Asp-87 → Asn substitution in gyrA were present in 92% of the strain tested. Ser-80 → Ile substitution in parC were found in 92% of the isolates tested, which also were resistant to both ciprofloxacin and levofloxacin. The substitution Thr-66 → Ser (1 strain, CIP-resistant, LEV-resistant), Thr-66 → Asn (1 strain, CIP-resistant, LEV-resistant), and Thr-66 → Tyr (2 strains, CIP-resistant, LEV-resistant) were also found in parC. Other substitutions in parC as Glu-84 → Val (2 strains, CIP-resistant, LEV-resistant) and Glu-84 → Ala were also detected. Interestingly, one strain (isolated UEc 76) which was resistant to ciprofloxacin, levofloxacin and norfloxacin, belonging to B2 phylo-group and blaCTX-M-containing, also carried the double mutations in Ser-83 → Leu and Asp-87 → Asn substitution in gyrA and the triple mutation in parC Ser-80 → Ile, Thr-66 → Tyr and Glu-84 → Val.
Table 7

Distributions of PMQR and blaCTX-M genes among UPEC, n (%)

Virulence genesTotal isolates, n = 110 (%)MDR, n = 70 (%)Male, n = 24 (%)Female, n = 86 (%)*pHospital-acquired, n = 31 (%)Community-acquired, n = 79 (%)
qnrA 25 (22.7)15 (21.4)7 (29.2)18 (20.9)9 (29.0)16 (20.3)
qnrB 23 (20.9)13 (18.6)6 (25.0)17 (19.8)10 (32.3)13 (16.5)
qnrS 7 (6.4)3 (4.3)3 (12.5)4 (4.7)2 (6.5)5 (6.3)
qnrC 1 (0.9)0 (0.0)0 (0.0)1 (1.2)0 (0.0)1 (1.3)
qnrD 5 (4.5)4 (5.7)1 (4.2)4 (4.7)3 (9.7)2 (2.5)
aac(6′)-Ib-cr7 (6.4)4 (5.7)4 (16.6)3 (3.5)0.01942 (6.5)5 (6.3)
bla CTX-M 14 (12.4)11 (15.7)5 (20.8)9 (10.5)4 (12.9)10 (12.7)

* Only statistical significant values are shown

Table 8

Characterization of UTI isolates

StrainResistance profilePhylo-groupPMQR genesQRDR mutationsβ-lactamase-resistance-genesOther resistant genesIntegron
∆GyrA ∆ParC
UEc 11AMP, SXTB2NANA bla TEM ant(3″)-Ia (aadA1), aph3 (strA), dhfrI, sulII, tet(B)Class 2 integron
UEc 22AMP, SAM, AMC, CFZ, SXT, CIP, LEV, NORB2S83 → LD87 → NS80 → IT66 → N bla TEM tet(B)
UEc 23AMP, SAM, CFZ, CTZ, CAZ, CRO, FEP, SXT, CIP, LEVFaac(6′)-Ib-crNANAaac(3)-IIa (aacC2)Class 1 integron
UEc 27GEN, AMP, SAM, AMC, SXT, CIP, LEVB2S83 → LD87 → NS80 → IE84 → V bla PSE-1 sulI, tet(A)
UEc 30GEN, SAM, AMC, SXTB2NANA bla OXA-1 ant(3″)-Ia (aadA1), tet(A), tet(30), tet®, sulIClass 1 integron
UEc 58AMP, SXT, CIP, LEVB2S83 → LD87 → NG114 → SS80 → I bla TEM dhfrVII, sulII, tet(B), aph3 (strA), mphA
UEc 65AMP, CFZ, CAZ, CRO, FEP, CIP, LEVDS83 → LD87 → NG114 → SS80 → I bla CTX-M-15 bla TEM aac(3)-IIa (aacC2), dhfrVII, mphA, sulI, tet(B)Class 1 integron
UEc 69AMP, SXT, NITB2 qnrA NANA bla TEM sulII
UEc 75AMK, GEN, AMP, SAM, AMC, TZP, CFZ, CTX, CRO, FEPCIP, LEV, NORB2 qnrA S83 → LD87 → NS80 → IT66 → YblaOXY/K1, blaTEMaac(3)-IIa (aacC2), aph(3′)-Ia (aphA1), aph(3′)-IIa (aphA2), aph3 (strA), sulI, sulII, tet(A), tet(B)
UEc 76CFZ, CAZ, CRO, FEP, CIP, LEVB2S83 → LD87 → NS80 → IT66 → YE84 → V bla CTX-M-15 bla OXA-1 tet(A), tet(30)
UEc 84GEN, TOB, AMP, SAM, TZP, CFZ, CTX, CAZ, CRO, FEP, SXT, CIP, LEVDaac(6′)-Ib-crS83 → LD87 → NS80 → IblaCTX-M-15, blaOXA-1 bla TEM bla PSE-4 tet(30), mphA
UEc 99AMP, SXTB2 qnrA NoneNoneblaCTX-M-12,blaOXA-9, blaTEMaac(3)-IV, aac(3)-IIa (aacC2), aph3 (strA), catI, sulI, sulIIClass 1 integron
UEc 102AMP, CFZ, CAZ, CRO, FEP, SXT, CIP, LEVB2S83 → LD87 → NG114 → SS80 → I bla TEM aph(3′)-Ia (aphA1), sulII
UEc 104AMP, SXTDqnrA, aac(6′)-Ib-crNANAblaCMY-2,blaCTX-M-12, blaOXA-1aac(3)-IIa (aacC2), sulI, tet(B), mphAClass 1 integron
UEc 107FNANA
UEc 108AMPD qnrA NANA bla TEM sulI Class 1 integron
UEc 109AMP, SAMDaac(6′)-Ib-crNANA bla TEM sulII
UEc 110GEN, TOB, AMP, SAM, CTX, SXT, CIP, NITB2NANAaac(3)-IIa (aacC2), tet(B)Class 1 integron

AMK Amikacin, GEN gentamicin, TOB tobramycin, NET netilmicin, AMP ampicillin, SAM ampicillin–sulbactam, AMC amoxicillin–clavulanic acid, TZP piperacillin–tazobactam, CFZ cefazolin, CTX cefotaxime, CAZ ceftazidime, CRO ceftriaxone, FEP cefepime; SXT trimethoprim–sulfamethoxazole, CIP ciprofloxacin, LEV levofloxacin, NOR norfloxacin, NIT nitrofurantoin, ETP ertapenem, IPM imipenem, PMQR plasmid-mediated quinolone resistance genes, QRDR quinolone resistance-determining region, NA not analyzed

Distributions of PMQR and blaCTX-M genes among UPEC, n (%) * Only statistical significant values are shown Characterization of UTI isolates AMK Amikacin, GEN gentamicin, TOB tobramycin, NET netilmicin, AMP ampicillin, SAM n class="Chemical">ampicillin–sulbactam, AMC amoxicillin–clavulanic acid, TZP piperacillin–tazobactam, CFZ cefazolin, CTX cefotaxime, CAZ ceftazidime, CRO ceftriaxone, FEP cefepime; SXT trimethoprim–sulfamethoxazole, CIP ciprofloxacin, LEV levofloxacin, NOR norfloxacin, NIT nitrofurantoin, ETP ertapenem, IPM imipenem, PMQR plasmid-mediated quinolone resistance genes, QRDR quinolone resistance-determining region, NA not analyzed ESBL genes were investigated through microarray and PCR assay. A total of 27 isolates (24.5%) suspected as n class="Chemical">cephalosporinase producers showed positive PCRs for blaCTX-M (12.7%/14 isolates), blaTEM (18.2%/20 isoaltes), blaPSE (2.7%/3 isoaltes), and blaOXA (9.1%/10 isolates). Sequencing of the blaCTX-M amplicons identified the presence of blaCTX-M-15 in 7.2% of the strains (8 isolates), blaCTX-M-12 in 4.5% (5 isolates), blaCTX-M-3 in 1.8% (2 isolates), and blaCTX-M-14 in 1.8% (2 isolates). Furthermore, blaROB-1, blaSHV-37, and blaCMY-2 genes, were identified in one isolate (0.9%) through the microarray assay. Overall blaCTX-M genes and PMQR genes as well as mutation in QRDR were found in both community- and hospital-acquired n class="Disease">infections as well as in male and female genders. The PMQR qnrA (21.4%), and qnrB (18.6%), were highly distributed on MDR-phenotype (Table 7). Isolates from males had higher prevalence of aac(6′)-Ib-cr gene compare to female isolates (16.6% vs 3.5%, p = 0.0194). Quinolone-resistance isolates also presented higher prevalence to blaCTX-M compared to quinolone-sensitive phenotype isolates (21% vs 5.2%, p = 0.012).

Discussion

In accordance with global trends, our results reveal higher prevalence of urinary tract infections in female n class="Species">patients than in males [7, 34–36]. The emergence of high rates of antibiotic resistance and MDR-phenotype from urinary tract infections related bacteria becomes a public health concern worldwide. In this study, more than 70% of the isolates showed resistance to trimethoprim–sulfamethoxazole (TMP–SXT) that is recommended as a first choice for UTI treatment [36]. Previous studies reported similar results [20, 36]. In agreement with Bouchillon et al. [34] in this study, UPEC isolates presented more than 40% resistance to ciprofloxacin and levofloxacin antibiotics. Moreover, resistance rates to antimicrobial drugs were higher in isolates from male than in those from female patients [37]. Interestingly, fluoroquinolones are widely used for the treatment of UTIs in male patients [36, 38]. It is possible that male infections may be more difficult to eradicate because of the higher rates of antibiotic resistance observed in strains isolated from males, which may lead to recurrent infections. These observations were similar to previous papers [35, 36, 39]. Susceptibility analysis of isolates to antibiotics prior to treatment choice is recommended. Multidrug-resistant strain prevalence (63.3%) was higher in this work than in other study from Mexico, which reported only 16.4% of MDR strains [21]. While work of Paniagua-Contreras et al. [20], showed 97% of MDR strains. It is well known that susceptibility patterns may vary in different geographical regions and can be change over time [36]. In addition, an unexpected result was found, as the percentage of resistance to the antibiotics tested and MDR-phenotype were similar in hospital and community-acquired infections, indicating an important reservoir of resistance in both settings [34]. This could be due to household use of antibiotics before 2010, which would were acquired without prescription then. Moreover, resistance to n class="Chemical">cephalosporin and nitrofurantoin was associated to hospital-acquired infections. Co-resistance with fluoroquinolones and TMP–SXT was also observed in both hospital and community. As detected by Ochoa et al. [21], phylo-group D, an important phylo-group in pathogenic ExPEC was associated to MDR-phenotype. Additionally, FQ-resistant strains were correlated to phylo-group D strains. Strains from hospital-acquired n class="Disease">infections exhibited a greater number of virulence genes than those from community. In addition, E. coli isolates from hospital-acquired UTIs are correlated to the presence of kpsMTII gene that has been associated to pyelonephritis, a more severe infection of the upper urinary tract [40]. In agreement with other studies [20, 41], our results showed an important frequency of fyuA-encoding yersiniabactin receptor and, fimH encoding type 1 fimbrial adhesion. Detailed analysis of a strains subset using microarrays, revealed that some of them from both, hospital- and community-acquired infections carried virulence related genes of enteroaggregative and diffusely adherent n class="Species">E. coli (EAEC and DAEC), including capU (cap locus protein, hexosyltransferasa), deoK (deoxyribokinase), shf (putative virulence factor, plasmid pAA2, similar to Shigella flexneri Shf), virK (similar to Shigella flexneri virulence protein VirK, plasmid pAA2) and astA gene (EAEC heat-stable enterotoxin 1). This was also reported in previous works [42-45], which noticed that EAEC virulence related genes were among the most frequent markers of diarrheagenic E. coli reported in ExPEC strains. The deoK operon is frequently associated with strains isolated from infected urine and blood and is part of a large genetic island carrying genes contributing to the strain intrinsic virulence and/or adaptive properties [43]. These strains, by acquiring the pAA plasmid, could become a potential diarrheal agent [42]. Another finding was the presence of enteropathogenic E. coli (EPEC) related genes on five UPEC isolates. These genes included the eae (coding for intimin, a protein involved in attaching and effacing lesions), as well as virulence related genes such as espG (protein secreted by the type III secretion system and translocated into host epithelial cells), eprJ (n class="Species">E. coli type III secretion system 2 protein ErpJ), epaS (E. coli type III secretion system 2 protein EpaS), and eivG (E. coli type III secretion system 2 protein EivG) [3, 46]. T3SS genes are not common in UPEC isolates, however genes encoding components of T3SS have been found [47, 48]. These unusual gene combinations illustrate genome plasticity displayed by UPEC strains that may result in new hybrids pathotypes [45, 49, 50]. In this study, UPEC strains carrying PMQR genes associated to quinolones resistance including qnrA, qnrB, qnrS, qnrC and n class="Gene">qnrD as well as aac(6′)-Ib-cr were detected. The most common PMQR-genes identified were qnrA and qnrB, which is in contrast to previous studies were aac(6′)-Ib-cr gene detection was more frequent on ExPEC isolates [19, 51]. Moreover, qnrA and qnrB were frequently found as a part of MDR-phenotype. qnrD gene was found in 4.5% of the isolates. Previous papers reported qnrD in bacteria isolated from rooks [51], pigs [15] and humans clinical isolates of Salmonella enterica serovar Kentucky, serovar Bovismorbificans, Proteus mirabilis and Morganella morganii [52, 53], as well as in E. coli from dogs [54]. In accordance to others studies [19, 55, 56], qepA was not identified. Although PMQR genes provide a low level of FQ-resistance, they have been reported to favor the selection of additional chromosome-encoded resistance mechanism [57]. In our study, QRDR mutations in gyrA and parC were prevalent in community-acquired infections (89% vs 11%). Overall, mutations in QRDR were equally present among isolates from males and females patients. In our study, ESBL genes n class="Gene">blaCTX-M (blaCTX-M-15, blaCTX-M-14, blaCTX-M-12, and blaCTX-M-3), blaTEM, blaPSE, and blaOXA were detected. For the isolates carrying resistance genes, ESBL genes such as TEM, SHV and CTX-M, are the most widespread and frequently detected in E. coli [9]. In addition, CTX-M-15 is quite common in Mexico [58, 59].

Conclusions

Our study describes significant antimicrobial resistance in E. coli UTI isolates from hospital and community in Mexico. Diverse genotypes and phenotypes including multidrug-resistance, n class="Chemical">fluoroquinolone resistance and carriage of virulence genes related to several enteropathogenic E. coli were found among UPEC isolates. Thus, continuous surveillance for antimicrobial resistance of UPEC is needed in order to prevent treatment failure and to improve the strategies to mitigate the occurrence of antibiotic resistance organisms and ensure the best treatment to UTI patients. This study highlights the importance of antimicrobial resistance of virulent E. coli from urinary tract infection in Mexico.
  63 in total

1.  Plasmid-mediated quinolone resistance pump QepA2 in an Escherichia coli isolate from France.

Authors:  Vincent Cattoir; Laurent Poirel; Patrice Nordmann
Journal:  Antimicrob Agents Chemother       Date:  2008-07-21       Impact factor: 5.191

2.  Genetic characterization of highly fluoroquinolone-resistant clinical Escherichia coli strains from China: role of acrR mutations.

Authors:  H Wang; J L Dzink-Fox; M Chen; S B Levy
Journal:  Antimicrob Agents Chemother       Date:  2001-05       Impact factor: 5.191

3.  Role of the vpe carbohydrate permease in Escherichia coli urovirulence and fitness in vivo.

Authors:  Vanessa Martinez-Jéhanne; Christophe Pichon; Laurence du Merle; Olivier Poupel; Nadège Cayet; Christiane Bouchier; Chantal Le Bouguénec
Journal:  Infect Immun       Date:  2012-05-21       Impact factor: 3.441

4.  Draft genome sequences of five recent human uropathogenic Escherichia coli isolates.

Authors:  Sargurunathan Subashchandrabose; Tracy H Hazen; David A Rasko; Harry L T Mobley
Journal:  Pathog Dis       Date:  2013-10-01       Impact factor: 3.166

5.  Identification of CTX-M beta-lactamases in Escherichia coli from hospitalized patients and residents of long-term care facilities.

Authors:  Carl Urban; Noriel Mariano; Patricia A Bradford; Margareta Tuckman; Sorana Segal-Maurer; Wehbeh Wehbeh; Louise Grenner; Rita Colon-Urban; Brian Johnston; James R Johnson; James J Rahal
Journal:  Diagn Microbiol Infect Dis       Date:  2010-04       Impact factor: 2.803

6.  Molecular characterization and antimicrobial susceptibility of extended-spectrum {beta}-lactamase-producing Enterobacteriaceae isolates at a tertiary-care centre in Monterrey, Mexico.

Authors:  Elvira Garza-González; Sandra Iveth Mendoza Ibarra; Jorge M Llaca-Díaz; Gloria M Gonzalez
Journal:  J Med Microbiol       Date:  2010-10-07       Impact factor: 2.472

7.  The Clermont Escherichia coli phylo-typing method revisited: improvement of specificity and detection of new phylo-groups.

Authors:  Olivier Clermont; Julia K Christenson; Erick Denamur; David M Gordon
Journal:  Environ Microbiol Rep       Date:  2012-12-24       Impact factor: 3.541

8.  qnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbificans strains of human origin.

Authors:  L M Cavaco; H Hasman; S Xia; F M Aarestrup
Journal:  Antimicrob Agents Chemother       Date:  2008-11-24       Impact factor: 5.191

Review 9.  Pathogenic Escherichia coli.

Authors:  James B Kaper; James P Nataro; Harry L Mobley
Journal:  Nat Rev Microbiol       Date:  2004-02       Impact factor: 60.633

10.  Presence of multi-drug resistant pathogenic Escherichia coli in the San Pedro River located in the State of Aguascalientes, Mexico.

Authors:  Flor Y Ramírez Castillo; Francisco J Avelar González; Philippe Garneau; Francisco Márquez Díaz; Alma L Guerrero Barrera; Josée Harel
Journal:  Front Microbiol       Date:  2013-06-17       Impact factor: 5.640

View more
  25 in total

1.  Susceptibility to first choice antimicrobial treatment for urinary tract infections to Escherichia coli isolates from women urine samples in community South Brazil.

Authors:  Zuleica Naomi Tano; Renata K Kobayashi; Evelyn Poliana Candido; Juliana Buck Dias; Luis Felipe Perugini; Eliana Carolina Vespero; Wander Rogerio Pavanelli
Journal:  Braz J Infect Dis       Date:  2022-05-18       Impact factor: 3.257

2.  Comparative Study of ESBL Production Among Uropathogenic Escherichia coli Clinical Isolates from Pre- and Post-menopausal Women in Egypt.

Authors:  Ghada Hani Ali; Marwa A Yakout
Journal:  Curr Microbiol       Date:  2021-07-20       Impact factor: 2.188

3.  A strategy design based on antibiotic‑resistance and plasmid replicons genes of clinical Escherichia coli strains.

Authors:  Junyan Liu; Xin Lin; Thanapop Soteyome; Yanrui Ye; Dingqiang Chen; Ling Yang; Zhenbo Xu
Journal:  Bioengineered       Date:  2022-03       Impact factor: 6.832

4.  Virulence gene transcription, phylogroups, and antibiotic resistance of cervico-vaginal pathogenic E. coli in Mexico.

Authors:  Eric Monroy-Pérez; Areli Bautista Cerón; Luis Rey García Cortés; Nancy Nolasco Alonso; Pablo Domínguez-Trejo; Tania Hernández-Jaimes; Jaime Bustos-Martínez; Aida Hamdan-Partida; Ernesto Arturo Rojas Jiménez; Sergio Vaca; Felipe Vaca-Paniagua; Gloria Luz Paniagua-Contreras
Journal:  PLoS One       Date:  2020-06-22       Impact factor: 3.240

5.  Treatment Failure in Urinary Tract Infections: A Warning Witness for Virulent Multi-Drug Resistant ESBL- Producing Escherichia coli.

Authors:  Zahra Naziri; Abdollah Derakhshandeh; Arash Soltani Borchaloee; Meisam Poormaleknia; Negar Azimzadeh
Journal:  Infect Drug Resist       Date:  2020-06-17       Impact factor: 4.003

6.  Genomic analysis of trimethoprim-resistant extraintestinal pathogenic Escherichia coli and recurrent urinary tract infections.

Authors:  Dmitriy Li; Cameron J Reid; Timothy Kudinha; Veronica M Jarocki; Steven P Djordjevic
Journal:  Microb Genom       Date:  2020-11-18

7.  Draft Genome Sequence of a Uropathogenic Escherichia coli Sequence Type 44 Strain Carrying Multiple Antimicrobial Resistance Genes.

Authors:  Jessica L Ortega-Balleza; Abraham Guerrero; Graciela Castro-Escarpulli; Eduardo Cruz-González; Gildardo Rivera; Virgilio Bocanegra-García
Journal:  Microbiol Resour Announc       Date:  2022-03-24

8.  The Vacuolating Autotransporter Toxin (Vat) of Escherichia coli Causes Cell Cytoskeleton Changes and Produces Non-lysosomal Vacuole Formation in Bladder Epithelial Cells.

Authors:  Juan Manuel Díaz; Charles M Dozois; Francisco Javier Avelar-González; Eduardo Hernández-Cuellar; Pravil Pokharel; Alfredo Salazar de Santiago; Alma Lilian Guerrero-Barrera
Journal:  Front Cell Infect Microbiol       Date:  2020-06-26       Impact factor: 5.293

9.  Isolation, Characterization and Genomic Analysis of a Novel Bacteriophage VB_EcoS-Golestan Infecting Multidrug-Resistant Escherichia coli Isolated from Urinary Tract Infection.

Authors:  Mahsa Yazdi; Majid Bouzari; Ezzat Allah Ghaemi; Khashayar Shahin
Journal:  Sci Rep       Date:  2020-05-06       Impact factor: 4.379

Review 10.  Antibiotic Resistance Among Uropathogenic Escherichia coli.

Authors:  Barbara Kot
Journal:  Pol J Microbiol       Date:  2019-12-05
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.