| Literature DB >> 30011880 |
Josué Delgado1, Alicia Rodríguez2, Alfredo García3, Félix Núñez4, Miguel A Asensio5.
Abstract
Aflatoxigenic molds can grow and produce aflatoxins on dry-fermented meat and cheese. The small, basic, cysteine-rich antifungal protein PgAFP displays a time-limited inhibitory ability against unwanted molds by increasing reactive oxygen species (ROS), which can lead to increased aflatoxin production. However, calcium abolishes the inhibitory effect of PgAFP on certain Aspergillus spp. To maximize the antifungal effect, this protein may be combined with protective cultures. Yeasts and lactic acid bacteria may counteract the impact of calcium on PgAFP fungal inhibition. The objective of this work was to study the effect of PgAFP and different combined treatments with Debaryomyces hansenii and/or Pediococcus acidilactici against growth of and aflatoxin production by an aflatoxigenic strain of Aspergillus parasiticus in both culture media and dry-fermented foods with low or high calcium levels. Aflatoxins production was increased by PgAFP but dramatically reduced by P. acidilactici in low calcium culture medium, whereas in the Ca-enriched culture medium, all treatments tested led to low aflatoxins levels. To study whether PgAFP and the protective microorganisms interfere with ROS and aflatoxin production, the relative expression of genes foxA, which is involved in peroxisomal β-oxidation, and aflP, which is required for aflatoxin biosynthesis, were evaluated. The aflatoxin overproduction induced by PgAFP seems not to be linked to peroxisomal β-oxidation. The combination of PgAFP and D. hansenii provided a successful inhibitory effect on A. parasiticus growth as well as on aflatoxin production on sliced dry-fermented sausage and cheese ripened up to 15 days, whereas P. acidilactici did not further enhance the protective effect of the two former agents. Therefore, the combined treatment of PgAFP and D. hansenii seems to provide a promising protective mean against aflatoxin-producing A. parasiticus on dry-fermented foods.Entities:
Keywords: Aflatoxin; Aspergillus parasiticus; Debaryomyces hansenii; antifungal protein; biopreservation; cheese; dry-fermented sausage
Year: 2018 PMID: 30011880 PMCID: PMC6164858 DOI: 10.3390/microorganisms6030069
Source DB: PubMed Journal: Microorganisms ISSN: 2076-2607
Nucleotide sequence of primers used for the quantitative polymerase chain reaction (qPCR) assay.
| Primer Name | Nucleotide Sequences (5′-3′) | Product Size | Position | Reference |
|---|---|---|---|---|
| F-Omt-1 | GGCCGCCGCTTTGATCTAGG | 123 | a 1485 | [ |
| R-Omt-1 | ACCACGACCGCCGCC | 1593 | ||
| F-foxA | ACCGCAACCCTCTTCACATT | 73 | b 1196 | This study |
| R-foxA | AGACCGTGCAGGATAGGAGT | 1268 | ||
| F-β-tub | TCTTCATGGTTGGCTTCGCT | 98 | c 964s | This study |
| R-β-tub | CTTGGGGTCGAACATCTGCT | 1042 |
a Positions are in accordance with the published sequence of the aflP (omt-1) gene of A. flavus (GenBank accession no. L25835.1). b Positions are in accordance with the published sequence of the foxA gene of A. flavus (GenBank accession no. XM_002377580). c Positions are in accordance with the published sequences of the β-tubulin gene of A. parasiticus (GenBank accession no. FR775333.1).
Figure 1Mycelium dry weight of A. parasiticus cultured in yeast extract sucrose broth (left) and calcium-enriched yeast sucrose broth (right) for 15 days with different combinations of biopreservative agents. Pg: PgAFP, Dh: Debaryomyces hansenii, Pa: Pediococcus acidilactici. * Means are significantly different from untreated control (p ≤ 0.05).
Figure 2Effect of different combinations of biopreservative agents in aflatoxin B1 (left) and G1 (right) production by Aspergillus parasiticus in yeast extract sucrose broth (A) and calcium-enriched yeast extract sucrose broth (B) after 15 days. Pg: PgAFP; Dh: Debaryomyces hansenii; Pa: Pediococcus acidilactici. LOD: Limit of detection. * Means are significantly different from untreated batch (p ≤ 0.05).
Aflatoxins concentrations and microbial counts on slices of dry-fermented sausage at five and 15 days of incubation. Data are given as mean ± SD.
| Day 5 | |||
|---|---|---|---|
| Untreated | Pg + Dh | Pg + Dh + Pa | |
| 6.54 ± 0.22 | <3 * | <3 * | |
| <3.00 | >7.50 * | >7.50 * | |
| 4.40 | 3.54 | 7.53 * | |
| 86 ± 8 | <LOD b,* | <LOD * | |
| 152 ± 9 | <LOD * | <LOD * | |
|
| |||
|
|
|
| |
| 7.42 ± 0.09 | 4.26 ± 0.28 * | 4.74 ± 0.38 * | |
| <3.00 | >7.50 * | 6.05 ± 0.48 * | |
| 4.30 | 3.23 | 6.83 * | |
| 115 ± 0.43 | <LOD * | <LOD * | |
| 170 ± 31 | 8.3 ± 4.5 * | 10 ± 1.3 * | |
Pg: PgAFP; Dh: Debaryomyces hansenii; Pa: Pediococcus acidilactici. LOD: Limit of detection. * Mean values are significantly different from those of the untreated batch (p ≤ 0.05).
Water activity (aw), microbial counts and aflatoxins concentration in cheese slices inoculated with A. parasiticus at five and 15 days of incubation. Data are given as mean ± SD.
| Day 5 | ||||
|---|---|---|---|---|
| Untreated | Pg + Dh | Pg + Dh + Pa | ||
|
| 0.89 | 0.89 | 0.89 | |
| 4.12 ± 0.57 | 2.31 ± 0.64 * | 2.39 ± 0.75 * | ||
| <3.00 | >7.50 * | >7.50 * | ||
| 2.84 ± 0.35 | 2.49±0.74 | 6.73 ± 0.26 * | ||
| <LOD | <LOD | <LOD | ||
| 11 ± 7 | <LOD * | <LOD * | ||
|
| ||||
|
|
|
| ||
|
| 0.86 | 0.86 | 0.86 | |
| 4.87 ± 0.21 | <2 * | 2.99 ± 0.67 * | ||
| <3.00 | >7.50 * | >7.50 * | ||
| 3.75 | 2.7 | 6.71 * | ||
| <LOD | <LOD | <LOD | ||
| 29 ± 24 | <LOD | <LOD | ||
Pg: PgAFP; Dh: Debaryomyces hansenii; Pa: Pediococcus acidilactici. LOD: Limit of detection. * Means are significantly different from untreated samples (p ≤ 0.05).
Figure 3Effect of different combinations of biopreservative agents on relative gene expression of aflP (left) and foxA (right) genes in yeast extract sucrose broth (A) or calcium-enriched yeast extract sucrose broth (B) after five days. Pg: PgAFP; Dh: Debaryomyces hansenii; Pa: Pediococcus acidilactici. *Means are significantly different from untreated batch (p ≤ 0.05).