Literature DB >> 29883395

Development of a Highly Sensitive FcMito qPCR Assay for the Quantification of the Toxigenic Fungal Plant Pathogen Fusarium culmorum.

Katarzyna Bilska1, Tomasz Kulik2, Anna Ostrowska-Kołodziejczak3, Maciej Buśko4, Matias Pasquali5, Marco Beyer6, Anna Baturo-Cieśniewska7, Marcin Juda8, Dariusz Załuski9, Kinga Treder10, Joerg Denekas11, Juliusz Perkowski12.   

Abstract

Fusarium culmorum is a ubiquitous, soil-borne fungus (ascomycete) causing foot and root rot and Fusarium head blight on cereals. It is responsible for yield and quality losses as well as grain contamination with mycotoxins, which are a potential health hazard. An extremely sensitive mitochondrial-based qPCR assay (FcMito qPCR) for quantification of F. culmorum was developed in this study. To provide specificity, the FcMito assay was successfully validated against 85 F. culmorum strains and 53 isolates of 30 other fungal species. The assay efficiency and sensitivity were evaluated against different F. culmorum strains with various amounts of pure fungal DNA and in the presence of background wheat DNA. The results demonstrated the high efficiency of the assay (97.2⁻106.0%, R²-values > 0.99). It was also shown that, in the presence of background DNA, 0.01 pg of fungal template could be reliably quantified. The FcMito assay was used to quantify F. culmorum DNA using 108 grain samples with different trichothecene levels. A significant positive correlation was found between fungal DNA quantity and the total trichothecene content. The obtained results showed that the sensitivity of the FcMito assay was much higher than the nuclear-based qPCR assay for F. culmorum.

Entities:  

Keywords:  Fusarium culmorum; Fusarium head blight (FHB); detection; mitochondrial DNA (mtDNA); qPCR assay; quantification

Mesh:

Substances:

Year:  2018        PMID: 29883395      PMCID: PMC5983267          DOI: 10.3390/toxins10050211

Source DB:  PubMed          Journal:  Toxins (Basel)        ISSN: 2072-6651            Impact factor:   4.546


1. Introduction

A common soil-borne fungus, Fusarium culmorum, remains an important cereal pathogen of a wide range of small-grain cereals, as well as maize [1,2]. On wheat and barley, it causes two distinct diseases: FRR (Fusarium foot and root rot) and FHB (Fusarium head blight), also known as ear blight or scab [1]. Both diseases cause significant yield losses and the latter results in contamination of the grain with trichothecenes, which may pose a grave threat to both food and feed safety [3,4,5,6]. Trichothecenes produced by F. culmorum include deoxynivalenol (DON), nivalenol (NIV), and their acetylated derivatives, 3-acetylodeoxynivalenol (3ADON) and 4-acetylnivalenol (4ANIV, syn. fusarenon X) [7], which differ in toxicity to mammals and plants [8]. Options of chemical control are very limited. F. culmorum can be controlled by fungicides containing triazoles as active ingredients, while strobilurins such as trifloxystrobin and succinate dehydrogenase inhibitors such as isopyrazam are hardly effective [9]. Before 2000, F. culmorum was the predominant agent of FHB in Northern, Central, and Western Europe [1,10]. However, since that time, a change has been observed in many European countries in the distribution of F. culmorum, which appears to be replaced by F. graminearum sensu stricto (s.s.) [11]. This progressive switch may be explained by the increased production of maize, which favors the production of ascospores by F. graminearum s.s. Other causes of F. culmorum to F. graminearum s.s. replacement may be related to the gradual adaptation of F. graminearum s.s. to colder climates [12,13] or to the recorded rise in average temperatures caused by climate change [1,14,15,16]. It is, however, noteworthy that F. culmorum can predominate in certain European locations. For example, in Luxembourg, following the dry year 2011, F. culmorum was identified from the majority of symptomatic wheat heads, whereas only 10% were infected by F. graminearum s.s. [17]. F. culmorum is now frequently reported as the main agent of FRR and FHB in the Mediterranean region, which is contrary to surveys from Central and Northern Europe [1,18,19,20,21,22,23,24,25]. Traditionally, identification of F. culmorum is based on the shape of the macroconidia formed in sporodochia [1,26]. However, morphological identification of Fusaria is time-consuming, requires qualified experts in the field of culturing fungi [27], and precludes the distinction of species frequently occurring on wheat [26]. In addition, ascomycetes cannot be reliably quantified by the viable count procedures [28,29]. Recently, quantitative polymerase chain reaction (qPCR) has been found to be a most promising method for fungal quantification from different environmental samples. qPCR offers several advantages over other diagnostic techniques, including higher sensitivity and specificity and a rapid turnaround time. At least four specific real-time PCR assays have previously been designed for F. culmorum, using either SybrGreen or TaqMan chemistries [30,31,32,33]. However, fungal quantification is sometimes a challenge, mostly due to the relatively low fungal biomass in environmental samples and the fungal cell wall structure itself, which makes nucleic acid extraction difficult [34]. The sensitivity of qPCR assays can be improved with diagnostic assays focusing on various multi-copy DNA regions, such as mitochondrial DNA (mtDNA). As was successfully demonstrated with the development of the FgMito assay for quantification of F. graminearum s.s. [35]. The present study sought to design a highly sensitive FcMito qPCR assay to quantify F. culmorum. To ensure high assay sensitivity, primers and a minor-groove binding (MGB) probe were prepared based on multi-copy mitochondrial DNA. The specificity of the assay was evaluated against both a broad range of F. culmorum strains from distinct localities as well as other Fusarium species. The assay’s efficiency and sensitivity were further evaluated against a test panel of different F. culmorum strains with various amounts of pure fungal DNA as well as in the presence of wheat background DNA. F. culmorum was quantified using the FcMito assay from 108 field samples with different trichothecene amounts.

2. Results

2.1. The Design of a Primer/Probe Set for Specific Quantification of F. culmorum Based on the Mitochondrial COX2 Gene

To design a primer/probe set specific for F. culmorum, complete mitogenomes of F. culmorum, F. graminearum s.s., and F. gerlachii were aligned. An intron3 within the COX2 gene was present in F. culmorum only, based on which a primer/probe set was designed for specific quantification of this species. In silico specificity of primers and the designed probe was further confirmed by BLAST searches.

2.2. Optimizing a TaqMan Assay Specific for F. culmorum

The 138 Fusarium strains were used to evaluate the specificity of the FcMito assay (Table S1). All 85 F. culmorum strains emitted a fluorescent signal with the FcMito assay, whereas no amplification was noted on the remaining tested non-target Fusaria. The efficiency of the FcMito assay ranged from 98.5 to 100.5%, while the coefficient of determination was greater than R2 = 0.995 (Table 1). No significant differences were recorded in the CT range, R2, or efficiency between pure strain standards or standards mixed with 30 ng of wheat background DNA. No false-positive signals were detected when using 30 ng of wheat DNA (Table 2). Six low concentrations of F. culmorum DNA (2, 0.5, 0.2, 0.05, 0.02, and 0.01 pg) showed no false-negative results in the presence of background wheat DNA. A false-negative rate of 34.7% was found for the lowest DNA input (0.005 pg). In this way, the limit of quantification (LOQ) of the FcMito assay could be established as 0.05 pg.
Table 1

Validation results of FcMito assay based on 10 PCR runs using pure strain standards and templates mixed with 30 ng of wheat DNA.

StrainAssay Quantitative Dynamic Range (pg) aCT RangeR2Efficiency (%)
M6016840–0.6815.31 ± 0.17–28.18 ± 0.200.99899.2
ZFc 05026500–0.6514.99 ± 0.19–28.15 ± 0.170.99899.9
ZFc 060127,320–2.7312.72 ± 0.18–25.98 ± 0.160.99899.0
ZFc 0601 b 12.9 ± 0.09–26.17 ± 0.120.99998.9
CBS 1105688720–0.6723.34 ± 0.12–36.68 ± 0.130.99899.7
CBS 110568 b 22.98 ± 0.14–35.85 ± 0.960.99998.1
CBS 171.285440–0.5423.79 ± 0.12–36.55 ± 0.140.995100.5
CBS 171.28 b 23.86 ± 0.10–36.22 ± 0.060.997106.0
MCR 3202620–0.2615.89 ± 0.09–29.28 ± 0.210.99998.5
MCR 320 b 15.88 ± 0.07–29.45 ± 0.130.99997.2

a Fungal DNA was quantified by Qubit fluorometer in three independent measurements; b Diluted in the presence of 30 ng of background wheat DNA.

Table 2

Results of the quantity median (IQR) and quantity mean of seven low concentrations of F. culmorum DNA (in picograms) analyzed in the presence of 30 ng of wheat DNA.

Amount of Input Template (pg)No. of Positive AmplificationsQuantity Mean (pg)Quantity Median (IQR) (pg)
272/722.218 (1.821–2.94)2.191
0.572/720.489 (0.39–0.62)0.483
0.272/720.228 (0.161–0.578)0.22
0.0572/720.053 (0.031–0.11)0.052
0.0272/720.014 (0.001–0.064)0.011
0.0172/720.011 (0.002–0.035)0.010
0.00547/720.008 (0.001–0.084)0.004
30 ng of wheat background DNA only0/96--
No template0/96--

2.3. The Quantification of F. culmorum DNA from Naturally Contaminated Grain Samples

The FcMito assay was used to quantify F. culmorum DNA from 108 grain samples (Table S2). The presence of F. culmorum was revealed in all of them. The obtained CT values ranged from 21.46 to 36.94, while the estimated fungal DNA amount differed significantly between samples, ranging from 61.969 to 0.002 pg. However, most of the grain samples (n = 78) contained a very low amount of F. culmorum DNA (<1 pg). Grain samples were additionally examined with the real-time PCR assay, which targeted the nuclear genome of F. culmorum [30]. Negative results were obtained for 60 samples. All of these samples contained very low amounts of F. culmorum, ranging from 1.753 to 0.002 pg, as quantified with the FcMito assay. Thus, over half of the amount of the samples analyzed with a nuclear-based assay produced false-negative results. The DNA from F. graminearum s.s. was found in almost half of the samples (n = 53). Interestingly, in most samples exhibiting increased levels of F. graminearum s.s., a very low quantity of F. culmorum was revealed. The grain samples were then analyzed for the presence of trichothecenes. Deoxynivalenol was the dominant trichothecene compound (Table S2). Mycotoxins were found in all samples except for two. To determine the existence of the relationship in the total trichothecenes and the DNA quantity in grain samples, Spearman’s rank correlation was calculated separately for F. culmorum, F. graminearum s.s., and both species together. Spearman’s rank correlation was used because non-normal distribution of the data. In all three cases, statistical analysis revealed positive correlations between the fungal DNA and the total trichothecene content (r = 0.36, r = 0.35, r = 0.49, accordingly, p < 0.001).

3. Discussion

There are two major Fusarium species responsible for FHB in Europe: F. culmorum and F. graminearum s.s. Reliable identification and quantification of these species forms the basis of all studies related to population dynamics, fungal ecology, toxicology, and the efficacy of crop protection measures. Nowadays, qPCR is one of the most promising tools for quantification of Fusaria from environmental samples. However, the quantification of fungal DNA can often be hampered by the relatively low levels of fungal loads in environmental samples and the structure of the fungal cell wall—making disruption for nucleic acid extraction difficult [34]. It is possible to improve the sensitivity of fungal quantification by diagnostic assays targeting mtDNA. Considering the relatively small differences for mean and median of quantified DNA for 0.01 and 0.02 pg (Table 2), the limit of quantification (LOQ) of the FcMito assay was determined as 0.05 pg. This is 18-fold lower than LOQ of another F. culmorum specific TaqMan assay targeting the nuclear genome [30]. It was shown that the FcMito assay could detect 0.005 pg of the input template, but only with a 35% false-negative rate. Thus, the limit of detection (LOD) of the designed assay could be determined between 0.05 and 0.005 pg. The haploid cell of F. culmorum contains 42 Mb [36], which equals 0.04 pg. Therefore, LOQ of the FcMito assay (0.05 pg) is equal to approximately one and a quarter of the haploid cell of F. culmorum. A comparison of the LOQ values of both FcMito and FgMito assays shows a 4-fold lower LOQ of FcMito than the FgMito assay. This can be explained by incorporation of a primer with an additional mismatch in the 3rd last nucleotide from the 3′ end of the FgMito assay. Although this modification increased the specificity of the assay [35], it negatively affected the LOQ and LOD of the FgMito assay (data not shown). Atoui et al. [37] claimed that the best way to identify grain contamination by fungi is targeting the mycotoxigenic genes specifically where a particular mycotoxin can be produced by a number of species. However, it is occasionally impossible to distinguish a particular species. Atoui et al. [37] found that primers targeting the PKS13 gene involved in zearalenone (ZEA) biosynthesis detected F. graminearum s.s. and F. culmorum. A similar assay was developed by Meng et al. [38] and was specific for the zearalenone-producing F. graminearum s.s., F. culmorum, and F. cerealis. FcMito assay is species-specific, as it only amplifies the F. culmorum DNA (Table S1). In this study, high efficiency (98.5–100.5%) and high coefficients of determination (over R2 = 0.995) were acquired for a series dilution of pure strain standards. Moreover, there were no significant differences in amplification profiles between pure strain standards and standards mixed with 30 ng of wheat background DNA. This indicates that, since wheat DNA had no impact on FcMito assay, it can be successfully used in field sample analysis. This study found a positive correlation between the F. culmorum DNA and the total trichothecenes present in naturally contaminated grains. Despite Spearman’s rank correlation coefficient (r = 0.34) not being high, it was still significant. Similar results were obtained when correlating quantities of F. graminearum s.s. DNA to trichothecenes [35]. However, we found that correlation of the sum of trichothecenes to the sum of F. culmorum and F. graminearum s.s. DNA resulted in an increase in Spearman’s rank correlation coefficient (r = 0.49), which indicates that a more reliable prediction of trichothecene content in the grain requires quantification of both species. This also confirmed that both F. culmorum and F. graminearum s.s. are responsible for the current contamination of European grains with type B trichothecenes [24]. Fusaria differ significantly in pathogenicity, toxigenicity, and sensitivity to commonly used fungicides. Identification and quantification of predominant species is important in preventing and controlling the FHB epidemic. Furthermore, the quantification of fungal DNA can indicate plausible mycotoxin contamination. This may help in the prediction of potential toxicological risks. Due to its extremely high sensitivity, a FcMito assay may be used to study infection strategy of the pathogen in biomass-limited samples such as individual floral organs of cereals. Together with other mitochondrial-based assays, the assay developed in this study could be applied to reveal tissue-specific infection patterns in naturally infected caryopses, paleas, lemmas, and glumes on which compound appressoria are formed at initial stages of the infection process [39]. Our assay may also be used to characterize fungal concentrations in environmental samples with relatively lower amounts of fungal biomass such as air dust, soil, and water, without the need to cultivate fungi on artificial media. Finally, the mitochondrially based assay developed in this study would be valuable in many plant-breeding programs, as well as an initial step in food and feed quality assessment.

4. Materials and Methods

4.1. Fungal Strains

Table S1 lists the 138 Fusarium strains used in the specificity test. Polish isolates of F. culmorum [40] are kept in the Department of Phytopathology and Molecular Mycology of the University of Technology and Life Sciences (Bydgoszcz, Poland). The DBNP strains are located in the Department of Microbiology and Mycology of the University of Warmia and Mazury in Olsztyn (Olsztyn, Poland). The tested CBS strains are held in the Westerdijk Fungal Biodiversity Institute (Utrecht, The Netherlands). The strains from Italy and Luxemburg are kept in the Fungal Culture Collection of the Department Environmental Research and Innovation of the Luxembourg Institute of Science and Technology and are accessible at www.luxmcc.lu [41]. The Fusarium isolates were maintained at 25 °C on a potato dextrose agar (PDA) before DNA extraction was conducted.

4.2. Grain Samples

The 108 grain samples were analyzed in the study presented in this paper (Table S2). The wheat samples from Luxembourg (n = 13) (received from the Luxembourg Institute of Science and Technology) were collected in 2007 and 2008 [42]. Polish samples were harvested in 2011 and 2012. An IKA A10 analytical grinding mill (IKA Werke GmbH & Co. KG, Staufen im Breisgau, Germany) was used to initially grind 100 g of grain from each sample. Samples were kept at −25 °C.

4.3. DNA Extraction

The DNA extraction involved 0.1 g of mycelium collected from the top of PDA plates as well as 0.25 g of ground grain per sample. These samples were homogenized twice (30 s at a speed of 6.0 m/s) using a FastPrep-24 instrument (MP Biomedicals, Solon, OH, USA). A ChargeSwitch® gDNA Plant Kit (Invitrogen, Carlsbad, CA, USA) was used to isolate genomic DNA following the manufacturer’s protocol. A Qubit® 2.0 Fluorometer and a Qubit®dsDNA BR Assay (Invitrogen, Carlsbad, CA, USA) were used to determine fungal and plant DNA concentrations according to the manufacturer’s recommendations.

4.4. Design of a Primer/Probe Set Specific for F. culmorum

To find the polymorphic site to design a primer/probe set specific for F. culmorum, complete mitogenomes of F. culmorum (GenBank: NC_026993.1), F. graminearum s.s. (GenBank: NC_009493.1, DQ364632.1, KR011238.1, KP966561.1, KP966560.1, KP966559.1, KP966558.1, KP966557.1, KP966556.1, KP966555.1, KP966554.1, KP966553.1, KP966552.1, KP966551.1, KP966550.1) and F. gerlachii (GenBank: KM486533) were aligned. The sequence analysis revealed that the COX2 intron3 (3358 bp, 34.300–37.658) was present in F. culmorum only, which was then used to design primers and probe (Table 3) using the PRIMER EXPRESS 3.0 software package (Applied Biosystems, Foster City, CA, USA). The probe included a minor groove binder (MGB) moiety at the 3′ was labeled with 6-carboxyfluorescein (FAM) at the 5′-end. The probes were obtained from the ABI PRISM Primers and TaqMan Probe Synthesis Service and the primers were synthesized by Sigma-Aldrich (St. Louis, MO, USA).
Table 3

Primers and MGB probe developed for quantification of F. culmorum.

Primer/Probe NamePrimer/TagMan Probe Sequence
COX2_1TCGTTGACGGTGAGGGTTGT
COX2_2GACTCGAACACGTCAACCAACTT
COX2 probeFAM-CGGTTATTATTTCGAAAAGT-MGB

4.5. Optimization of a TaqMan Assay Specific for F. culmorum

The TaqMan reaction was performed according to Kulik et al. [35] in a 7500 Fast Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA). The optimized TaqMan assay specificity was verified by testing a total of 138 fungal strains (Table S1). The efficiency and sensitivity of the assay were determined using a ten-fold serial dilution of various amounts of gDNA (in picograms) of six F. culmorum strains as a template (Table 1). The background DNA impact was considered by testing the efficiency and sensitivity of the assay in the presence of 30 ng of wheat DNA. Four replicates of each dilution were prepared for each TaqMan experiment. Two non-template controls (NTCs) were used: water-only and background DNA-only samples. The reaction efficiency and coefficient of determination (R2) were calculated with the obtained CT-values. The TaqMan reaction was performed in 96 replicates, using 30 ng of wheat DNA as a template in order to verify the false-positive rate. To identify false-negative results, seven low concentrations of F. culmorum DNA (2, 0.5, 0.2, 0.05, 0.02, 0.01, and 0.005 pg) were analyzed in the presence of 30 ng of wheat DNA (Table 2). The concentration of each template was then analyzed in 72 replicates.

4.6. Quantification of F. culmorum DNA from Naturally Contaminated Grain Samples

Plant Internal Positive Control (pIPC) was used for normalization the DNA samples extracted from grains, according to Kulik et al. [43]. Subsequently, all samples were analyzed for the presence and quantity of F. culmorum using the FcMito assay. The amount of F. culmorum DNA (pg) was evaluated from CT values using a standard curve. All template concentrations were analyzed in three replicates under the conditions described previously. The obtained results were compared with the results of F. culmorum and F. graminearum s.s. quantification from a previous study by Kulik et al. [35]. Differences in sensitivity between the FcMito assay and nuclear-based assay [30] were revealed by comparing the CT values of both assays.

4.7. Trichothecene Determination from the Grain Samples

The levels of DON, 3ADON, 15ADON, and NIV were determined in grain samples. The Polish samples were analyzed for trichothecene presence according to the protocol described by Perkowski et al. [44], while samples from Luxembourg were analyzed according to Giraud et al. [42].

4.8. Statistical Analyses

Statistical analyses were conducted using STATISTICA (Data Analysis Software System, ver. 12.5; StatSoft Inc., Tulsa, OK, USA, 2014). The relationship between the DNA quantity and the total trichothecene content in grain samples (p < 0.05) was established by Spearman’s rank correlation. The mean (pg) and median (IQR) (pg) quantities of seven low concentrations of the template (2, 0.5, 0.2, 0.05, 0.02, 0.01, and 0.005 pg) analyzed in the presence of background wheat DNA were determined.
  24 in total

1.  Comparison of different bead-beating RNA extraction strategies: an optimized method for filamentous fungi.

Authors:  Gonçalo M Leite; Naresh Magan; Ángel Medina
Journal:  J Microbiol Methods       Date:  2012-01-25       Impact factor: 2.363

2.  Microbiological and SYBR green real-time PCR detection of major Fusarium head blight pathogens on wheat ears.

Authors:  M Moradi; E C Oerke; U Steiner; D Tesfaye; K Schellander; H-W Dehne
Journal:  Mikrobiologiia       Date:  2010 Sep-Oct

Review 3.  Genome evolution in filamentous plant pathogens: why bigger can be better.

Authors:  Sylvain Raffaele; Sophien Kamoun
Journal:  Nat Rev Microbiol       Date:  2012-05-08       Impact factor: 60.633

4.  Evidence for a reversible drought induced shift in the species composition of mycotoxin producing Fusarium head blight pathogens isolated from symptomatic wheat heads.

Authors:  Marco Beyer; Friederike Pogoda; Marine Pallez; Joëlle Lazic; Lucien Hoffmann; Matias Pasquali
Journal:  Int J Food Microbiol       Date:  2014-05-14       Impact factor: 5.277

Review 5.  Fusarium culmorum: causal agent of foot and root rot and head blight on wheat.

Authors:  Barbara Scherm; Virgilio Balmas; Francesca Spanu; Giovanna Pani; Giovanna Delogu; Matias Pasquali; Quirico Migheli
Journal:  Mol Plant Pathol       Date:  2012-12-28       Impact factor: 5.663

6.  Trichothecene chemotypes of Fusarium culmorum infecting wheat in Tunisia.

Authors:  Lobna Gargouri Kammoun; Samia Gargouri; Christian Barreau; Florence Richard-Forget; Mohamed Rabeh Hajlaoui
Journal:  Int J Food Microbiol       Date:  2010-02-04       Impact factor: 5.277

7.  Fusarium head blight and associated mycotoxin occurrence on winter wheat in Luxembourg in 2007/2008.

Authors:  Frédéric Giraud; Matias Pasquali; Moussa El Jarroudi; Carine Vrancken; Céline Brochot; Emmanuelle Cocco; Lucien Hoffmann; Philippe Delfosse; Torsten Bohn
Journal:  Food Addit Contam Part A Chem Anal Control Expo Risk Assess       Date:  2010-06

8.  Development of an FgMito assay: A highly sensitive mitochondrial based qPCR assay for quantification of Fusarium graminearum sensu stricto.

Authors:  Tomasz Kulik; Anna Ostrowska; Maciej Buśko; Matias Pasquali; Marco Beyer; Sebastian Stenglein; Dariusz Załuski; Jakub Sawicki; Kinga Treder; Juliusz Perkowski
Journal:  Int J Food Microbiol       Date:  2015-06-12       Impact factor: 5.277

9.  Fusarium graminearum forms mycotoxin producing infection structures on wheat.

Authors:  Marike J Boenisch; Wilhelm Schäfer
Journal:  BMC Plant Biol       Date:  2011-07-28       Impact factor: 4.215

10.  A European Database of Fusarium graminearum and F. culmorum Trichothecene Genotypes.

Authors:  Matias Pasquali; Marco Beyer; Antonio Logrieco; Kris Audenaert; Virgilio Balmas; Ryan Basler; Anne-Laure Boutigny; Jana Chrpová; Elżbieta Czembor; Tatiana Gagkaeva; María T González-Jaén; Ingerd S Hofgaard; Nagehan D Köycü; Lucien Hoffmann; Jelena Lević; Patricia Marin; Thomas Miedaner; Quirico Migheli; Antonio Moretti; Marina E H Müller; Françoise Munaut; Päivi Parikka; Marine Pallez-Barthel; Jonathan Piec; Jonathan Scauflaire; Barbara Scherm; Slavica Stanković; Ulf Thrane; Silvio Uhlig; Adriaan Vanheule; Tapani Yli-Mattila; Susanne Vogelgsang
Journal:  Front Microbiol       Date:  2016-04-06       Impact factor: 5.640

View more
  8 in total

1.  Diversity of Mobile Genetic Elements in the Mitogenomes of Closely Related Fusarium culmorum and F. graminearum sensu stricto Strains and Its Implication for Diagnostic Purposes.

Authors:  Tomasz Kulik; Balazs Brankovics; Anne D van Diepeningen; Katarzyna Bilska; Maciej Żelechowski; Kamil Myszczyński; Tomasz Molcan; Alexander Stakheev; Sebastian Stenglein; Marco Beyer; Matias Pasquali; Jakub Sawicki; Joanna Wyrȩbek; Anna Baturo-Cieśniewska
Journal:  Front Microbiol       Date:  2020-05-25       Impact factor: 5.640

2.  Editorial: The Significance of Mitogenomics in Mycology.

Authors:  Tomasz Kulik; Anne D Van Diepeningen; Georg Hausner
Journal:  Front Microbiol       Date:  2021-01-07       Impact factor: 5.640

Review 3.  Recent Advances in Molecular Diagnostics of Fungal Plant Pathogens: A Mini Review.

Authors:  Ganeshamoorthy Hariharan; Kandeeparoopan Prasannath
Journal:  Front Cell Infect Microbiol       Date:  2021-01-11       Impact factor: 5.293

4.  Species Composition and Trichothecene Genotype Profiling of Fusarium Field Isolates Recovered from Wheat in Poland.

Authors:  Katarzyna Bilska; Sebastian Jurczak; Tomasz Kulik; Ewa Ropelewska; Jacek Olszewski; Maciej Żelechowski; Piotr Zapotoczny
Journal:  Toxins (Basel)       Date:  2018-08-10       Impact factor: 4.546

5.  A Preliminary Survey of Cultured Fusaria from Symptomatic Legume Grains in North-Eastern Poland.

Authors:  Maciej Żelechowski; Jacek Olszewski; Tomasz Kulik
Journal:  Toxins (Basel)       Date:  2019-09-29       Impact factor: 4.546

Review 6.  Promising Perspectives for Detection, Identification, and Quantification of Plant Pathogenic Fungi and Oomycetes through Targeting Mitochondrial DNA.

Authors:  Tomasz Kulik; Katarzyna Bilska; Maciej Żelechowski
Journal:  Int J Mol Sci       Date:  2020-04-10       Impact factor: 5.923

7.  Investigating Useful Properties of Four Streptomyces Strains Active against Fusarium graminearum Growth and Deoxynivalenol Production on Wheat Grains by qPCR.

Authors:  Elena Maria Colombo; Andrea Kunova; Claudio Gardana; Cristina Pizzatti; Paolo Simonetti; Paolo Cortesi; Marco Saracchi; Matias Pasquali
Journal:  Toxins (Basel)       Date:  2020-08-31       Impact factor: 4.546

8.  Patterns of Diversity of Fusarium Fungi Contaminating Soybean Grains.

Authors:  Maciej Żelechowski; Tomasz Molcan; Katarzyna Bilska; Kamil Myszczyński; Jacek Olszewski; Krzysztof Karpiesiuk; Joanna Wyrębek; Tomasz Kulik
Journal:  Toxins (Basel)       Date:  2021-12-10       Impact factor: 4.546

  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.