Literature DB >> 2985828

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

T A Casey, W T Ruyechan, M N Flora, W Reinhold, S E Straus, J Hay.   

Abstract

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

Entities:  

Mesh：

Substances：

Year:  1985        PMID： 2985828      PMCID： PMC254841     

Source DB:  PubMed          Journal:  J Virol        ISSN： 0022-538X            Impact factor:   5.103


  19 in total

1.  DNA of Epstein-Barr virus. III. Identification of restriction enzyme fragments that contain DNA sequences which differ among strains of Epstein-Barr virus.

Authors:  N Raab-Traub; R Pritchett; E Kieff
Journal:  J Virol       Date:  1978-08       Impact factor: 5.103

2.  Restriction endonuclease fingerprinting of herpes simplex virus DNA: a novel epidemiological tool applied to a nosocomial outbreak.

Authors:  T G Buchman; B Roizman; G Adams; B H Stover
Journal:  J Infect Dis       Date:  1978-10       Impact factor: 5.226

3.  A new method for sequencing DNA.

Authors:  A M Maxam; W Gilbert
Journal:  Proc Natl Acad Sci U S A       Date:  1977-02       Impact factor: 11.205

4.  Extraction of nucleic acids from agarose gels.

Authors:  J Langridge; P Langridge; P L Bergquist
Journal:  Anal Biochem       Date:  1980-04       Impact factor: 3.365

5.  Nucleotide sequences of the joint between the L and S segments of herpes simplex virus types 1 and 2.

Authors:  A J Davison; N M Wilkie
Journal:  J Gen Virol       Date:  1981-08       Impact factor: 3.891

6.  XbaI, PstI, and BglII restriction enzyme maps of the two orientations of the varicella-zoster virus genome.

Authors:  A M Dumas; J L Geelen; M W Weststrate; P Wertheim; J van der Noordaa
Journal:  J Virol       Date:  1981-08       Impact factor: 5.103

7.  BamI, KpnI, and SalI restriction enzyme maps of the DNAs of herpes simplex virus strains Justin and F: occurrence of heterogeneities in defined regions of the viral DNA.

Authors:  H Locker; N Frenkel
Journal:  J Virol       Date:  1979-11       Impact factor: 5.103

8.  The polypeptide and the DNA restriction enzyme profiles of spontaneous isolates of herpes simplex virus type 1 from explants of human trigeminal, superior cervical and vagus ganglia.

Authors:  K G Warren; H Koprowski; D M Lonsdale; S M Brown; J H Subak-Sharpe
Journal:  J Gen Virol       Date:  1979-04       Impact factor: 3.891

9.  Restriction endonuclease analysis of the DNA from varicella-zoster virus: stability of the DNA after passage in vitro.

Authors:  H J Zweerink; D H Morton; L W Stanton; B J Neff
Journal:  J Gen Virol       Date:  1981-07       Impact factor: 3.891

10.  Varicella zoster virus DNA exists as two isomers.

Authors:  J R Ecker; R W Hyman
Journal:  Proc Natl Acad Sci U S A       Date:  1982-01       Impact factor: 11.205
View more
  11 in total

1.  Phylogenetic analysis of varicella-zoster virus: evidence of intercontinental spread of genotypes and recombination.

Authors:  Winsome Barrett Muir; Richard Nichols; Judith Breuer
Journal:  J Virol       Date:  2002-02       Impact factor: 5.103

2.  Complete-genome phylogenetic approach to varicella-zoster virus evolution: genetic divergence and evidence for recombination.

Authors:  Peter Norberg; Jan-Ake Liljeqvist; Tomas Bergström; Scott Sammons; D Scott Schmid; Vladimir N Loparev
Journal:  J Virol       Date:  2006-10       Impact factor: 5.103

3.  Variation of R1 repeated sequence present in open reading frame 11 of varicella-zoster virus strains.

Authors:  H Kinoshita; R Hondo; F Taguchi; Y Yogo
Journal:  J Virol       Date:  1988-03       Impact factor: 5.103

4.  Putative glycoprotein gene of varicella-zoster virus with variable copy numbers of a 42-base-pair repeat sequence has homology to herpes simplex virus glycoprotein C.

Authors:  P R Kinchington; J Remenick; J M Ostrove; S E Straus; W T Ruyechan; J Hay
Journal:  J Virol       Date:  1986-09       Impact factor: 5.103

5.  Mutational analysis of the repeated open reading frames, ORFs 63 and 70 and ORFs 64 and 69, of varicella-zoster virus.

Authors:  M H Sommer; E Zagha; O K Serrano; C C Ku; L Zerboni; A Baiker; R Santos; M Spengler; J Lynch; C Grose; W Ruyechan; J Hay; A M Arvin
Journal:  J Virol       Date:  2001-09       Impact factor: 5.103

6.  Comparative restriction endonuclease analysis of varicella-zoster virus clinical isolates.

Authors:  M Takayama; N Takayama; Y Kameoka; K Hachimori; K Kaneda; M Minamitani
Journal:  Med Microbiol Immunol       Date:  1989       Impact factor: 3.402

7.  Identification of varicella-zoster virus strains by PCR analysis of three repeat elements and a PstI-site-less region.

Authors:  M Takada; T Suzutani; I Yoshida; M Matoba; M Azuma
Journal:  J Clin Microbiol       Date:  1995-03       Impact factor: 5.948

8.  Global identification of three major genotypes of varicella-zoster virus: longitudinal clustering and strategies for genotyping.

Authors:  Vladimir N Loparev; Antonio Gonzalez; Marlene Deleon-Carnes; Graham Tipples; Helmut Fickenscher; Einar G Torfason; D Scott Schmid
Journal:  J Virol       Date:  2004-08       Impact factor: 5.103

9.  Strain variation of R5 direct repeats in the right-hand portion of the long unique segment of varicella-zoster virus DNA.

Authors:  R Hondo; Y Yogo
Journal:  J Virol       Date:  1988-08       Impact factor: 5.103

10.  Molecular characterisation of a hypervariable region downstream of the human alpha-globin gene cluster.

Authors:  A P Jarman; R D Nicholls; D J Weatherall; J B Clegg; D R Higgs
Journal:  EMBO J       Date:  1986-08       Impact factor: 11.598
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.