Wei Zhang1, Xinrui Cai2, Jie Yu3, Xuxiang Lu3, Qiuhai Qian4, Weibin Qian1. 1. Department of Lung Disease, Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan, Shandong 250011, P.R. China. 2. Department of Traditional Chinese Medicine, Shandong Academy of Occupational Health and Occupational Medicine, Shandong Academy of Medical Sciences, Jinan, Shandong 250062, P.R. China. 3. Department of Chinese Internal Medicine, Shandong University of Traditional Chinese Medicine, Jinan, Shandong 250355, P.R. China. 4. Department of Endocrinology, Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Jinan, Shandong 250011, P.R. China.
Abstract
Currently, resistance to tyrosine kinase inhibitors, such as erlotinib, has become a major obstacle for improving the clinical outcome of patients with metastatic and advanced‑stage non-small cell lung cancer (NSCLC). While cell behavior can be modulated by long non-coding RNAs (lncRNAs), the roles of lncRNAs within extracellular vesicles (exosomes) are largely unknown. To this end, in this study, the involvement and regulatory functions of potential lncRNAs wrapped by exosomes during the development of chemoresistance in human NSCLC were investigated. Erlotinib-resistant cell lines were established by grafting HCC827 and HCC4006 cells into mice and which were treated with erlotinib. After one treatment course, xenografted NSCLC cells were isolated and transplanted into nude mice again followed by erlotinib treatment. This process was repeated until 4th generation xenografts were isolated and confirmed to be erlotinib-resistant NSCLC cells. lncRNA microarray assays followed by RT‑qPCR were then performed which identified that lncRNA RP11‑838N2.4 was upregulated in erlotinib-resistant cells when compared to normal NSCLC cells. Furthermore, bioinformatics analysis and chromatin immunoprecipitation revealed that forkhead box protein O1 (FOXO1) could bind to the promoter region of lncRNA RP11‑838N2.4, resulting in its silencing through the recruitment of histone deacetylase. Functional experiments demonstrated that the knockdown of lncRNA RP11‑838N2.4 potently promoted erlotinib-induced cytotoxicity. Furthermore, extracellular lncRNA RP11‑838N2.4 could be incorporated into exosomes and transmitted to sensitive cells, thus disseminating erlotinib resistance. Treatment-sensitive cells with exosomes containing lncRNA RP11‑838N2.4 induced erlotinib resistance, while the knockdown of lncRNA RP11‑838N2.4 abrogated this effect. In addition, the serum expression levels of exosomal lncRNA RP11‑838N2.4 were upregulated in patients exhibiting resistance to erlotinib treatment. On the whole, exosomal lncRNA RP11‑838N2.4 may serve as a therapeutic target for patients with NSCLC.
Currently, resistance to tyrosine kinase inhibitors, such as erlotinib, has become a major obstacle for improving the clinical outcome of patients with metastatic and advanced‑stage non-small cell lung cancer (NSCLC). While cell behavior can be modulated by long non-coding RNAs (lncRNAs), the roles of lncRNAs within extracellular vesicles (exosomes) are largely unknown. To this end, in this study, the involvement and regulatory functions of potential lncRNAs wrapped by exosomes during the development of chemoresistance in humanNSCLC were investigated. Erlotinib-resistant cell lines were established by grafting HCC827 and HCC4006 cells into mice and which were treated with erlotinib. After one treatment course, xenografted NSCLC cells were isolated and transplanted into nude mice again followed by erlotinib treatment. This process was repeated until 4th generation xenografts were isolated and confirmed to be erlotinib-resistant NSCLC cells. lncRNA microarray assays followed by RT‑qPCR were then performed which identified that lncRNA RP11‑838N2.4 was upregulated in erlotinib-resistant cells when compared to normal NSCLC cells. Furthermore, bioinformatics analysis and chromatin immunoprecipitation revealed that forkhead box protein O1 (FOXO1) could bind to the promoter region of lncRNA RP11‑838N2.4, resulting in its silencing through the recruitment of histone deacetylase. Functional experiments demonstrated that the knockdown of lncRNA RP11‑838N2.4 potently promoted erlotinib-induced cytotoxicity. Furthermore, extracellular lncRNA RP11‑838N2.4 could be incorporated into exosomes and transmitted to sensitive cells, thus disseminating erlotinib resistance. Treatment-sensitive cells with exosomes containing lncRNA RP11‑838N2.4 induced erlotinib resistance, while the knockdown of lncRNA RP11‑838N2.4 abrogated this effect. In addition, the serum expression levels of exosomal lncRNA RP11‑838N2.4 were upregulated in patients exhibiting resistance to erlotinib treatment. On the whole, exosomal lncRNA RP11‑838N2.4 may serve as a therapeutic target for patients with NSCLC.
Lung cancer is one of the most malignant cancer types worldwide (1), with a low 5-year survival rate of 16.6% (2). Non-small cell lung cancer (NSCLC) is the predominant form of lung cancer and accounts for the majority of cancer-related mortality worldwide (3). Conventional therapeutic strategies of chemotherapy following surgery exert limited effects for patients with advanced NSCLC (4). A better understanding of the molecular mechanisms underlying NSCLC resistance and the development of personalized therapeutic strategies is urgently required in order to improve the prognosis of patients with NSCLC.Recently, an improved understanding of NSCLC pathogenesis has led to the development of multiple kinase inhibitors, such as erlotinib, one of the known tyrosine kinase inhibitors (TKIs). The targeting the ATP binding site of the intracellular domain of epidermal growth factor receptor (EGFR) by erlotinib has revolutionized the treatment of NSCLC (5). Patients with NSCLC whose tumors harbor sensitizing and driving mutations in EGFR, can benefit from erlotinib treatments. Moreover, there are also 3–15% of patients with NSCLC with wild-type EGFR which respond to erlotinib with a disease control rate (DCR) of 40–60% (6,7). Although erlotinib has been shown to improve the prognosis of patients with NSCLC in large randomized phase III studies, the majority of these patients have erlotinib-refractory disease, and thus acquire chemoresistance and suffer from cancer progression within 6–15 months of therapy (8). Therefore, there is an urgent need to elucidate the mechanisms of erlotinib resistance and to discover reliable biological targets that play important role in erlotinib resistance.With the advanced development of whole genome and transcriptome sequencing technologies and the ENCODE project (9), it is widely accepted that the majority of genomic DNA is represented in processed transcripts lacking protein coding ability (10). Long non-coding RNAs (lncRNAs) are a group of non-coding RNAs (ncRNAs) containing >200 nucleotides, which have recently been found to play important regulatory role in various diseases (11). In recent years, emerging evidence indicates that they play important roles in regulating cellular and biological functions, for example, by controlling gene expression at the post-transcriptional level via sponging microRNAs (miRNAs or miRs) (12) and modulating transcriptional gene activation or silencing via epigenetic regulation (13). However, lncRNA RP11-838N2.4 (ENST00000581442), which is located on chromosome 18: 3466247-3478925, has been rarely reported.Recently, increasing evidence suggests that cells may also communicate via other mechanisms in addition to these known methods, including the exchange of cellular fragments, membranes or specialized organelles, such as microvesicles, which until recently were regarded as cellular debris (14). Exosomes, which are membrane-derived vesicles that originate from endosomal multivesicular bodies, have a size range of 20–150 nm when released into the interstitial fluid. These vesicles contain protein, lipids, coding or ncRNAs derived from their donor cell cytoplasm (15) and can be taken up by other cells. Recently, some studies have suggested that exosomes from stromal cells can potentially affect the therapeutic response though the transfer of proteins and lncRNAs (16). However, whether exosomes derived from resistant cancer cells can confer drug resistance to sensitive cells still needs to be elucidated.In this study, we investigated the contributions of exosome-transmitted lncRNA to erlotinib resistance and explored the therapeutic implications for patients with NSCLC. Our results identified the involvement of lncRNA RP11-838N2.4 in the modulation of chemotherapeutic responses by tumor cell extracellular exosome. These results suggest that exosomal lncRNA RP11-838N2.4 may be a novel target for the treatment of NSCLC.
Materials and methods
Clinical samples
In total, 78 serum samples were collected from patients with NSCLC [male/female ratio, 53/25; range of age, 41–70 (median age, 56)] who received erlotinib treatment at the Affiliated Hospital of Shandong University of Traditional Chinese Medicine (Jinan, China) between January, 2011 and June, 2014. In brief, 5 ml of venous blood from each participant was collected via venous puncture prior to the commencement of chemotherapy. Serum was segregated via a centrifugation at 1,600 × g for 10 min at room temperature within 2 h after collection, followed by a second centrifugation at 12,000 × g for 10 min at 4°C to remove the residual cellular debris. Each serum supernatant was transferred into RNase-free tubes and stored at −80°C until use. The patients were divided into the responding (CR + PR, 43 patients) and non-responding (SD + PD, 35 patients) groups according to the Response Evaluation Criteria In Solid Tumors (RECIST) (version 1.1) (17). Written informed consent was obtained from each participant prior to blood collection. The study protocol was approved by the Clinical Research Ethics Committee of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine.Stability testing of exosomal lncRNAs in serum was performed by exposing the serum to different conditions, including incubation at room temperature for 0, 3, 6, 12 and 24 h, RNase A digestion and low (pH 1.0) or high (pH 13.0) pH solution for 3 h at room temperature followed by RT-qPCR determination of RP11-838N2.4 expression.
Cells and cell culture
The humanNSCLC cell lines, HCC827 and HCC4006, which harbor EGFR-activating mutations (18,19), were purchased from the Chinese Academy of Sciences (Shanghai, China). Both cell lines were cultured in RPMI-1640 medium (BioWhittaker; Lonza, Walkersville, MD, USA) supplemented with 10 mM HEPES, 1 mM L-glutamine, 100 U/ml penicillin/streptomycin (BioWittaker; Lonza) and heat-inactivated 10% fetal bovine serum (FBS; Gibco/Invitrogen Inc., Carlsbad, CA, USA) at 37°C in a humidified incubator with 5% CO2.
Reagents and treatments
Trichostatin A (TsA), RNase A and Triton X-100 were purchased from Qiagen (Waltham, MA, USA). The cells were treated with TsA for 24 h at the concentration of 2.5 nM followed by the detection of RP11-838N2.4. Rnase A were used at a working concentration of 20 µg/ml for 1 h followed by the determination of changes in the expression of lncRNA RP11-838N2.4. Triton X-100 was used at a volume ratio of 0.1% for 20 min to test the existence of vesicles.
Establishment of NSCLC erlotinib-resistant cell lines
The HCC827 and HCC4006 cells were used for the construction of erlotinib-resistant cells. Erlotinib (s1023) was purchased from Selleckchem (Houston, TX, USA). A total of 32 male BALB/C nude mice (6 weeks of age with a median weight of 17.8 g) were purchased from the Shanghai SIPPR-BK Laboratory Animal Co. Ltd. (Shanghai, China) and maintained in microisolator cages. Briefly, 32 mice were used for 4 passages of cell injection, and 8 mice were used for each passage of cells. For each passage, 4 mice were used for the construction of erlotinib-resistant HCC827 cells (HCC827/R), including 2 mice treated free of erlotinib (control) and 2 mice treated with erlotinib; the other 4 mice were used for the construction of erlotinib-resistant HCC4006 cells (HCC4006/R), including 2 mice treated free of erlotinib (control) and 2 mice treated with erlotinib. The mice were housed in a facility under controlled pathogen-free conditions at a temperature of 28°C, 50% humidity and were fed ad libitum with sterile chow food and water. All surgeries were performed under sodium pentobarbital anesthesia via intraperitoneal injection (75 mg/kg) and all efforts were made to minimize suffering. The research protocol was approved by the Shandong University of Traditional Chinese Medicine Committee on Ethics regarding the Care and Use of Laboratory Animals. Xenograft tumor volumes were evaluated by caliper measurements of two perpendicular diameters and calculated using the following formula: Volume = a x b2/2 ('a' represents length and 'b' represents width). In order to obtain erlotinib-resistant NSCLC cells, 5×106 HCC827 or HCC4006 cells were injected subcutaneously into the flanks of nude mice. When the volume of the xenografts reached 200 mm3, the mice were orally treated with erlotinib (40 mg/kg/day) following a standard schedule of 4 weeks on and 2 weeks off treatment. After one treatment course, the xenografted NSCLC cells were isolated and transplanted into nude mice again followed by erlotinib treatment. NSCLC cells from the 4th generation xenografts were isolated and confirmed to be erlotinib-resistant NSCLC cells. The volume of the 4th generation xenografts following erlotinib treatment was ~150 mm3 and ~500 mm3 for the control treatment. The established erlotinib-resistant cells were named HCC827/R and HCC4006/R respectively, while the original HCC827 and HCC4006 cells were parental cells.
Exosome isolation, labeling and RNA extraction
Exosomes were extracted from the NSCLC cell culture medium or serum samples using the ExoQuick precipitation kit (SBI; System Biosciences, Mountain View, CA, USA) according to the manufacturer's instructions. Briefly, the culture medium or serum was thawed on ice and centrifuged at 3,000 × g for 15 min to remove cells and cell debris. Subsequently, 250 µl of the supernatant was mixed with 63 µl of the ExoQuick precipitation kit and incubated at 4°C for 30 min following a brief up- and -down mix, followed by centrifugation at 1,500 × g for 30 min. The supernatant was then removed by careful aspiration, followed by another 5 min of centrifugation at 1,500 × g to remove the residual liquid. The exosome-containing pellet was subsequently re-suspended in 250 µl phosphate-buffered saline (PBS). The final pellets, containing exosomes, were collected for RNA isolation. Size distribution of exosomes was analyzed by Zetasizer (Malvern Panalytical Ltd., Malvern, UK). Purified exosomes were labeled with PKH26 Red Fluorescent Cell Linker kit for General Cell Membrane Labeling (Sigma-Aldrich, St. Louis, MO, USA) as per the manufacturer's instructions.The extraction of RNA from the exosomes was performed using the commercial miRNeasy Serum/Plasma kit (Qiagen), and RNA extraction from the cell fraction was performed using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. All RNA elution steps were carried out at 12,000 × g for 15 sec, and the RNA was finally eluted in 15 µl RNase-free ultra-pure water.
Transmission electron microscopy (TEM)
The exosome pellets were re-suspended in 50 µl PBS and a drop of the suspension was placed on a sheet of parafilm. A carbon-coated copper grid was floated on the drop for 5 min at room temperature. The grid was then removed and excess liquid was drained by touching the grid edge against a piece of clean filter paper. The grid was then placed onto a drop of 2% phosphotungstic acid with pH 7.0 for ~5 sec, and the excess liquid was drained off. The grid was allowed to dry for several minutes and then examined using a JEM-1200 EX microscope (Jeol, Akishima, Japan) at 80 kilo electron volts.
Total RNA was isolated from the serum samples or cell lines using TRIzol reagent (Invitrogen). The RNA was then reverse transcribed into cDNA using the SuperScript III® (Invitrogen) and then amplified by RT-qPCR based on the TaqMan method on a Bio-Rad CFX96 Sequence Detection system (Bio-Rad, Berkeley, CA, USA) (20). The thermocy-cling condition was 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. The gene expression levels were normalized to GAPDH expression. The RT-qPCR results were analyzed and expressed as ΔΔCq (21). All the primer sequences were synthesized by RiboBio (Guangzhou, China) and their sequences are listed in Table I.
Table I
The sequences of the primers used in RT-qPCR and the siRNA sequences.
RT-qPCR primer name
Primer sequence (5′-3′)
RP11-838N2.4 (Forward)
GTTTCCTGGAAGGGCATTTT
RP11-838N2.4 (Reverse)
TCCAGCTTCTCCTTTTGCA
FOXO1 (Forward)
GTGAAAACTGCGGGGAAAA
FOXO1 (Reverse)
CCCCTGGACATCAGCACA
GAPDH (Forward)
GCACCGTCAAGGCTGAGAAC
GAPDH (Reverse)
ATGGTGGTGAAGACGCCAGT
siRNA name
siRNA sequence (5′-3′)
RP11-838N2.4 sense
GCAAAUGAAAGCUACCAAU
RP11-838N2.4 antisense
AUUGGUAGCUUUCAUUUGC
ENST00000424980 sense
GCACAAUAUCUUUGAACUA
ENST00000424980 antisense
UAGUUCAAAGAUAUUGUGC
ENST00000430635 sense
CUAGAAUCCUAAAGGCAAA
ENST00000430635 antisense
UUUGCCUUUAGGAUUCUAG
ENST00000412816 sense
GCTGCTTTCTCGCTTGCT
ENST00000412816 antisense
CCAGGGTCCTTGGTCTCA
ENST00000548172 sense
CCCATGTCGAGCAGGAAG
ENST00000548172 antisense
TGGTGGTTTAGCCAAAGAAT
ENST00000413504 sense
GCTGCCTTCCTTTACCTTC
ENST00000413504 antisense
GCATGGGAGACAGAGTTCTT
NC sense
UUCUCCGAACGUGUCACGUTT
NC antisense
ACGUGACACGUUCGGAGAATT
RNA oligoribonucleotides and cell transfection
Small interfering RNA against lncRNAs and negative control siRNA were synthesized by GenePharma (Shanghai, China). Constitutive active FOXO1-A3 reagent was purchased from Invitrogen. The NSCLC cells were plated at 5×104 cells/well in 24-well plates ~24 h prior to transfection. After the cells reached 30–50% confluence, transfection was carried out using Lipofectamine 3000 (Invitrogen) following the manufacturer's instructions. Transfection efficiency was evaluated in each experiment by RT-qPCR 24 h later to ensure that the cells were actually transfected. Functional experiments were then performed after sufficient transfection for 48 h. The siRNA sequences are presented in Table I.
Microarray analysis
RNA expression profiling was performed using the Agilent human lncRNA microarray V.2.0 platform (GPL18109; Agilent Technologies, Santa Clara, CA, USA). Quantile normalization and subsequent data processing were performed using Agilent Gene Spring Software 11.5. Heatmaps representing differentially regulated genes were generated using Cluster software (version 3.0) (22). The microarray analysis was performed by Beijing Genomics Institute/HuaDa-Shenzhen (Shenzhen, China).
Bioinformatics analysis
The online database of transcription factor binding profiles JASPAR (http://jaspar.genereg.net/) was used for prediction of potential transcription factor binding to the promoter region of RP11-838N2.4.
Cell viability assay
Alterations in cell viability following transfection or erlotinib treatment was assayed using the CCK8 kit (Dojindo, Rockville, MD, USA). In brief, the NSCLC cell lines were seeded into a 96-well plate in triplicate and then treated with si-RP11-838N2.4 or si-NC for different periods of time. The cell cultures were then treated with CCK8 reagent and further cultured for 2 h. The optical density at 450 nm was measured using a spectrophotometer (Thermo Electron Corp., Beverly, MA, USA). The percentage of the control samples of each cell line was calculated thereafter.
Fluorescence in situ hybridization analysis (FISH)
Nuclear and cytosolic fraction separation was performed using a PARIS kit (Life Technologies/Thermo Fisher Scientific, Waltham, MA, USA), and RNA FISH probes were designed and synthesized by RiboBio (Guangzhou, China) according to the manufacturer's instructions. Briefly, the cells were fixed in 4% formaldehyde for 15 min and then washed with PBS. The fixed cells were treated with pepsin and dehydrated through ethanol. The air-dried cells were incubated further with 40 nM of the FISH probe in hybridization buffer. Following hybridization, the slide was washed, dehydrated and mounted with Prolong Gold Antifade Reagent with DAPI for detection. The slides were visualized for immunofluorescence with an Olympus fluorescence microscope (IX73; Olympus Corp., Tokyo, Japan).
Chromatin immunoprecipitation (ChIP)
ChIP was performed using the EZ ChIPTM Chromatin Immunoprecipitation kit (Millipore, Burlington, MA, USA) according to the manufacturer's instructions. Briefly, cross-linked chromatin was sonicated into 200–1,000 bp fragments. The chromatin was immunoprecipitated using anti-FOXO1 antibodies (#2880, 1:1,000; Cell Signaling Technology, Beverly, MA, USA). RT-qPCR was conducted to detect the relative enrichment according to the method described above.
Western blot analysis
Cell lysates were prepared with RIPA buffer containing protease inhibitors (Sigma, St. Louis, MO, USA). Protein concentrations were measured with the BCA Protein Assay kit according to the manufacturer's instructions (Beyotime Institute of Biotechnology, Shanghai, China). Equal amounts of protein (25 µg) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA). The membranes were then blocked with 5% (5 g/100 ml) non-fat dry milk in Tris-buffered saline plus Tween (TBS-T) buffer for 2 h at room temperature. The membranes were incubated overnight at 4°C with a 1:1,000 solution of antibodies: Anti-FOXO1 (#2880, 1:1,000, Cell Signaling Technology), anti-cleaved PARP (#5625, 1:1,000, Cell Signaling Technology), anti-cleaved caspase3 (#9664, 1:1,000, Cell Signaling Technology), anti-CD9 (#13403, 1:1,000, Cell Signaling Technology) and anti-β-actin (#4970, 1:1,000, Cell Signaling Technology). The horseradish peroxidase-conjugated (HRP) anti-rabbit antibody (#7074, 1:5,000, Cell Signaling Technology) was used as secondary antibody for immunostaining for 1 h at room temperature.
Statistical analysis
The Mann-Whitney U test, or Kruskal-Wallis test (post hoc Mann-Whitney U test with Bonferroni's correction) was used for evaluating the differences among clinical cohort groups or cell groups. Receiver operating characteristic (ROC) curves and the area under the curve (AUC) were established to discriminate patients with NSCLC responding to treatment from those not responding using MedCalc (MedCalc Software bvba, Ostend, Belgium). Count dates were described as frequency and examined using Fisher's exact test. All statistical analyses were performed with SPSS software (version 17.0, SPSS Incorporation, Chicago, IL, USA). The package plots and function heatmap in R software were used for mapping. Error bars in figures represent the means ± standard deviation (SD). The results were considered statistically significant at P<0.05.
Results
lncRNA RP11-838N2.4 is upregulated in erlotinib-resistant NSCLC cells
To identify the potential lncRNAs that regulate erlotinib resistance in NSCLC, we established erlotinib-resistant cell lines. HCC827 and HCC4006 cells are known to be sensitive to erlotinib treatment, as they harbor EGFR activating mutations in the tyrosine kinase domain, precisely in exon 19. To obtain erlotinib-resistant cells, we grafted HCC827 and HCC4006 cells into nude mice and performed cycles of erlotinib treatment along with serial passaging in vivo (Fig. 1A). NSCLC xenografts from the 4th passage exhibited a poor response to erlotinib treatment. Resistant NSCLC cells were isolated from these xenografts and termed HCC827/R and HCC4006/R cells, respectively. As shown in Fig. 1B, both erlotinib-resistant cells exhibited specific morphological changes, including loss of cell polarity causing a spindle-cell morphology, increased intercellular separation signifying the loss of intercellular adhesion and the increased formation of pseudopodia. Compared with the parental cells, these established resistant cells were less responsive to erlotinib treatment, as evidenced by increased IC50 values and an enhanced cell viability (Fig. 1C and D).
Figure 1
Identification of the upregulation of lncRNA RP11-838N2.4. Schematic presentation of the establishment of erlotinib-resistant cell lines. The yellow-marked images in mice of passage 1 or the control group illustrate the parental NSCLC cells which are sensitive to erlotinib, and the red-marked images illustrate the cells that are becoming resistant following continuous treatment with erlotinib at advanced passages. (B) The erlotinib-resistant cell lines, HCC827/R and HCC4006/R, exhibited specific morphological changes. (C) The IC50 value of erlotinib was detected for both sensitive and resistant cells by cell viability assay. (D) The cell viability of both erlotinib-resistant and sensitive cells was also detected. (E) lncRNA microarray data of erlotinib-resistant and parental cells are presented in a heatmap. (F) Determination of IC50 values of erlotinib for both erlotinib-resistant cell lines cells following transfection with various siRNAs. ***P<0.001 compared to Ctrl siRNA.
By using the parental and erlotinib-resistant cell lines, we performed an lncRNA microarray assay to identify the dysregulated lncRNAs between them. The heatmap created revealed significant differentially expressed lncRNAs between the NSCLC parental and resistant cell lines (Fig. 1E), which were then subjected to validation by RT-qPCR using sensitive and resistant NSCLC cells. From the 6 upregulated lncRNAs validated in the first round of experiments (Table II), we validated that the interference of lncRNA RP11-838N2.4 (ENST00000581442) reversed erlotinib resistance in erlotinib-resistant cells, while the other 5 lncRNAs exerted minimal effects (Fig. 1F). Therefore, we focused on the functional role of lncRP11-838N2.4 in this study.
Table II
Fold change of deregulated lncRNAs between erlotinib-resistant cells and parental cells.
lncRNA
Average fold change in HCC827R/HCC827 cells
Average fold change in HCC4006R/HCC4006 cells
ENST00000581442
6.08
1.69
ENST00000424980
5.88
3.02
ENST00000430635
4.76
3.35
ENST00000412816
2.58
3.05
ENST00000548172
3.59
2.39
ENST00000413504
3.77
2.43
lncRP11-838N2.4 is regulated by FOXO1 in erlotinib-resistant cells
Increasing evidence has revealed that several key transcription factors contribute to lncRNA dysregulation in the humancancer cells (23,24). We then sought to determine whether the dysregulation of lncRNA RP11-838N2.4 in erlotinib-resistant cells is due to the activation or silencing of upstream factors. Three DNA binding elements at the promoter region of lncRNA RP11-838N2.4 were predicted for FOXO1 by JASPAR (Fig. 2A). RT-qPCR and western blot analysis revealed that FOXO1 expression was downregulated in erlotinib-resistant cells when compared with the parental cells at both the transcript and protein levels (Fig. 2B). Consistently, immunofluorescence assay revealed that FOXO1 was less enriched in the nucleus of HCC827 erlotinib-resistant NSCLC cells in contrast to the parental cells (Fig. 2C). Moreover, constitutively active FOXO1-A3 markedly inhibited the lncRNA RP11-838N2.4 expression levels in both erlotinib-resistant cells (Fig. 2D). Previously, FOXO1 has been reported to act as a transcription inhibitor by recruiting histone deacetylase (25). Thus, we then investigated whether FOXO1 functions in a similar manner. As expected, treatment with TsA, a well-known histone deacetylase inhibitor, abrogated the effects of FOXO1 (Fig. 2E). We also performed ChIP assay to further verify the enrichment of FOXO1 at the promoter region of lncRNA RP11-838N24. As expected, FOXO1 was enriched and the enrichment was significantly depressed in the HCC827/R cells (Fig. 2F). Taken together, these results identified that lncRNA RP11-838N2.4 was inactivated by FOXO1 in erlotinib-resistant cell lines.
Figure 2
lncRNA RP11-838N2.4 is negatively regulated by FOXO1. (A) FOXO1 binding site prediction in the lncRNA RP11-838N2.4 promoter region using JASPAR. (B) FOXO1 mRNA and protein levels were detected by RT-qPCR and western blot analysis, respectively, in erlotinib-resistant and parental cell lines. **P<0.01 compared to parental cells. (C) FISH assay revealed a lower enriched level of FOXO1 gene in the nucleus of HCC827/R cells. (D) lncRNA RP11-838N2.4 was detected by RT-qPCR in cells treated with active FOXO1-A3 or the blank controls for 48 h. **P<0.01 compared to blank control. (E) RT-qPCR analysis of lncRP11-838N2.4 in erlotinib-resistant cells after co-treatment of FOXO1-A3 and TsA (100 nM), or FOXO1-A3 and DMSO (control for FOXO1-A3) for 48 h. ***P<0.001 compared to blank control. (F) ChIP assay was performed to detect the relative enrichment of FOXO1 on the promoter region of lncRNA RP11-838N2.4 in both the HCC827 parental and resistant cells. *P<0.05, **P<0.01 compared to parental cells.
lncRNA RP11-838N2.4 is required for the erlotinib resistance of NSCLC cells
To investigate whether lncRP11-838N2.4 is essential for the erlotinib resistance of NSCLC cells, we performed loss-of-function assay. siRNAs against lncRNA cRP11-838N2.4 was synthesized and incorporated into erlotinib-resistant cells. As shown in Fig. 3A, lncRNA RP11-838N2.4 was markedly silenced in both cell lines. Compared with the response of the control group, the silencing of lncRNA RP11-838N2.4 promoted cellular cytotoxicity induced by erlotinib treatment (Fig. 3B). Moreover, the knockdown of lncRNA RP11-838N2.4 induced an increase in the protein expression levels of cleaved PARP (c PARP) and cleaved caspase3 (c caspase-3) following treatment with erlotinib (Fig. 3C). In addition, flow cytometry indicated that lncRNA RP11-838N2.4 silencing significantly promoted the proportion of apoptotic cells following treatment with erlotinib in the two resistant cell lines (Fig. 3D). Collectively, these results suggest that lncRNA RP11-838N2.4 is essential for the development of erlotinib resistance.
Figure 3
lncRNA RP11-838N2.4 is essential for the erlotinib resistance of NSCLC cells. RT-qPCR validation of the silencing effect of lncRNA RP11-838N2.4 following transfection with specific interference silencing RNAs. **P<0.01 compared to si-NC. (B) lncRNA RP11-838N2.4 knockdown promoted apoptosis induced by erlotinib treatment in both erlotinib-resistant cell lines. (C) Western blot analysis was used to evaluate the effects of lncRNA RP11-838N2.4 knockdown on cleaved PARP and caspase-3. (D) Flow cytometry assay for cell apoptosis induced by the knockdown of lncRNA RP11-838N2.4. *P<0.05 compared to si-NC.
Extracellular lncRNA RP11-838N2.4 is transferred through incorporation into exosomes
Exosomes can be actively secreted from a variety of cell types, and lncRNAs contained in exosomes can be secreted into the culture medium (26). In order to investigate whether lncRNA RP11-838N2.4 is secreted through packaging into exosomes, we detected changes in the expression level of lncRNA RP11-838N2.4 following treatment with RNase A. As shown in Fig. 4A, the expression level of lncRNA RP11-838N2.4 in the culture medium was minimally influenced upon RNase treatment; however it was significantly decreased following treatment with RNase and Triton X-100 simultaneously, suggesting that this lncRNA was protected by the membrane instead of being directly secreted. To validate these results, we purified and extracted exosomes from the culture medium. The representative micrograph obtained by TEM revealed vesicles with a round or oval membrane, and a diameter of 20–200 nm by TEM (Fig. 4B). Exosomes with a size ranging from 30–150 nm in diameter accounted for 75%, with the median value was 57.89 nm (Fig. 4C). Western blot analysis further confirmed their identity by enriched exosome proteins, such as CD63 and CD9 (Fig. 4D). Subsequently, we determined whether lncRNA RP11-838N2.4 was incorporated into exosomes. Exosomes were isolated from the culture medium with the ExoQuick purification kit followed by RT-qPCR. As expected, lncRNA RP11-838N2.4 was detectable, and its expression level was significantly higher in the culture medium collected from erlotinib-resistant cells than in the culture medium from the parental cells (Fig. 4E). These findings strongly indicated that extracellular lncRNA RP11-838N2.4 was released by packaging into exosomes.
Figure 4
Extracellular lncRNA RP11-838N2.4 was packaged into exosomes in NSCLC cells. RT-qPCR was performed to detect the expression level of lncRNA RP11-838N2.4 following treatment with 1 µg/ml RNase alone or in combination with 0.1% Triton X-100 for 30 min. *P<0.05, **P<0.01 compared to control group. (B) TEM scanning showed the exosomes images released by the HCC827/R and HCC4006/R cells. (C) Size distribution of exosomes was analyzed by Zetasizer. (D) Exosomal protein markers (CD63 and CD9) detection by western blot analysis from purified exosomes (Exo) and exosome-depleted supernatant (Exo-D). (E) RT-qPCR assay for the expression level of exosomal lncRNA RP11-838N2.4 in both erlotinib-sensitive cell lines. ***P<0.001 compared to parental cells.
Exosome-mediated transfer of lncRNA RP11-838N2.4 induces erlotinib resistance
To identify whether lncRP11-838N2.4 regulates erlotinib resistance through the delivery of exosomes, we proved that lncRNA RP11-838N2.4 contained in exosomes can be taken up by recipient cells using two approaches. Firstly, we examined whether the secreted exosomes could be taken up by recipient cells by labeling isolated exosomes with PKH26 dye from HCC827/R cells. The labeled exosomes were then added and incubated with the HCC827 and HCC4006 parental cells. As shown in Fig. 5A, the majority of the recipient cells exhibited a red signal under a confocal microscope. Secondly, we examined whether these exosomes could deliver lncRNA RP11-838N2.4 to recipient cells similar to the intercellular transfer of other ncRNAs as previously reported (27). RT-qPCR revealed an increased expression of lncRNA RP11-838N2.4 in both recipient cells incubated with exosomes from the HCC827/R cells (Fig. 5B). Thus, we verified that lncRNA RP11-838N2.4 contained in exosomes could be taken by recipient cells.
Figure 5
Exosome-mediated transfer of lncRNA RP11-838N2.4 induces erlotinib resistance. (A) Intercellular trafficking of exosomes among different cell lines by isolated exosomes labeled with PKH26 dye. (B) RT-qPCR assay for the detection of exosomal lncRNA RP11-838N2.4 in cells treated with extracted exosomes or the blank control for 48 h. *P<0.05 compared to blank control group. (C) CCK-8 assay used for the detection of cell viability in the two cell lines following treatment with extracted exosomes or the blank control for 48 h. (D) Knockdown of lncRNA RP11-838N2.4 abrogated the effects induced by exosome treatment as evidenced by CCK-8 assay.
Subsequently, we determined whether the HCC827 and HCC4006 cells with elevated exosomal lncRNA RP11-838N2.4 expression levels exhibit an increased resistance to erlotinib treatment compared with the control cells. As expected, both recipient cell lines exhibited decreased cell death compared with the control cells when treated with erlotinib (Fig. 5C). However, the knockdown of lncRNA RP11-838N2.4 in the parental cells abrogated this effect (Fig. 5D), indicating that the increased erlotinib-resistant potency was induced by treatment with exosomal lncRNA RP11-838N2.4.
Serum exosomal lncRNA RP11-838N2.4 level is upregulated in erlotinib-resistant patients
We attempted to determine the expression level of exosomal lncRNA RP11-838N2.4 in 78 serum samples from patients with advanced NSCLC receiving erlotinib treatment. Patients were divided into the responding (CR + PR, 43 patients) and non-responding (SD + PD, 35 patients) groups according to the Response Evaluation Criteria In Solid Tumors (RECIST) (version 1.1) (17). We found that the serum exosomal lncRNA RP11-838N2.4 level was significantly higher in patients who did not respond to treatment than in those who responded to erlotinib (Fig. 6A). Since a better stability was a critical prerequisite for tumor markers, we then examined the stability of lncRNA RP11-838N2.4 in serum exosomes by exposing exosomes to different conditions, including incubation at room temperature for 0, 3, 6, 12 and 24 h, RNase A digestion, and low (pH 1.0) or high (pH 13.0) pH solution for 3 h at room temperature. Our results revealed that the exosomal lncRNA RP11-838N2.4 expression level was not significantly affected by any of the experimental conditions (Fig. 6B–D), indicating that exosomal lncRNAs were stable in serum exosomes. We then investigated the diagnostic potential of lncRNA RP11-838N2.4 by performing ROC analysis. As shown in Fig. 6E, the AUC, diagnostic sensitivity and specificity reached 0.754, 74.5 and 67.3% with the established cut-offs (0.09), respectively. Under this stratification criteria (0.09), patients were divided into the low and a high lncRNA RP11-838N2.4 expression groups, and the proportion of patients not responding to chemotherapy was significantly higher in the high exosomal lncRNA RP11-838N2.4 expression group than in the low expression group (Fig. 6F). Taken together, serum exosomal lncRNA RP11-838N2.4 was also dysregulated in patients with NSCLC in addition to the in vitro observations. However, further investigations of clinical value are warranted.
Figure 6
Serum exosomal lncRNA RP11-838N2.4 is associated with erlotinib resistance in patients with non-small cell lung cancer (NSCLC). (A) RT-qPCR analysis of lncRNA RP11-838N2.4 in patients responding or not responding to erlotinib treatment. (B-D) The exosomal lncRNA RP11-838N2.4 expression level was not significantly influenced by (B) the exposure time, (C) RNase A digestion or (D) pH values. (E) Receiver operating characteristic (ROC) curve analysis of the diagnostic value of exosomal lncRNA RP11-838N2.4 in patients with NSCLC receiving erlotinib treatment. Arrow indicates the position of cut-off value (0.09). (F) RT-qPCR revealed that the proportion of patients that exhibited resistance to erlotinib therapy was significantly higher in the high lncRNA RP11-838N2.4 expression groups than in the low expression group.
Discussion
Extensive efforts in the past have contributed to the understanding of both the molecular and cellular mechanisms of chemoresistance, one of the major causes for the failure of treatment of advanced cancer types. However, little progress has been made ever since (28). In this study, we established erlotinib-resistant cell lines, and further investigated the functional association between erlotinib resistance and specific lncRNAs. Our data revealed that lncRNA RP11-838N2.4 was inactivated by FOXO1, and was upregulated in erlotinib-resistant cells. More importantly, we revealed that extracellular lncRNA RP11-838N2.4 was transferred through incorporation into exosomes, and exosomal lncRNA RP11-838N2.4 incubation promoted the erlotinib resistance of parental cells. Clinically, the serum exosomal lncRNA RP11-838N2.4 level was associated with erlotinib response in patients with NSCLC.EGFR is critical in proliferation and survival pathways, and activating mutations are often observed in NSCLC (29). EGFR mutations occur more frequently in Asian patients compared with Caucasian patients (30,31). Erlotinib, the second EGFR TKI evaluated in NSCLC, was approved by the FDA in November, 2004 based on the results of the BR.21 trial conducted by the National Cancer Institute of Canada Clinical Trials Group. Erlotinib has exhibited efficacy as a second-/third-line treatment for advanced NSCLC, and superior first-line efficacy versus chemotherapy in EGFR mutation-positive disease (32–34). However, acquired resistance, defined as progression after initial benefits are observed, to targeted therapies inevitably occurs (35). Therefore, breakthroughs are required in the understanding and treatment of acquired erlotinib resistance in NSCLC, particularly for patients with EGFR mutant and ALK rearrangement-positive sites. In this study, we established two erlotinib-resistant NSCLC cell lines, which exhibited specific morphological changes, including the loss of cell polarity, increased intercellular separation, and increased formation of pseudopodia. These changes strongly indicate that chemoresistant cells undergo an epithelial-mesenchymal transition (EMT) process. Previous studies have also demonstrated that cancer cells with aquired chronic chemoresistance undergo EMT in various cancer types (36–38). Thus, the role of lncRNA RP11-838N2.4 in erlotinib-induced EMT warrants further investigation in our subsequent studies.Exosomes are nano-sized vesicles released upon the fusion of multivesicular bodies with plasma membranes in a variety of mammalian cells (39). In fact, exosomes exist extensively in body fluids, such as blood, urine, ascites and amnionic fluid. Exosomes consist of lipid bilayer membranes and numerous molecular constituents of their original cells, including proteins and nucleic acids (40). They have been described as a means of communication between tumor cells and other cell types, through the transfer of constituents, such as lncRNAs (41). lncRNAs have gained marked attention in recent years due to their aberrant expression in a wide range of cancers and their multiple roles in cancer progression, invasion and resistance. lncRNAs can act as activators or inhibitors to participate in a variety of biological processes via interacting with DNAs, mRNAs, miRNAs or proteins (42). lncRNAs can be protected by exosomes from degradation in the circulation and can be useful for monitoring cancer at the early stage (43,44). Therefore, in this study, we performed microarray analysis to identify the potential dysregulated lncRNAs in erlotinib-resistant cells in contrast to the parental NSCLC cell lines. By using two-step approaches, we finally identified lncRNA RP11-838N2.4 as a potential lncRNA participating in erlotinib resistance. Moreover, our integrated research also revealed that this lncRNA can be packaged into exosomes when released into the extracellular culture medium. A previous study by Liu et al demonstrated that lncRNA RP11-838N2.4 enhanced the cytotoxic effects of temozolomide and reversed temozolomide resistance in glioma cells (45). This suggests that lncRNA RP11-838N2.4 may be an active regulator during the formation of chemoresistance, which is consistent with our conclusion. Other 5 potential preliminary identified lncRNAs, which have not been previously reported, were excluded as they exhibited minimal effects on erlotinib resistance.We also verified whether lncRNA RP11-838N2.4 was incorporated into exosomes, and whether these exosomes containing lncRNA RP11-838N2.4 could mediate erlotinib resistance. Its expression in the culture medium was minimally influenced by the treatment with RNase alone, but was markedly suppressed following treatment with RNase and Triton X-100 simultaneously, suggesting that this lncRNA was contained in vesicles, such as exosomes. Moreover, cDNA detection with RT-qPCR from the extracted exosomes in the culture medium revealed that the epxression lncRNA RP11-838N2.4 was detectable and markedly increased in the culture medium of erlotinib-resistant cells. Treatment of the parental cells with exosomes containing lncRNA RP11-838N2.4 induced an enhanced erlotinib resistance. To conclude, lncRNA RP11-838N2.4 participated in the development of resistance to erlotinib through exosome-mediated transfer. Moreover, we should state that the two NSCLC cell lines, HCC827 and HCC4006, were inconsistent used for some experimental validation, which is a limitation of our work.Based on the functional observations, we then determined the exosomal lncRNA RP11-838N2.4 level in clinical serum samples. Several attempts have been made to use lncRNAs in serum or plasma as useful predictors in NSCLC (46,47). Nevertheless, these potential tumor biomarkers are often found in relatively low abundance and are impeded by the complexity of bodily fluids. The release of exosomes into the extracellular space affords an opportunity to examine exosomes in body fluids, such as blood and urine. Most importantly, exosomes contain nucleic acids and proteins, reflecting the characteristics of cancer cells, which provides us with the development of highly sensitive diagnostic strategies in a non-invasive manner (48). Emerging evidence has uncovered the unique properties of exosomes, including their ability to embed specific lncRNAs, their stability and easy detection in the circulatory system (49,50). As expected, our data clearly indicated that the exosomal lncRNA RP11-838N2.4 level was upregulated in erlotinib-resistant patients, and was associated with erlotinib response.In conclusion, the findings of this study suggested that the exosome-mediated transfer of lncRNA RP11-838N2.4 induced erlotinib resistance in NSCLC cells. Therefore, lncRNA RP11-838N2.4 can act as a potential therapeutic target which may be used to overcome erlotinib resistance, thus enhancing the clinical benefits of erlotinib therapy in patients with NSCLC.
Authors: David S Ettinger; Wallace Akerley; Gerold Bepler; Matthew G Blum; Andrew Chang; Richard T Cheney; Lucian R Chirieac; Thomas A D'Amico; Todd L Demmy; Apar Kishor P Ganti; Ramaswamy Govindan; Frederic W Grannis; Thierry Jahan; Mohammad Jahanzeb; David H Johnson; Anne Kessinger; Ritsuko Komaki; Feng-Ming Kong; Mark G Kris; Lee M Krug; Quynh-Thu Le; Inga T Lennes; Renato Martins; Janis O'Malley; Raymond U Osarogiagbon; Gregory A Otterson; Jyoti D Patel; Katherine M Pisters; Karen Reckamp; Gregory J Riely; Eric Rohren; George R Simon; Scott J Swanson; Douglas E Wood; Stephen C Yang Journal: J Natl Compr Canc Netw Date: 2010-07 Impact factor: 11.908
Authors: Anthony D Yang; Fan Fan; E Ramsay Camp; George van Buren; Wenbiao Liu; Ray Somcio; Michael J Gray; Haiyun Cheng; Paulo M Hoff; Lee M Ellis Journal: Clin Cancer Res Date: 2006-07-15 Impact factor: 12.531
Authors: Rafael Rosell; Teresa Moran; Cristina Queralt; Rut Porta; Felipe Cardenal; Carlos Camps; Margarita Majem; Guillermo Lopez-Vivanco; Dolores Isla; Mariano Provencio; Amelia Insa; Bartomeu Massuti; Jose Luis Gonzalez-Larriba; Luis Paz-Ares; Isabel Bover; Rosario Garcia-Campelo; Miguel Angel Moreno; Silvia Catot; Christian Rolfo; Noemi Reguart; Ramon Palmero; José Miguel Sánchez; Roman Bastus; Clara Mayo; Jordi Bertran-Alamillo; Miguel Angel Molina; Jose Javier Sanchez; Miquel Taron Journal: N Engl J Med Date: 2009-08-19 Impact factor: 91.245
Authors: Ji Yun Lee; Jong-Mu Sun; Sung Hee Lim; Hae Su Kim; Kwai Han Yoo; Ki Sun Jung; Haa-Na Song; Bo Mi Ku; Jiae Koh; Yeon-Hee Bae; Se-Hoon Lee; Jin Seok Ahn; Keunchil Park; Myung-Ju Ahn Journal: Clin Cancer Res Date: 2015-12-14 Impact factor: 12.531
Authors: Andrew E Massey; Shabnam Malik; Mohammad Sikander; Kyle A Doxtater; Manish K Tripathi; Sheema Khan; Murali M Yallapu; Meena Jaggi; Subhash C Chauhan; Bilal B Hafeez Journal: Int J Mol Sci Date: 2021-05-17 Impact factor: 5.923