Literature DB >> 29750171

Phylogeny of Maleae (Rosaceae) Based on Multiple Chloroplast Regions: Implications to Genera Circumscription.

Jiahui Sun1,2, Shuo Shi1,2,3, Jinlu Li1,4, Jing Yu1, Ling Wang4, Xueying Yang5, Ling Guo6, Shiliang Zhou1,2.   

Abstract

Maleae consists of economically and ecologically important plants. However, there are considerable disputes on generic circumscription due to the lack of a reliable phylogeny at generic level. In this study, molecular phylogeny of 35 generally accepted genera in Maleae is established using 15 chloroplast regions. Gillenia is the most basal clade of Maleae, followed by Kageneckia + Lindleya, Vauquelinia, and a typical radiation clade, the core Maleae, suggesting that the proposal of four subtribes is reasonable. In the core Maleae including 31 genera, chloroplast gene data support that the four Malus-related genera should better be merged into one genus and the six Sorbus-related genera would be classified into two genera, whereas all Photinia-related genera should be accepted as distinct genera. Although the phylogenetic relationships among the genera in Maleae are much clearer than before, it is still premature to make a formal taxonomic treatment for these genera.

Entities:  

Mesh:

Substances:

Year:  2018        PMID: 29750171      PMCID: PMC5884435          DOI: 10.1155/2018/7627191

Source DB:  PubMed          Journal:  Biomed Res Int            Impact factor:   3.411


1. Introduction

Rosaceae or rose family, consisting of approximately 4,828 species in 91 genera [1], is of great economic and ecological importance. Many species are cultivated for their fruits or as ornamentals. The monophyly of the family is implied by the presence of unique floral structures and strongly supported by rbcL phylogeny [2]. However, the rose family displays a considerable diversity in morphology and anatomy, and it had been generally subdivided into four subfamilies, that is, Rosoideae, Spiraeoideae, Amygdaloideae (incorrectly Prunoideae), and Maloideae. Such a subdivision was recently challenged by molecular phylogenies of matK and trnL-F [3], six nuclear and four chloroplast regions [4], and hundreds of nuclear genes [5]. A formal three-subfamily classification was proposed: Dryadoideae, Rosoideae, and Amygdaloideae (incorrectly Spiraeoideae in [4]). Dryadoideae was separated from Rosoideae, and Spiraeoideae and Maloideae were merged with Amygdaloideae (incorrectly Spiraeoideae). One of the most striking changes in the new classification is that traditional Maloideae became subtribe Malinae (incorrectly Pyrinae). Here we use tribe Maleae instead of supertribe Pyrodae sensu [4] to include the traditional pome-bearing Maloideae plus Gillenia Moench (=Porteranthus Britton), Kageneckia Ruiz & Pav., Lindleya Kunth, and Vauquelinia Corrêa ex Bonpl. in traditional Spiraeoideae [4, 6–9]. Maleae consists of about 1,000 species, occurring mostly in the temperate Northern Hemisphere. The tribe includes many well-known fruit crops such as apple (Malus pumila Mill.), pear (Pyrus spp.), loquat (Eriobotrya japonica (Thunb.) Lindl.), and black chokeberry (Aronia melanocarpa (Michx.) Elliott), as well as many ornamentals. The core Maleae is characterized by a synapomorphic pome, a type of accessory fruit that does not occur in other Rosaceae plants [10], and a basal chromosome number, x = 17. With the addition of Gillenia, Kageneckia, Lindleya, and Vauquelinia, the tribe has drupaceous or follicle fruits and x = 9 (or 15) as well [2, 4, 6, 9, 11–13]. The origin of core Maleae (x = 17) has long been considered an example of allopolyploidization between the species with x = 9 in traditional Spiraeoideae and the species with x = 8 in traditional Amygdaloideae [14-17]. However, recently discovered genomic data suggested an origin via autopolyploidization followed by aneuploidization around 50 million years ago [18, 19]. In contrast, the allopolyploid nature of core Maleae was confirmed by GBSSI, which had four copies in the core Maleae but only two copies in other groups [6]. Polyploidization affects systematics at both generic and specific levels. It is unlikely to resolve the polytomy of ancestral populations that have just a few closely related species involved in historical speciation and subsequent diversification, owing to the lack of phylogenetically informative signals and incomplete lineage sorting. The merging of several genomes into one species enriches the pool of available genetic combinations and the survival of recombinants is overcome by apomixis. Maleae is one such species-rich tribe of genera but is difficult to classify. The pome-bearing plants have been generally subdivided into two groups: one with connate endocarps and the other with polypyrenous drupes [10, 20–22]. However, such subdivisions of the core Maleae do not receive support from molecular data. Considerable controversies exist on circumscriptions of genera based on morphology or anatomy [21, 23–37]. Sorbus L. is considered to include both the pinnate-leaved species (Sorbus s.s. and Cormus Spach) and the simple-leaved species (Aria (Pers.) Host, Micromeles Decne., Chamaemespilus Medik., and Torminalis Medik.) [21, 34, 38, 39]. Aronia Medik., Heteromeles M. Roem., Pourthiaea Decne., and Stranvaesia Lindl. are either merged together with Photinia Lindl. or accepted as distinct genera [37, 40, 41]. Varying opinions are also found among Malus Mill., Docyniopsis Koidz., and Eriolobus (DC.) M. Roem., as well as among Pseudocydonia (C. K. Schneid.) C. K. Schneid., Cydonia Mill., and Chaenomeles Lindl. [22, 27, 37]. Lack of consensus treatment among these genera is a result of uncertainty about genetic relationships among all entities (or genera in the narrow sense) and molecular data have been used to reveal their phylogenies. Both chloroplast DNA sequences [2, 4, 7, 9, 42] and nuclear DNA sequences ([4, 6–8, 12, 43]; Lo et al., 2012) have been tried, and it is clear that the monophyly of each entity is highly supported; the major unsolved problem is the phylogeny among entities. To elucidate the intricate relationships among these entities (the generally recognized genera in the narrow sense within Maleae), we sampled representative species for each of them, including the occasionally accepted genera and subgenera, and constructed their phylogeny using 15 chloroplast regions. Our results are expected to be helpful for the correct circumscription of genera in Maleae.

2. Materials and Methods

2.1. Taxon Sampling

A total of 41 species were examined: 35 species representing all generally recognized genera of Maleae and five species representing other major lineages of Amygdaloideae and Rosa rugosa Thunb. as an outgroup (Table 1). All samples were collected under appropriate permits: Herbarium, Institute of Botany, CAS; Beijing Botanical Garden, CAS; Kunming Botanical Garden, CAS; and Xishuangbanna Tropical Botanical Garden, CAS; and other places listed in Table 1.
Table 1

Representative species of Maleae, other major lineages of Amygdaloideae, and an outgroup used in this study, together with sample vouchers and sampling localities.

TaxonVoucher Locality
Amelanchier arborea (F. Michx.) FernaldS. L. Zhou BOP022147Herbarium, Institute of Botany, CAS (PE)
Aria nivea HostS. L. Zhou BOP022174Herbarium, Institute of Botany, CAS (PE)
Aronia melanocarpa (Michx.) ElliottS. L. Zhou BOP022150Herbarium, Institute of Botany, CAS (PE)
Chaenomeles speciosa (Sweet) NakaiS. L. Zhou BOP010027Beijing Botanical Garden, CAS
Chamaemeles coriacea Lindl.K. R. Roberson 4775Illinois Natural History Survey Herbarium (ILLS)
Chamaemespilus alpina (Mill.) K. R. Robertson & J. B. PhippsK. R. Roberson 5276Illinois Natural History Survey Herbarium (ILLS)
Cormus domestica (L.) SpachS. L. Zhou BOP022163Herbarium, Institute of Botany, CAS (PE)
Cotoneaster multiflorus BungeS. L. Zhou BOP010016Beijing Botanical Garden, CAS
Crataegus kansuensis E. H. WilsonS. L. Zhou BOP010010Beijing Botanical Garden, CAS
Cydonia oblonga Mill.S. L. Zhou BOP010020Beijing Botanical Garden, CAS
Dichotomanthes tristaniicarpa KurzS. L. Zhou BOP027700Kunming Botanical Garden, CAS
Docynia delavayi (Franch.) C. K. Schneid.S. L. Zhou BOP027738Xishuangbanna Tropical Botanical Garden, CAS
Docyniopsis tschonoskii (Maxim.) Koidz.S. L. Zhou BOP022164Herbarium, Institute of Botany, CAS (PE)
Eriobotrya japonica (Thunb.) Lindl.S. L. Zhou BOP003044Beijing Botanical Garden, CAS
Eriolobus kansuensis (Batalin) C. K. Schneid.S. L. Zhou BOP011038Huludao, Liaoning, CHN
Gillenia trifoliata (L.) MoenchS. L. Zhou BOP022159Herbarium, Institute of Botany, CAS (PE)
Heteromeles arbutifolia (Dryand.) M. Roem.S. L. Zhou BOP022160Herbarium, Institute of Botany, CAS (PE)
Kageneckia  crataegifolia Lindl.S. L. Zhou BOP022176Herbarium, Institute of Botany, CAS (PE)
Lindleyella schiedeana (Schltdl.) Rydb.S. L. Zhou BOP022161Herbarium, Institute of Botany, CAS (PE)
Malacomeles denticulata (Kunth) G. N. JonesS. L. Zhou BOP022179Herbarium, Institute of Botany, CAS (PE)
Malus baccata (L.) Borkh.S. L. Zhou BOP016421Beijing Botanical Garden, CAS
Mespilus germanica L.S. L. Zhou BOP022165Herbarium, Institute of Botany, CAS (PE)
Micromeles folgneri C. K. Schneid.S. L. Zhou BOP017025Harbin, Heilongjiang, CHN
Osteomeles schwerinae C. K. Schneid.S. L. Zhou BOP027697Kunming Botanical Garden, CAS
Peraphyllum ramosissimum Nutt. ex Torr. & A. GrayS. L. Zhou BOP022168Herbarium, Institute of Botany, CAS (PE)
Photinia serratifolia (Desf.) KalkmanS. L. Zhou BOP027633Beijing Botanical Garden, CAS
Pourthiaea arguta var. salicifolia (Decne.) Hook. f.S. L. Zhou BOP022178Herbarium, Institute of Botany, CAS (PE)
Pseudocydonia sinensis (Dum. Cours.) C. K. Schneid.S. L. Zhou BOP010349Beijing Botanical Garden, CAS
Pyracantha fortuneana (Maxim.) H. L. LiS. L. Zhou BOP003043Beijing Botanical Garden, CAS
Pyrus  bretschneideri RehderS. L. Zhou BOP010065Beijing Botanical Garden, CAS
Rhaphiolepis indica (L.) Lindl.S. L. Zhou BOP016354Kunming Botanical Garden, CAS
Sorbus aucuparia L.S. L. Zhou BOP016569Harbin, Heilongjiang, CHN
Stranvaesia davidiana Decne.S. L. Zhou BOP027698Kunming Botanical Garden, CAS
Torminalis clusii (M.Roem.) K. R. Robertson & J. B. PhippsK. R. Roberson 5275Illinois Natural History Survey Herbarium (ILLS)
Vauquelinia corymbosa Corrêa ex Humb. & Bonpl.S. L. Zhou BOP022177Herbarium, Institute of Botany, CAS (PE)
Other lineages
Physocarpus amurensis (Maxim.) Maxim.S. L. Zhou BOP010043Beijing Botanical Garden, CAS
Prinsepia sinensis (Oliv.) Oliv. ex BeanS. L. Zhou BOP010133Beijing Botanical Garden, CAS
Rhodotypos scandens (Thunb.) MakinoS. L. Zhou BOP010022Beijing Botanical Garden, CAS
Sorbaria sorbifolia (L.) A. BraunS. L. Zhou BOP016568Beijing Botanical Garden, CAS
Spiraea pubescens Turcz.S. L. Zhou BOP010042Beijing Botanical Garden, CAS
Outgroup
Rosa rugosa Thunb.S. L. Zhou BOP010536Beijing Botanical Garden, CAS

2.2. DNA Extraction, Amplification, and Sequencing

Total genomic DNA was extracted using the mCTAB method [44] and purified using the Wizard DNA Clean-Up System (A7280, Promega Corporation, Madison, WI). Fifteen chloroplast regions, that is, atpB-rbcL, matK, ndhF, petA-psbJ, psbA-trnH, psbM-trnD, rbcL, rpl16, rpl20-rps12, rps16, trnC-ycf6, trnH-rpl2, trnL-trnF, trnS-trnG, and ycf1, were used in this study. Fourteen primer pairs published in Dong et al. [45, 46] were synthesized by Sangon Biotech (Shanghai) Co. Ltd. (Beijing, China) and used to amplify and sequence these regions (Table 2). Sequences of rps16 were downloaded from GenBank. The polymerase chain reaction (PCR) amplifications were carried out in a mixture volume of 20 μL, containing 1x Taq buffer (1 mol/L KCl; 20 mmol Tris-HCl pH 9.0; 1% Triton X-100), 2.0 μL dNTPs (2 mmol/L), 1.0 μL each of the primers (5 μmol/L), 20 ng of genomic DNA, and 1 unit of Taq polymerase. PCR was conducted using a C1000 Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA). The program started at 94°C for 3 min, followed by 35 cycles at 94°C for 30 s, 50°C for 30 s, and 72°C for 2 min, and ended at 72°C for 5 min. The PCR products were purified with an equal mixture of 40% PEG 8000 and 5 mol/L NaCl, followed by a washing step with 80% ethanol. The PCR products were then Sanger sequenced for both strands on an ABI 3730xl DNA Analyzer using BigDye Terminator cycle sequencing kit v3.1 (Applied Biosystems, Foster City, CAS, USA) following the manufacturer's instructions.
Table 2

Primers used to amplify and sequence 15 regions of chloroplast genome of Rosaceae.

Gene regionsForward primer (5′-3′)Reverse primer (5′-3′)Reference
atpB-rbcL TTTCCTAATAATTGCTGTACCACAGTTGTCCATGTACCAGTAGDong et al., 2013 [45]
matK TCTAGCACACGAAAGTCGAAGTCGATCTATTCATTCAATATTTCDong et al., 2013 [45]
ndhF ACACCAACGCCATTCGTAATGCCATCAAGATGAAATTCTTAATGATAGTTGGDong et al., 2013 [45]
petA-psbJ CTAATGTGGGTGGATTTGGTCAATGGCCGATACTACTGGAAGGThis study
psbA-trnH GAACCCGCGCATGGTGGATTCACTGGCTCCCTATTCAGTGCTATGCThis study
psbM-trnD GTTTTTACGTATATTATAAGTAGTTCAAATCCAGCTCGGCCCAThis study
rbcL ATGTCACCACAAACAGAGACTAAAGCTTCCATACTTCACAAGCAGCAGCTAGDong et al., 2013 [45]
rpl16 TCCCGAAATAATGAATTGAGTTCGTCAGAGAAGGTAGGGTTCCCCTDong et al., 2013 [45]
rpl20-rps12 ATGATCTCATTGGAAATCATATAAAGAGGGTAATGATCCATCAACCGGCDong et al., 2013 [45]
rps16 GTGGTAGAAAGCAACGTGCGACTTTCGGGATCGAACATCAATTGCAACOxelman et al., 1997 [85]
trnC-ycf6 GGCGGCATGGCCGAGTGGTAAGGCTCCACTTCTTCCCCATACTACGADong et al., 2013 [45]
trnH-rpl2 AGCCAACACTTAGATCCGGCTCTACGATTTGTGAATCCACCATGCGCGDong et al., 2013 [45]
trnL-trnF GTTCAAGTCCCTCTATCCCCAGATTTTCAAGAACGGGAATCTTADong et al., 2013 [45]
trnS-trnG AAACTCTTCGTTTACACAGTAGTGACTTTTACCACTAAACTATACCCGCDong et al., 2013 [45]
ycf1 TCTCGACGAAAATCAGATTGTTGTGAATATACATGTCAAAGTGATGGAAAADong et al., 2015 [46]

2.3. Sequence Data Preparation and Evaluation

The newly generated sequences were checked and assembled using Sequencer 4.7 (Gene codes Corporation, Ann Arbor, Michigan, USA). The resulting sequences (Supplementary Table S2) were combined with the published sequences of Maleae species downloaded from GenBank (Supplementary Table S1), aligned with Clustal X [47, 48], and then manually adjusted with Se-Al 2.0 [49]. Each individual gene dataset was then subjected to several rounds of phylogenetic evaluations to select reliable sequences. Sequences that were misidentified or exhibited large amounts of missing data were excluded from the datasets. To predict the phylogenetic performance of individual gene partitions, the variability of genes was parameterized by DnaSP 5.0 [50] and PAUP 4.0b10 [51] using nucleotide diversity, the number of polymorphic sites, and so forth. Prior to concatenating the dataset of each marker, incongruence length difference (ILD) tests were performed on all 15 datasets. The datasets were finally concatenated into one final data matrix using SequenceMatrix [52] for phylogenetic analyses.

2.4. Phylogenetic Analysis

Phylogenetic analyses were performed on single gene datasets and the concatenated dataset, using PAUP 4.0b10 [51] for maximum parsimony (MP), RAxML v.8.1.24 [53] for maximum likelihood (ML), and MrBayes 3.2.2 [54] for Bayesian inference (BI). The MP analysis used a heuristic search that treats all characters as equally weighted and unordered, obtaining the starting trees by stepwise addition, random stepwise addition of 100 replicates, TBR, and MulTrees enabled. Branch support for MP trees was assessed with 1,000 bootstrap replicates and all trees were saved at each replicate. ML analysis was performed with 1,000 nonparametric bootstrap replicates (BP). The suitable substitution model (GTR + I + G) for BI analysis was inferred by using ModelTest version 3.7 [55] under the Akaike information criterion. Default settings were used for the MrBayes run, and 2 × four chains were run for ten million generations, sampled every 1,000 generations. Posterior probabilities (PP) were calculated from the majority consensus of all of the sampled trees when the standard deviation of the split frequencies (SDSF) permanently fell below 0.01, and the trees sampled during the burn-in phase were discarded.

3. Results

3.1. Sequence Variability within Maleae

The ILD tests did not suggest serious conflicts between datasets of the 15 chloroplast regions (p = 0.11). The variability of the 15 examined DNA regions within Maleae are given in Table 3, together with the MP tree scores of all taxa. The longest DNA region was matK (La = 2045), and the shortest was trnH-rpl2 (La = 205). Of the 15 chloroplast regions, psbA-trnH was the most variable fragment with a π (nucleotide diversity) value of 0.02547, whereas trnH-rpl2 was the least variable fragment with a π value of 0.00391. The psbA-trnH, petA-psbJ, ycf1, trnS-trnG, and trnC-ycf6 gene regions were more variable (π > 0.010) than other genes.
Table 3

Variability of 15 chloroplast regions among species in Maleae and the maximum parsimony tree scores of all taxa.

Gene regions N LaSc S IsNH π k L CIRI
atpB-rbcL 39796659339250.004224.151770.9210.781
matK 412045176116747320.008798.176630.7410.538
ndhF 391973182114838290.009377.56940.7450.567
petA-psbJ 341370107215536270.0104611.315540.7910.629
psbA-trnH 372832223410150.0254712.011960.7890.436
psbM-trnD 341503122512633270.009018.385890.810.666
rbcL 38135312936025250.005394.432960.5470.442
rpl16 40117894012431320.0080410.534630.6890.518
rpl20-rps12 377436774215300.007105.652300.7520.617
rps16 399647728422280.009998.713780.7460.639
trnC-ycf6 3610328109030280.010848.725250.7850.616
trnH-rpl2 3620518911550.003915.371960.7890.436
trnL-trnF 4110889449024260.007838.274200.7570.612
trnS-trnG 3689566110220270.0101111.44700.7810.528
ycf1 348667428821280.0121010.164890.7650.595

N, number of species; La, aligned length; Sc, sites considered; S, number of polymorphic sites, excluding sites with missing data; Is, parsimony-informative site; NH, number of haplotypes; π, nucleotide diversity; k, average number of nucleotide differences; L, the tree length; CI, consistency index; RI, retention index.  Including all taxa.

The concatenated data matrix of the 41 taxa reached an aligned length of 17,554 bp with 1,266 parsimony-informative characters. MP searches yielded one best tree with a consistency index (CI) of 0.779, a retention index (RI) of 0.637, and a tree length of 5,974.

3.2. Phylogenetic Relationships of the Basal Maleae

Polytomies were observed in all the 15 best trees based on each chloroplast region. However, the tree topologies were similar; we thus concatenated them to build best resolved phylogenetic trees using MP, ML, and BI methods. The consensus trees from the MP, ML, and BI analyses showed substantially identical topologies and the monophyly of Maleae was recovered (Figure 1). A long branch leads to the crown taxa of Maleae, including Gillenia, Lindleya, Kageneckia, and Vauquelinia (Figure 1(A)), and this branch is strongly supported (Figure 1(B)) (PB = 100, BP = 100, PP = 1).
Figure 1

Phylogenetic relationships of Maleae based on a concatenated dataset of 15 chloroplast gene regions. (A) Bayesian phylogram with branch lengths. (B) 50% majority-rule Bayesian consensus tree with bootstrap supports. Values beside the branches are the bootstrap percentages from maximum parsimony analysis, maximum likelihood analysis, and Bayesian posterior probabilities. “-” indicates a branch collapse in the maximum parsimony and maximum likelihood trees.

An earliest and remarkable divergence of Gillenia is clearly indicated in Figure 1. Lindleya and Kageneckia form a monophyletic clade and they diverged slightly earlier than Vauquelinia. The divergence among Lindleya + Kageneckia, Vauquelinia, and the core Maleae happened within a very short span of time, as indicated by the very short branches. All the three branches are well supported. The basal branching pattern of Maleae may serve as the foundation of subtribal division within the tribe if necessary.

3.3. Phylogenetic Relationships within the Core Maleae

The monophyly of the core Maleae is clearly indicated (Figure 1(A)) and well supported (Figure 1(B)). The genera in the core Maleae seem to be from the second radiation event. Nevertheless, three multigenus clades within the core Maleae are recognizable. Clade I consists of Amelanchier Medik., Crataegus L., Cydonia Mill., Malacomeles (Decne.) Decne., Mespilus L., and Peraphyllum Nutt. and is well supported (PB = 95, BP = 90, PP = 1). A very close relationship between Crataegus and Mespilus is indicated. Clade II (PB = 65, BP = 79, PP = 1) consists of four Photinia-related, three Sorbus-related, and three distinct entities. There are four pairs of genera in this clade but only two of them are highly supported (PB = 100, BP = 100, PP = 1), namely, Eriobotrya Lindl. versus Rhaphiolepis Lindl. and Micromeles Decne. versus Sorbus L. Stranvaesia Lindl. was closer to Cotoneaster Mecik. rather than to Photinia Lindl. Clade III consists of four Malus-related, one Photinia-related, three Sorbus-related, and five distinct entities and is weakly supported (PB = 50, BP = 67, PP = 0.91). Very close relationships were revealed between Malus-related Docyniopsis Koidz. and Malus Mill. (PB = 100, BP = 100, PP = 1) and among the Sorbus-related Aria (Pers.) Host, Chamaemespilus Medik., and Torminalis Medik. (PB = 72, BP = 94, PP = 1). Docynia Decne. and Eriolobus (DC.) Roem. also fall in the same clade as Docyniopsis and Malus, but the clade is only weakly supported (PB = 56, BP = 67, PP = 1). Chaenomeles Lindl. is related to Pseudocydonia (C. K. Schneid.) C. K. Schneid. (BP = 52, PP = 1).

4. Discussion

4.1. Taxa and Gene Sampling Strategies

It is often a challenge to reconstruct the phylogeny of taxa from recent radiation events due to unclear relationships among subdivisions and low resolution of markers. Maleae is such a taxon and that is why early studies failed to establish solid phylogenetic relationships among its subdivisions. In “A checklist of the subfamily Maloideae (Rosaceae)” [21], only 23 genera were accepted. Six Sorbus-related entities, that is, Aria, Chamaemespilus, Cormus, Micromeles, Sorbus, and Torminalis, were proposed to be merged. To test the distinctness of these taxa, we included all of them in this study. Malus-related and Photinia-related entities have similar taxonomic problems. Inclusion of representative species from other lineages of Amygdaloideae was to test the monophyly of Maleae. Considering that the monophyly of the genera in the narrowest sense has been well verified, 35 entities with one representative species each were sampled for being the most inclusive and economically affordable. Sampling chloroplast regions as molecular markers for Maleae is another challenge. The tribe was found to be quite young and the core Maleae was even younger. Chloroplast markers have showed very low resolutions in previous studies [2, 4, 7, 9, 42]. Therefore, the most variable regions suggested by Dong et al. [56] were used together with the four conventional DNA barcodes, matK, psbA-trnH, rbcL, and ycf1 [46]. By doing so, the major groups in Maleae were well resolved.

4.2. Phylogenetic Relationships among Major Groups of Maleae

The phylogeny (Figure 1) strongly suggests inclusion of Gillenia, Kageneckia, Lindleya, and Vauquelinia in Maleae (incorrectly Pyrodae in [7] and in [4]). Gillenia seemed to diverge slightly early, and Kageneckia + Lindleya, Vauquelinia, and the core Maleae are quite probably from the first radiation event. Although the inclusion of Kageneckia, Lindleya, and Vauquelinia into Maleae seems disagreeable with respect to fruit types, their basal chromosome number (x = 15 or 17) suggests that they had probably experienced similar speciation events. They bridge the gap between the core Maleae and true spiraeoid Gillenia. The inclusion of Gillenia in Maleae verifies that the core Maleae is from spiraeoid members within the tribe or other tribes in Amygdaloideae. Unfortunately, transcriptome data of nuclear genes did not provide more information for the issue of origin of the core Maleae because Figure 1 is substantially similar to the tree topologies based on transcriptome data in [5]. Given that Gillenia is the only diploid member in Maleae, the ancestor of Gillenia or its close relatives must be the maternal parent of the extant Maleae.

4.3. Phylogenetic Relationships within the Core Maleae

The core Maleae is a natural group with several synapomorphic characters, such as syncarpous ovaries, epigynous flowers, and fleshy fruits derived from the hypanthial ovary [57-59]. It could be better classified as subtribe Malinae (incorrectly Pyrinae) if necessary. The Malinae diverged into genera by radiation which is the second radiation event in Malese. The genera are so closely related that it is unnecessary to subdivide this subtribe further.

4.3.1. Generic Pairs and Their Taxonomic Status

There are four generic pairs, for which the taxonomic status needs to be clarified. Firstly, a close genetic relationship between Crataegus and Mespilus has been revealed by Lo and Donoghue [9] in detail, which is confirmed here again. If Mespilus were to be accepted as a distinct genus, Crataegus would become a paraphyletic group. Although Mespilus was merged with Crataegus, its distinction was still recognized by giving it the taxonomic rank of section in Crataegus [9]. Secondly, reduction of Pseudocydonia to Chaenomeles was done by Gu and Spongberg [60], and their treatment is supported by Campbell et al. [7]. However, their close relationship does not receive high support in this study (BP = 52, PP = 1). They have diverged for some time because the clade does not show remarkable branch length. They had better be considered distinct genera. Thirdly, Stranvaesia is morphologically similar to both Photinia and Cotoneaster and sometimes submerged into Photinia [61]. Phylogeny based on chloroplast regions done by Campbell et al. [7] indicated a close relationship between Stranvaesia and Pyracantha. However, our data support a close relationship between Stranvaesia and Cotoneaster, a relationship also supported by GBSSI-1B [7]. Fourthly, although very close morphological and genetic relationships have been revealed in almost all studies involving Eriobotrya and Rhaphiolepis, there has been no suggestion yet to merge them into one, despite the existence of their hybrids [62]. Genetic divergence between them is very recently because their clade has a relatively long branch.

4.3.2. Sorbus-Related Genera

So far, no well-sampled phylogeny of all Sorbus-related taxa is available, owing to the genetic complexity of the group and difficulties in sampling. There are ca. 250 species belonging to mainly temperate areas in the Northern Hemisphere [21], and six narrowly defined genera or subgenera under Sorbus in the broadest sense are usually accepted: Aria, Chamaemespilus, Cormus, Micromeles, Sorbus, and Torminalis [21, 37–39, 43, 58, 63–72]. These taxa fall into two clades in this study (Figure 1). Sorbus sensu stricto and Cormus with compound leaves nested in Clade I, and Aria, Chamaemespilus, and Torminalis with lobed or unlobed simple leaves nested in Clade III. Micromeles, a genus created to contain the species without persistent calyx lobes, is not a natural entity and is, therefore, unacceptable [8]. Micromeles folgneri in this study is a synonym of Sorbus folgneri. Although Cormus had been considered a synonym of Sorbus, its taxonomic position remains to be determined. Aria, Chamaemespilus, and Torminalis in Clade III are closely related and they had better merge into one separate from Sorbus. Sorbus-related entities are notorious in taxonomy due to complexity in phenotypes resulting from interspecific hybridization and facultative agamospermy [39, 69, 70]. Apomictic microspecies confound systematic resolution of agamic complexes using nuclear markers [71]. Phylogenies based on nuclear genes may suffer from paralogue problems and chloroplast markers would work better at the very beginning when no clear ideas are available for classification.

4.3.3. Photinia-Related Genera

Four genera in their narrowest sense, Aronia, Heteromeles, Pourthiaea, and Stranvaesia, are considered related to Photinia [24, 25, 29, 31, 37]. This study demonstrates that all the five genera are superficially similar but actually distinct groups. Heteromeles possesses a soft pyrene, while Photinia possesses a soft core [16, 37, 58]. Stranvaesia is distinguishable from Photinia by the dehiscent fruits at maturity. Although Guo et al. [73] stated with quite certainty that Stranvaesia must be merged into Photinia, we believe that further studies are needed for a reliable conclusion. Pourthiaea belongs to Clade III instead of Clade II as other genera. It is readily separable from other genera by characters such as deciduous habit, warty peduncles and pedicels, and a pulp structure in the fruits [41]. The distinction of Pourthiaea is further supported by leaf epidermis and wood anatomy [74, 75]. Aronia is not a sister group of Pourthiaea because the clade is poorly supported, a conclusion that is similar to the earlier studies ([8, 9, 73]).

4.3.4. Malus-Related Genera

The four genera, Docynia, Docyniopsis, Eriolobus, and Malus, really have very close relationships among them, especially between Docyniopsis and Malus. Some species have been transferred among the four genera by different authors. The monophyly of a clade comprising the four genera is indicated by our chloroplast data (Figure 1(B)). There are only two species in Docynia, two species in Docyniopsis, and one species in Eriolobus. Considering that these species are nested within Malus [18], these genera could better be merged with Malus.

5. Conclusions

This molecular phylogenetic study was conducted on all the genera of Maleae, by using 15 variable chloroplast gene regions. Four major clades are well resolved and the branches are well supported. These clades could be classified into four subtribes. The first radiation event gave birth to Lindleya + Kageneckia, Vauquelinia, and the ancestor of the core Maleae, and the second radiation event triggered the divergence of the genera in the core Maleae within a short time period. Within the core Maleae the four Malus-related genera should better be merged into one genus; the six Sorbus-related genera would be better classified into at least two genera; and all Photinia-related genera should be accepted as distinct genera. For a more reliable classification, phylogeny based on the whole chloroplast genomes of representative species from each genus should be used. Such a strategy has been practiced on many seed plants (e.g., [76-83]). Besides, the nuclear genes, especially the single copy nuclear genes in diploid species such as starch-branching enzyme (Sbe; [84]), should be considered with priority to document the origins of Maleae, as the maternally transmitted markers can only tell one aspect of the whole story. Application of nuclear genome information in phylogenetic reconstruction of Maleae also seems feasible, because the genomes of several species in the tribe have been sequenced, and the resequencing of many species is underway. We are expecting a completely resolved phylogeny of Maleae, and that is why we do not provide a formal taxonomic treatment in this study.
  23 in total

1.  MrBayes 3: Bayesian phylogenetic inference under mixed models.

Authors:  Fredrik Ronquist; John P Huelsenbeck
Journal:  Bioinformatics       Date:  2003-08-12       Impact factor: 6.937

2.  Expanded phylogenetic and dating analyses of the apples and their relatives (Pyreae, Rosaceae).

Authors:  Eugenia Y Y Lo; Michael J Donoghue
Journal:  Mol Phylogenet Evol       Date:  2012-01-25       Impact factor: 4.286

3.  The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools.

Authors:  J D Thompson; T J Gibson; F Plewniak; F Jeanmougin; D G Higgins
Journal:  Nucleic Acids Res       Date:  1997-12-15       Impact factor: 16.971

4.  A gene encoding starch branching enzyme I (SBEI) in apple (Malusxdomestica, Rosaceae) and its phylogenetic relationship to Sbe genes from other angiosperms.

Authors:  Yuepeng Han; Ksenija Gasic; Fengjie Sun; Mingliang Xu; Schuyler S Korban
Journal:  Mol Phylogenet Evol       Date:  2006-09-09       Impact factor: 4.286

5.  Floral Ontogeny and Morphology in Subfamily Spiraeoideae Endl. (Rosaceae).

Authors: 
Journal:  Int J Plant Sci       Date:  1999-09       Impact factor: 1.785

6.  Phylogenomic and structural analyses of 18 complete plastomes across nearly all families of early-diverging eudicots, including an angiosperm-wide analysis of IR gene content evolution.

Authors:  Yanxia Sun; Michael J Moore; Shoujun Zhang; Pamela S Soltis; Douglas E Soltis; Tingting Zhao; Aiping Meng; Xiaodong Li; Jianqiang Li; Hengchang Wang
Journal:  Mol Phylogenet Evol       Date:  2015-12-24       Impact factor: 4.286

7.  Molecular genetic features of polyploidization and aneuploidization reveal unique patterns for genome duplication in diploid Malus.

Authors:  Michael J Considine; Yizhen Wan; Mario F D'Antuono; Qian Zhou; Mingyu Han; Hua Gao; Man Wang
Journal:  PLoS One       Date:  2012-01-10       Impact factor: 3.240

8.  Resolving deep relationships of PACMAD grasses: a phylogenomic approach.

Authors:  Joseph L Cotton; William P Wysocki; Lynn G Clark; Scot A Kelchner; J Chris Pires; Patrick P Edger; Dustin Mayfield-Jones; Melvin R Duvall
Journal:  BMC Plant Biol       Date:  2015-07-11       Impact factor: 4.215

9.  Evolution of Rosaceae Fruit Types Based on Nuclear Phylogeny in the Context of Geological Times and Genome Duplication.

Authors:  Yezi Xiang; Chien-Hsun Huang; Yi Hu; Jun Wen; Shisheng Li; Tingshuang Yi; Hongyi Chen; Jun Xiang; Hong Ma
Journal:  Mol Biol Evol       Date:  2017-02-01       Impact factor: 16.240

10.  Sequencing angiosperm plastid genomes made easy: a complete set of universal primers and a case study on the phylogeny of saxifragales.

Authors:  Wenpan Dong; Chao Xu; Tao Cheng; Kui Lin; Shiliang Zhou
Journal:  Genome Biol Evol       Date:  2013       Impact factor: 3.416

View more
  5 in total

1.  The complete chloroplast genome sequence of Gillenia trifoliata (Rosaceae).

Authors:  Jiahui Sun; Yiheng Wang; Shiliang Zhou; Luqi Huang
Journal:  Mitochondrial DNA B Resour       Date:  2019-07-18       Impact factor: 0.658

2.  Characterization and comparative analysis among plastome sequences of eight endemic Rubus (Rosaceae) species in Taiwan.

Authors:  JiYoung Yang; Yu-Chung Chiang; Tsai-Wen Hsu; Seon-Hee Kim; Jae-Hong Pak; Seung-Chul Kim
Journal:  Sci Rep       Date:  2021-01-13       Impact factor: 4.379

3.  Increasing Taxa Sampling Provides New Insights on the Phylogenetic Relationship Between Eriobotrya and Rhaphiolepis.

Authors:  Zhanghong Dong; Shaohong Qu; Sven Landrein; Wen-Bin Yu; Jing Xin; Wenzhi Zhao; Yu Song; Yunhong Tan; Peiyao Xin
Journal:  Front Genet       Date:  2022-03-15       Impact factor: 4.599

4.  Typification of 23 names in Eriobotrya (Maleae, Rosaceae).

Authors:  Bin-Bin Liu; Guang-Ning Liu; De-Yuan Hong; Jun Wen
Journal:  PhytoKeys       Date:  2020-02-04       Impact factor: 1.635

5.  Power and Weakness of Repetition - Evaluating the Phylogenetic Signal From Repeatomes in the Family Rosaceae With Two Case Studies From Genera Prone to Polyploidy and Hybridization (Rosa and Fragaria).

Authors:  Veit Herklotz; Aleš Kovařík; Volker Wissemann; Jana Lunerová; Radka Vozárová; Sebastian Buschmann; Klaus Olbricht; Marco Groth; Christiane M Ritz
Journal:  Front Plant Sci       Date:  2021-12-07       Impact factor: 5.753

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.