| Literature DB >> 29733317 |
Isabel M Schopp1, Julien Béthune2.
Abstract
To complement existing affinity purification (AP) approaches for the identification of protein-protein interactions (PPI), enzymes have been introduced that allow the proximity-dependent labeling of proteins in living cells. One such enzyme, BirA* (used in the BioID approach), mediates the biotinylation of proteins within a range of approximately 10 nm. Hence, when fused to a protein of interest and expressed in cells, it allows the labeling of proximal proteins in their native environment. As opposed to AP that relies on the purification of assembled protein complexes, BioID detects proteins that have been marked within cells no matter whether they are still interacting with the protein of interest when they are isolated. Since it biotinylates proximal proteins, one can moreover capitalize on the exceptional affinity of streptavidin for biotin to very efficiently isolate them. While BioID performs better than AP for identifying transient or weak interactions, both AP- and BioID-mass spectrometry approaches provide an overview of all possible interactions a given protein may have. However, they do not provide information on the context of each identified PPI. Indeed, most proteins are typically part of several complexes, corresponding to distinct maturation steps or different functional units. To address this common limitation of both methods, we have engineered a protein-fragments complementation assay based on the BirA* enzyme. In this assay, two inactive fragments of BirA* can reassemble into an active enzyme when brought in close proximity by two interacting proteins to which they are fused. The resulting split-BioID assay thus allows the labeling of proteins that assemble around a pair of interacting proteins. Provided these two only interact in a given context, split-BioID then allows the analysis of specific context-dependent functional units in their native cellular environment. Here, we provide a step-by-step protocol to test and apply split-BioID to a pair of interacting proteins.Entities:
Mesh:
Substances:
Year: 2018 PMID: 29733317 PMCID: PMC6100705 DOI: 10.3791/57479
Source DB: PubMed Journal: J Vis Exp ISSN: 1940-087X Impact factor: 1.355






|
|
|
| 1 | NBirA*-protein1/CBirA*-protein2 |
| 2 | CBirA*-protein1/NBirA*-protein2 |
| 3 | NBirA*-GFP/CBirA*-protein1 |
| 4 | NBirA*-GFP/CBirA*-protein2 |
| 5 | no transfection |
|
|
|
| Cassette 1 reverse primer (CBirA* fusion) | TATACTTTCTAGAGAATAGGAAC |
| Cassette 2 reverse primer (NBirA* fusion) | GTGGTTTGTCCAAACTCATC |