Bacterial and protozoal pathogens found in ticks collected from humans in Corum province of Turkey.

BACKGROUND: Tick-borne diseases are increasing all over the word, including Turkey. The aim of this study was to determine the bacterial and protozoan vector-borne pathogens in ticks infesting humans in the Corum province of Turkey. METHODOLOGY/PRINCIPAL
FINDINGS: From March to November 2014 a total of 322 ticks were collected from patients who attended the local hospitals with tick bites. Ticks were screened by real time-PCR and PCR, and obtained amplicons were sequenced. The dedected tick was belonging to the genus Hyalomma, Haemaphysalis, Rhipicephalus, Dermacentor and Ixodes. A total of 17 microorganism species were identified in ticks. The most prevalent Rickettsia spp. were: R. aeschlimannii (19.5%), R. slovaca (4.5%), R. raoultii (2.2%), R. hoogstraalii (1.9%), R. sibirica subsp. mongolitimonae (1.2%), R. monacensis (0.31%), and Rickettsia spp. (1.2%). In addition, the following pathogens were identified: Borrelia afzelii (0.31%), Anaplasma spp. (0.31%), Ehrlichia spp. (0.93%), Babesia microti (0.93%), Babesia ovis (0.31%), Babesia occultans (3.4%), Theileria spp. (1.6%), Hepatozoon felis (0.31%), Hepatozoon canis (0.31%), and Hemolivia mauritanica (2.1%). All samples were negative for Francisella tularensis, Coxiella burnetii, Bartonella spp., Toxoplasma gondii and Leishmania spp.
CONCLUSIONS/SIGNIFICANCE: Ticks in Corum carry a large variety of human and zoonotic pathogens that were detected not only in known vectors, but showed a wider vector diversity. There is an increase in the prevalence of ticks infected with the spotted fever group and lymphangitis-associated rickettsiosis, while Ehrlichia spp. and Anaplasma spp. were reported for the first time from this region. B. microti was detected for the first time in Hyalomma marginatum infesting humans. The detection of B. occultans, B. ovis, Hepatozoon spp., Theileria spp. and Hemolivia mauritanica indicate the importance of these ticks as vectors of pathogens of veterinary importance, therefore patients with a tick infestation should be followed for a variety of pathogens with medical importance.

Introduction

Ticks are important vectors of a variety of diseases all over the world, including Turkey. They may transmit different kind of pathogens including bacteria, viruses, and protozoa affecting humans, domestic and wild animals [1,2]. Turkey is composed from a mosaic of habitats for ticks due to its diverse climate, vegetation, and large variety of wild and domestic animals [1,3]. Today, 48 tick species are known from this country, 31 of which have been found infesting humans [3].

Nineteen tick-borne diseases (TBDs) have been detected either in animals or humans in Turkey [1]. From 2002 to 2015, a total of 9,787 human cases of Crimean Congo hemorrhagic fever (CCHF) have been reported, 469 of which resulted in death [4]. Lyme borreliosis were reported in Turkey [5], while the sero-prevalence of Borrelia burgdorferi in humans was 4% [6]. Between 2005 and 2011, 4,824 human cases with tularemia were reported to the Ministry of Health [7]. Anaplasmosis is known from farm animals [8], while in humans, sero-positivity was 10.62% [9]. Ehrlichiosis and hepatozoonosis have been diagnosed in dogs [10,11]. The sero-prevalence for bartonellosis was 18.6% in cats [12], 6% in human blood donors [13], and 22.2% in cattle breeders and veterinarians [14]. Rickettsiosis was reported in Thrace and East Mediterranean regions of Turkey [15,16], the most prevalent being the Mediterranean Spotted Fever (MSF) [17]. Q fever cases in humans were reported from the Black Sea region of Turkey [18].

Babesiosis in animals is highly prevalent in Turkey, but there are no reports about clinical cases in humans [1]. Toxoplasmosis is one of the more common parasitic zoonosis worldwide, and in Turkey the prevalence in humans was found to vary between 13.9% and 76.6% [19]. Between the years 1988–2010, 50,381 cases of cutaneous leishmaniasis were reported to the Turkish Ministry of Health [20]. According to recent studies, ticks can be also possible vectors of toxoplasmosis and leishmaniasis [21,22].

The first CCHF cases in Turkey were observed in the province of Tokat which is a neighboring province of Corum; both cities are located in Kelkit Valley where the main vector, Hyalomma marginatum is prevalent [1,4]. Recently, 327 cases of CCHF and other TBDs such as rickettsial infections were reported from Corum [3,23-27]. The present study aims to investigate the human infested ticks species distribution; to determine their broad-ranges pathogens like Rickettsia spp., Anaplasma spp., Ehrlichia spp., Coxiella burnetii, Borrelia burgdorferi sensu lato, Francisella tularensis, Bartonella spp., Leishmania spp., Toxoplasma gondii, Babesia spp., Theileria spp., Hepatozoon spp., and Hemolivia mauritanica in Corum province of Turkey.

Methods

Study area

This study was carried out in the province of Corum (40° 33′ 00′′ N, 34° 57′ 14′′ E), which is located in Central Anatolia region of Turkey (Fig 1). It has a surface area of 12,820 km2, a population of 527,220 people, 152,244 of which live in the country site and another 374,926 in urban centers. The mean altitude is 801 m, the mean annual precipitation 429 mm, and the mean temperature 10–11°C. Due to the influences of the Black Sea and continental climates, the summers are hot and dry, while the winters are cold and rainy. Wild animals such as deer, boar, bear, badger, fox, rabbit, wolf, marten, squirrel and beaver are abundant throughout the province (Special Provincial Administration, Anonymous, 2009), while in rural areas farm animals are bred.

Fig 1

Map of the Corum province and its location within Turkey.

Ticks collection and morphological identification

From March to November 2014 specimens were collected from patients who applied to the Emergency Service of the Hitit University Research and Training Hospital with a tick infestation. Ticks were morphologically identified under the stereomicroscope (Leica MZ16, Germany) using standard taxonomic keys [28-30].

Amplification of tick-borne pathogen DNA

Individual ticks were mechanically homogenized by crushing with liquid nitrogen using disposable micro pestle and the DNA was extracted using the Tissue and Bacterial DNA Purification Kit (EURx DNA, Gdansk, Poland) according to the manufacturer’s protocols. All Polymerase Chain Reaction (PCR) amplifications were conducted with final volumes of 25 μl with 2.5 μl of template DNA, while negative and positive controls for each pathogen were used. With the exception of Francisella tularensis and protozoa, ticks were molecularly screened for pathogens by real-time-PCR using Evagreen master mix (Biotium, State, USA), while suspected samples were subjected to PCR. For the detection of F. tularensis and Leishmania a real-time-PCR taqman probe was used. For the identification of Babesia, the conventional PCR was used. All positive samples were sequenced. The primers BJ1 and BN2 amplifying Babesia spp., detected also Theileria spp., Hepatozoon spp. and H. mauritanica. The PCR methods, target genes and primer sequences used can be seen in Table 1 [31-41].

Table 1

PCR methods, target genes and primer sequences used for tick-borne pathogens.

Pathogen	Methods	Target gene	Primer sequences	Productsize (bp)	Ref.
Rickettsia spp.	Real-time-PCR	23S rRNA,	PanR8F- AGC TTG CTT TTG GAT CAT TTG GPanR8R- TTC CTT GCC TTT TCA TAC ATC TAG T		31
Rickettsia spp.	PCR	ompA	Rr190.70p ATGGCGAATATTTCTCCAAAARr190.602n AGTGCAGCATTCGCTCCCCCT	532	32
Rickettsia spp.	PCR	gltA	RpCS.877p GGGGGCCTGCTCACGGCGGRpCS.1258n ATTGCAAAAAGTACAGTGAACA	381	32
Anaplasma spp., Ehrlichia spp.	realtime-PCR/,PCR	groEL	ESpF- TACTCAGAGTGCTTCTCAATGTESpR- GCATACCATCAGTTTTTTCAAC	362	33
Coxiella burnetii	Real-time-PCR	ompA	CoxF- CAGAGCCGGGAGTCAAGCTCoxR- CTGAGTAGGAGATTTGAATCGC	82	34
Bartonella spp.	Real-time-PCR	ssrA	ssrA F-GCTATGGTAATAAATGGACAATGAAATAAssrA R-GCTTCTGTTGCCAGGTG	301	35
Borrelia spp.	Real-time-PCR	16S rRNA	p16Swt F-GGATATAGTTAGAGATAATTATTCCCCGTTTGp16Swt R-CATTACATGCTGGTAACAGATAACAAGG	139	36
Borrelia spp.	PCR	flagellin	FL16- TGCTGGTGAGGGAGCTCAAGCTGCTCAGGCTGCACC TGTTCAAGAGGGTGCTFL17-TGCAGGTGAAGGCGCTCAGGCTGCTCCAGTGCAAGAGATAGGA	260	37
Francisella tularensis	Real-time-PCR taqman prob	tul4	Tul4F-ATTACAATGGCAGGCTCCAGATul4R- TGCCCAAGTTTTATCGTTCTTCTTul4P- TTCTAAGTGCCATGATACAAGCTTCCCAATTACTAAG BHQ1)	91	38
Babesia spp. Hepatozoon spp, Theileria spp., Hemolivia mauritanica	PCR	18S rRNA	BJ1- GTCTTGTAATTGGAATGATGGBN2- TAGTTTATGGTTAGGACTACG	411–452	39
Leishmania spp.	Real-time -PCR taqman prob	ITS1 (ITS1 region between the SSU and 5.8S rRNA genes)	LITSR- CTGGATCATTTTCCGATGITS1R- GAAGCCAAGTCATCCATCGCProbe: LC640-GCGGGGTGGGTGCGTGTGTG—PH	270–292	40
Toxoplasma gondii	Real-time-PCR /Evagreen	B1 gene	TOXO-F- TCCCCTCTGCTGGCGAAAAGTTOXO-R- AGCGTTCGTGGTCAACTATCGATTG	98	41

Sequencing and phylogenetic analysis

PCR positive samples were purified and sequenced in one direction at a commercial sequencing service provider (Macrogen, Netherlands). Nucleotide sequences were analyzed using nucleotide Blast (National Centre for Biotechnology Information, www.blast.ncbi.nlm.nih.gov/Blast). Representative nucleotide sequences from this study were submitted to GenBank under accession numbers MF383491-MF383615 and MF494656-MF494660. A phylogenetic tree was constructed using the MEGA5.1 program.

Results

A total of 322 ticks were collected from humans and identified as Hyalomma marginatum (n = 164, 50.9%), Hyalomma excavatum (n = 5; 1.5%), Hyalomma aegyptium (n = 1; 0.31%), Hyalomma spp. (n = 46; 14.3%), Haemaphysalis parva (n = 41; 12.7%), Haemaphysalis punctata (n = 6; 1.8%), Haemaphysalis sulcata (n = 1; 0.31%), Rhipicephalus turanicus (n = 34; 10.5%), Rhipicephalus bursa (n = 3; 0.93%), Dermacentor marginatus (n = 17; 5.2%) and Ixodes ricinus (n = 4; 1.24%). Overall, 37.2% of the examined ticks were infected with at least one pathogen; 3.7% of which with two different pathogens. The infection rate was 100% in Dermacentor spp., 89% in Haemaphysalis spp., 75% in Ixodes spp., 37% in Hyalomma spp. and 27% in Rhipicephalus spp. A total of 17 microorganism species were identified (Table 2). The most prevalent Rickettsia spp. being R. aeschlimannii (19.5%), R. slovaca (4.5%), R. raoultii (2.2%), R. hoogstraalii (1.9%), R. sibirica subsp. mongolitimonae (1.2%), R. monacensis (0.31%), and Rickettsia spp. (1.2%). In addition, the following pathogens were identified: Borrelia afzelii (0.31%), Anaplasma spp. (0.31%), Ehrlichia spp. (0.93%), Babesia microti (0.93%), Babesia ovis (0.31%), Babesia occultans (3.4%), Theileria spp. (1.6%), Hepatozoon felis (0.31%), Hepatozoon canis (0.31%), and Hemolivia mauritanica (2.1%). Table 3 shows the presence of bacterial pathogens according to the tick species, while in Table 4 the distribution of protozoan pathogens can be seen. All samples were negative for Francisella tularensis, Coxiella burnetii, Bartonella spp., Toxoplasma gondii and Leishmania spp.

Table 2

Total number and percentage of pathogens found in the 322 examined ticks, the percentage of their nucleotide identity and their accession number in NCBI GenBank.

Detected pathogens n / %		n / %	Nucleotide identity (%)	GenBank accession no.
Rickettsia spp.100/31	R. aeschlimannii	63/19.5	99–100	MF383515- MF383577
	R. slovaca	15/4.6	99–100	MF383578- MF383592
	R. raoultii	7/2.2	99–100	MF383593- MF383599
	R. hoogstraalii	6/1.9	99–100	MF383600- MF383605
	R. sibirica subsp. mongolitimonae	4/1.2	99–100	MF383606- MF383609
	R. monacensis	1/0.31	98	MF383610
	Rickettsia spp.	4/1.2	90–99	-
Ehrlichia spp.		3/0.93	99–100	MF383611- MF383613
Anaplasma spp.		1/0.31	81	MF383615
Borrelia afzelii		1/0.31	100	MF383614
Babesia spp.15/4.7	B. microti	3/0.93	99–100	MF383491- MF383493
	B. occultans	11/3.4	99–100	MF383494-MF383504
	B. ovis	1/0.31	99	MF383505
Hepatozoon spp.2/0.62	Hepatozoon canis	1/0.31	99	MF383514
	Hepatozoon felis	1/0.31	99	MF383513
Hemolivia mauritanica		7/2.1	99–100	MF383506- MF383512
Theileria spp.		5/1.6	90–92	MF494656- MF494660

Table 3

Presence of bacterial pathogens in tick species isolated from humans in the Corum province.

Tick species	N	R. aeschlimannii	R. slovaca	R. raoultii	R. hoogstraalii	R. sibiricasubsp. mongolitimonae	R. monacensis	Rickettsia spp.	Ehrlichia spp.	Anaplasma spp.	B. afzelii
H. marginatum	164	29	1	4	-	1	-	3	1
Hyalomma spp.	46	11	1	1	-	-	-		1
H. excavatum	5	-	-	-	-	1	-	-
H. aegyptium	1	1
R. turanicus	34	7	-	-	-	-	-	-
R. bursa	3					1
Hae. parva	41	9	2	-	4	1	-	1	1	1
Hae. punctata	6	1			2
Hae. sulcata	1	1	-	-	-	-	-	-
D. marginatus	17	3	11	2
I. ricinus	4	1	-	-	-	-	1	-			1
Total	322	63	15	7	6	4	1	4	3	1	1

Table 4

Presence of protozoan pathogens in tick species isolated from humans in the Corum province.

Tick species	N	Babesia microti	Babesia occultans	Babesia ovis	Theileria spp.	Hepatozoon canis	Hepatozoon felis	H. mauritanica
H. marginatum	164	3	10	-	2	-	-	-
Hyalomma spp. (nymph)	46	-	1	-	3	-	-	7
R. turanicus	34	-	-	-	-	-	1	-
R. bursa	3	-	-	1	-	-	-	-
D. marginatus	17	-	-	-	-	1	-	-
Total	322	3	11	1	5	1	1	7

Discussion

Recently, a lot of attention is being given to ticks and tick-borne diseases in Turkey, were many individuals died as a result of CCHF [1,3,4]. Table 5 summarizes the studies done on ticks and their pathogens in the seven main regions of Turkey (Fig 2) [8,12,14,24-27,42-83].

Table 5

Tick-borne pathogens recorded in Turkey by regions.

Marmara Region
Provinces	Tick-borne pathogens	Method	Hosts	Ref.
Istanbul	R. monacensis, R. aeschlimannii,R. conorii subsp. conorii, R. helvetica,R. raoultii, R. africae, R. felis	Nested PCR	Ticks (I. ricinus, R. sanguineus, H. aegyptium, Hyalomma spp., H. marginatum, D. marginatus)	24
	Rickettsia spp, B. burgdorferi s.l.	Semi Nested PCR	Ticks (D. marginatus, H. aegyptium, H. aegyptium, Haemaphysalis spp., Ixodes spp., I. ricinus,R. bursa, R. sanguineus gr.)	42
Thrace region	R. conorii	PCR in skin biopsies	Human	43
Thrace (including a recreational park Zekeriyakoy, Belgrad Forest in the Istanbul metropolitan area)	B. burgdorferi s.s.,B. garinii (Eurasian type), B. afzelii,B. lusitaniae, B. valaisiana	PCR	Ticks (I. ricinus)	44
Istanbul	B. canis, B. vogeli, B. rossi	PCR	Dogs	25
Adana, Aydin, Bursa, Hatay, Istanbul UrfaKars, Kirikkale Sivas,	B. vinsonii subsp. berkhoffii	IFA	Dogs	45
Istanbul	F. tularensis	Microagglutination	Human	46
Istanbul, Kirklareli	A. phagocytophilum, B. burgdorferi s.l.	PCR	Ticks (I. ricinus)	47
Agean Region
Provinces	Tick-borne pathogens	Method	Hosts	Ref
Aydin	T. annulata	IFA	Cattle	48
Aydin and Denizli	B. henselae	IFA	Human	14
Aydin	A. centrale, A. marginale, A. phagocytophilum	PCR	Cattle, Ticks (H. marginatum, H. excavatum)	49
Adana, Aydin, Bursa, Hatay, Istanbul, UrfaKars, Kirikkale, Sivas	B. vinsonii subsp. berkhoffii	IFA	Dogs	45
Manisa	West Nile virus, CCHFV, F. tularensis,B. burgdorferi	ELISA, IFA, WB	Human	50
Central Anatolia Region
Provinces	Tick-borne pathogens	Method	Hosts	Ref
Kirklareli	A. marginale	Nested PCR	Cows	51
Ankara	B. crassa, B. major, B. occultans, B. rossi,B. burgdorferi s.s.,R. aeschlimannii, R. slovaca, R. hoogstraalii	PCR and sequencing analysis.	Ticks (Haemaphysalis, Hyalomma, Ixodes Rhipicephalus)	26
	B. caballi, B (T.). equi	PCR	Horses	52
	E. canis		Dogs	53
	B. vinsonii subsp. berkhoffii			54
Kayseri	E. canis, B. canis canis, B. gibsoni,A. phagocytophilum, H. canis, B. canis vogeli	Real Time PCR	Dogs	55
Yozgat	R. aeschlimannii, R. hoogstraalii, R. raoultii,R. slovaca	PCR	Ticks (H. marginatum, H. parva, D. marginatus)	56
	F. tularensis	Microagglutination	Human	57
Ankara	B. henselae, Bartonella clarridgeiae	Culture	Cats	12
Ankara	B. ovis, T. ovis, CCHFV	PCR	Anatolian wild sheep and ticks (Rh. bursa, H. excavatum)	58
Konya	B. canis vogeli, H. canis, Hepatozoon sp. MF, Mycoplasma. haemocanis, M. haematoparvum	PCR	Dogs	59
Konya	B. ovis	IFAT	Sheep	60
Sivas	B. bigemina, B. bovis	IFAT	Cattle	61
Sivas, Amasya	Rickettsia spp., Francisella, Coxiella, Neisseriaceae, Enterobacteriaceae, Francisella, Coxiella, Shigella	PCR	Ticks (R. (B.) annulatus, D. marginatus)	62
Adana, Aydin, Bursa, Hatay, Istanbul UrfaKars, Kirikkale Sivas,	B. vinsonii subsp. berkhoffii	IFA	Dogs	45
Black Sea Region
Provinces	Tick-borne pathogens	Method	Hosts	Ref
Bolu, Kastamonu, Corum, Samsun, Tokat, Giresun, Bayburt provinces of the Black Sea region of Turkey	T. ovis, B. ovis, B. bigemina, B. microti	PCR	Ticks (R. bursa, R. turanicus, R. sanguineus, H. parva,H. marginatum, I. ricinus)	63
Sinop	B. microti	IFA	Human	64
Middle and Eastern Black Sea	A. phagocytophilum	IFAT, PCR, microscopy	Sheep and cattle	8
Tokat, Amasya, Gumushane, Giresun, Trabzon, Rize.	T. annulata, T. buffeli/orientalisB. bigemina, B. major, Babesia sp.	reverse line blot	Cattle	65
Bartin	B. bovis, B. bigemina, B. divergens, B. occultans	reverse line blot	Cattle and ticks (R. (B.) annulatus)	66
Giresun, Trabzon, Rize	A. phagocytophilum	Nested PCR	Ticks (I. ricinus, Ixodes spp.)	67
Giresun, Trabzon, Rize, Tokat, Amasya, Gumushane	A. marginale, A. centrale, A. phagocytophilum, A. ovis, Ehrlichia	PCR	Cattle	68
Giresun, Trabzon, Rize, Tokat, Amasya, and Gumushane	T. buffeli/orientalis, Babesia spp., Anaplasma/Ehrlichia spp., A. centrale,A. phagocytophilum	PCR	Ticks (R. bursa, R. (B.) annulatus,H. excavatum, H. marginatum)	69
Ordu	C. burnetii	IFAT IgG	Human	70
Sivas, Amasya,	Rickettsia spp., Francisella, Coxiella, Neisseriaceae, Enterobacteriaceae, Shigella	PCR	Ticks (R. (B.) annulatus, D. marginatus)	62
Corum	R. aeschlimannii, R. sibirica mongolitimonae,R. raoultii, R. slovaca	PCR	Ticks (H. marginatum, D. marginatus)	27
Tokat	R. aeschlimannii, R. sibirica mongolitimonae	PCR	Ticks (H. marginatum)	71
Eastern Anatolia Region
Provinces	Tick-borne pathogens	Method	Hosts	Ref
Erzincan	T. annulata, T. buffeli/orientalis	reverse line blotting	Cattle	72
Kars	B (T). equi	IFA	Horses	73
Igdir	E. canis	ELISA	Dogs	74
Elazig, Malatya, Mus Tunceli, Bingol, Bitlis,	C. burnetii	PCR	Sheep	75
Elazig	Ehrlichia spp., A. platys, A. ovis	PCR & sequence	Ticks (H. anatolicum, R. bursa, R. sanguineus)	76
Erzincan	C. burnetii	ELISA	Human	77
Erzurum	B. canis, Hepatozoon spp., H. canis,D. immitis, E. canis	Nested PCR	Dogs	78
Elazig	B. ovis	PCR	Sheep, goats, ticks (R. bursa)	79
Erzurum	T. equi, B. cabali	Multiplex PCR	Horses	80
Souteastern Anatolia Region
Provinces	Tick-borne pathogens	Method	Hosts	Ref
Adana Gaziantep Adiyaman	Babesia ovis, Theileria annulata	PCR	Ticks (R. bursa, R. turanicus, H. excavatum, H. parva, H. anatolicum)	81
Diyarbakir	Babesia sp., B. canis, B. vogeli, H. canis	Nested PCR	Dogs	82
	H. canis, H. felis	PCR	Ticks (R. sanguineus)	83
Adana, Aydin, Bursa, Hatay, Istanbul UrfaKars, Kirikkale Sivas,	B. vinsonii subsp. berkhoffii	IFA	Dogs	45

Fig 2

Seven main regions of Turkey.

In Corum province, 10 tick species infesting humans were identified, the most prevalent being H. marginatum, Hae. parva, R. turanicus and D. marginatus. Similar results from the same region has been obtained by Keskin et al., [84, 85], who, in addition to the tick species found in the present study, also reported the infestation of humans with Haemaphysalis erinacei taurica and Ixodes laguri. In their study the most prevalent tick species isolated from humans were H. marginatum, D. marginatus, R. turanicus and R. bursa. The differences could be explained with the changes in tick abundance according to climatic conditions, host factors, socio-demographic factors, deforestation, as well as agricultural and wildlife management [86].

In the present study all D. marginatus specimens were infected with at least one pathogen, while the infection rate was high also in Haemaphysalis spp. Orkun et al. who investigated tick pathogens in Ankara province found high infection rate of Rickettsia spp., Babesia spp., and Borrelia spp. in the same tick species [26].

Rickettsia spp. was identified as the most prevalent tick-borne pathogen in this study (31%). Other studies reported an average infection rate of 41.3 in Istanbul [24], while in Yozgat province the rate was 10.5% [56], and in Ankara province 27.2%[26].

Rickettsia aeschlimannii is commonly transmitted by Hyalomma and Rhipicephalus spp. [2]. In Turkey, R. aeschlimannii was detected in H. marginatum, H. aegyptium, H. excavatum, R. bursa and R. turanicus ticks [24,26,56,87,88]. In our study, this pathogen was found in all tick species examined with the exception of H. excavatum and R. bursa. To the best of our knowledge, this is the first report that R. aeschlimannii was found in Haemaphysalis spp., Dermacentor spp., and Ixodes spp. ticks, indicating that the pathogen might be transmitted also by other tick species. According to nucleotide Blast and phylogenetic analysis (ompA) (Annex 1), R. aeschlimannii strains in our study is closely related with R. aeschlimannii isolate BB-35/Camli-H.marg (99–100% identity, accession number KF791251).

Rickettsia aeschlimannii was the most prevalent (19.5%) pathogen among Rickettsia-positive ticks in this study. In an investigation which was performed in 2009 in Corum province, R. aeschlimannii was found in 5% of the ticks [87], while in Ankara and Yozgat provinces, where similar climatic conditions prevail, this pathogen was detected in 4.7% and 4.3%, respectively of ticks examined [26,56]. It was reported that R. aeschlimannii infections exhibited symptoms similar to Mediterranean spotted fever (MSF) [89], and potentially lead to severe symptoms resembling to those of viral hemorrhagic fever [17]. Accordingly, R. aeschlimannii infection should be included in the differential diagnosis, especially in endemic regions of MSF.

Rickettsia slovaca is usually transmitted by Dermacentor ticks and is associated with symptoms characterized by inoculation eschar on the scalp, necrosis erythema and cervical lymphadenopathy [2,24,56,88,90]. This disease is either called tick-borne neck lymphadenopathy (TIBOLA) or Dermacentor-borne necrosis erythema and lymphadenopathy (DEBONEL) [90]. Incidence of R. slovaca infections is likely underestimated. Parola et al. reported that in 49 out of 86 (57%) TIBOLA/DEBONEL cases the etiologic agent was R. slovaca [90]. Throughout Europe, Dermacentor marginatus and Dermacentor reticulatus ticks are responsible from transmission of this pathogen [90]. In our study, in addition to Dermacentor spp. ticks, this pathogen was for the first time also detected in H. marginatum, Hyalomma spp. nymphs and Hae. parva (Table 3). Nucleotide Blast and phylogenetic analysis (ompA,) of R. slovaca Corum strains were 99% identical to R. slovaca isolate BB-51/Akyurt-D.marg (accession number KF791235) (Annex 1), while the gltA gene of R. slovaca Corum strains (Annex 2), showed a 99% identity to R. slovaca strain PotiR30 (accession number DQ821852). In the present study R. slovaca was detected in 4.6% of the ticks. In similar studies conducted earlier, R. slovaca was found in 0.3% of ticks in Corum [87], in 4.8% in Yozgat province [56], and in 9.4% in Ankara province [26].

Similar to R. slovaca, R. raoultii is also the etiological agent of TIBOLA/DEBONEL and this Rickettsia seems to be less pathogenic and less frequent than R. slovaca [90]. Parola et al reported that in 7 out of 86 (8%) TIBOLA/DEBONEL cases the etiologic agent was R. raoultii [90]. Dermacentor ticks are known vectors of R. raoultii [24,56,88]. In the present study, in addition to Dermacentor spp., R. raoultii was also found in H. marginatum and Hyalomma spp. nymphs (Table 3). The nucleotide Blast and phylogenetic analysis of gltA gene of Corum R. raoultii strains (Annex 2) share a 99% sequence identity to R. raoultii clone Ds1 (accession number KF003009) and accordingly to ompA genes (Annex 1). In addition, a 99% similarity was found to R. raoultii strain WB16/Dm Monterenzio (accession number HM161789). Rickettsia raoultii was detected in 2.2% of the ticks examined. Earlier studies from Corum reported that the percentage was 0.3% [27] and in Yozgat province 0.4% [56], while this rickettsia was not detected in ticks from the Ankara region [26]. In Corum province, the rate of R. slovaca and R. raoultii in ticks infesting humans increased in comparison to 2009, and it seems that these pathogens are extending their vector diversity.

Rickettsia hoogstraalii has an unknown pathogenicity and it is transmitted by Hae. Parva [26,56,88], however, we found it in Hae. parva and Hae. punctata ticks. The nucleotide Blast and phylogenetic analysis of gltA gene of Corum R. hoogstraalii strains (Annex 2) have a 99% similarity to R. hoogstraalii strain RCCE3 with accession number EF629539. In our study the prevalence of R. hoogstraalii was 1.9%, while in Yozgat was 0.87% [56], and in Ankara 13% [26].

Rickettsia sibirica subsp. mongolitimonae, symptoms are characterized by fever, eschar and lymphadenopathies [91] and it is transmitted by ticks such as Hyalomma asiaticum, Hyalomma truncatum, H. excavatum and R. bursa [2,91-93]. We found this pathogen in H. marginatum, H. excavatum, R. bursa, and Hae. parva ticks. To the best of our knowledge this is the first detection of this pathogen in Hae. parva ticks. Nucleotide Blast and phylogenetic analysis of R. sibirica subsp. mongolitimonae Corum strains (ompA) (Annex 1), showed a 99% identity to R. sibirica subsp. mongolitimonae Bpy1 (accession number KT345980). In this study this Rickettsia species was detected earlier in 1.2% of the ticks, while it was reported in 0.3% of H. marginatum ticks in Corum [87] and in 0.25% of ticks in Tokat province [71].

Rickettsia monacensis infection shows flu-like symptoms, eschar and rash, the main vector of this pathogen being Ixodes ricinus [91]. In Anatolian region of Turkey this tick species is rare [3]. The ompA genes of Corum R. monacensis, which was detected also in our study in I. ricinus ticks, showed 99% identity with R. monacensis isolate Est1623 (accession number KT119437) (Annex 1). In previous studies this pathogens was not found in the Ankara and Yozgat provinces [26,56], whereas the infection rate was 30.5% in ticks infesting humans in Istanbul [24]

Ehrlichia spp. effect both humans and animals such as dogs and domestic ruminants with symptoms like fever, malaise, leucopenia, thrombocytopenia, and abnormal liver function [94]. The vectors of this pathogen are Amblyomma, Dermacentor, Rhipicephalus, Ixodes and Haemaphysalis ticks [2,94]. In this study, Ehrlichia spp. were detected in 0.93% of H. marginatum, Hyalomma spp. nymphs and Hae. parva. Nucleotide Blast and phylogenetic analysis of groEL genes of Corum Ehrlichia spp. strain (Annex 3) was 99% identical to Ehrlichia ewingii isolate AaFT81 GroEL.

In Turkey, bovine anaplasmosis was detected in I. ricinus ticks which were collected from cattle in the cost of Black Sea [67]. In the present study, Anaplasma spp. was found in Hae. parva ticks. Nucleotide Blast and phylogenetic analysis of groEL genes of Corum Anaplasma spp. strain shared an 81% identity to Anaplasma phagocytophilum isolate Omsk-vole52 with accession number KF745743, (Annex 3).

Coxiella burnetii is the etiological agent of Q-fever with flu-like symptoms and is considered as a zoonotic disease. The role of ticks in the transmission of C. burnetii to humans is low [95]. In present study this pathogen was not detected in ticks infesting humans.

Borrelia afzelii is the pathogenic agent of Lyme disease transmitted mainly by ticks belonging to the genus Ixodes. This pathogen is known from Europe, western parts of the former USSR and Northern Africa [2]. We detected it in one I. ricinus specimen. According to flagelline gene sequence analyses B. afzelii Corum strain was 100% identical to B. afzelii strain S60 with accession number KM198345 (Annex 4). Orkun et al. reported the presence of Borrelia burgdorferi sensu stricto in 3.5% of Hyalomma spp. and Hae. parva in Ankara province [26]. Lyme disease pathogens are prevalent in Istanbul region which has a moderate and wet climate and the infection rate in ticks collected from different areas was 38.7% [47]. Francisella tularensis is the causative agent of tularemia a severe zoonotic diseases affecting animals and humans. This pathogen was isolated from the bird-rabbit tick, Haemaphysalis leporispalustris [95] and from Dermacentor reticulatus infesting red foxes [96]. In Turkey, tularemia cases were generally transmitted as water-borne but there are few tick-borne cases [46,57,97]. F. tularensis was neither found in ticks collected from several barns, cattle and people [98], nor in the ticks of the present study.

Bartonella spp. are zoonotic vector-borne infection agents of humans. One of them, B. henselae is the pathogenic agent of cat-scratch disease, the main vector being the cat flea (Ctenocephalides felis) [12], however a direct link between tick bites, B. henselae and disease symptoms was reported in humans [99]. In the present study B. henselae was not detected in any of the ticks examined.

Babesia spp. are the pathogenic agents of babesiosis in humans and animals, which are considered as emerging diseases worldwide [86]. In Europe, infection rates of Babesia spp. in ticks ranges from 0.9 to 20% [100]. B. microti is pathogenic to humans causing malaria-like symptoms. The geographical distribution of this pathogen is USA, Canada, and Europe while the main vector is Ixodes spp. [2,100]. In USA, the prevalence of B. microti in ticks was 8.4% [101], while in ticks collected from vegetation in Poland was 2.8% [102]. In addition to Ixodes spp., B. microti was also detected in 0.7% of Dermacentor reticulatus in Switzerland [39]. In Turkey, B. microti was for the first time detected in one I. ricinus tick collected from a ruminant [63]. In Sinop province of Turkey, the sero-prevalence of B. microti in humans was 6.23% [64], while in the present study, the prevalence of B. microti in H. marginatum ticks was 0.93%. According to 18SrRNA gene nucleotide Blast and phylogenetic analysis, B. microti Corum strains were 100% identical to B. microti isolate RUS/Nov15-2950-Ipr with accession number KX987864 (Annex 5). This is the first report showing the presence of B. microti in H. marginatum infesting humans, which is the most prevalent tick species in Corum province and is the main vector for B. microti.

Babesia occultans is a bovine parasite with high prevalence in South Africa, the vectors being Hyalomma spp. [2]. In Turkey, presence of B. occultans was reported by Aktas et al. in H. marginatum and R. turanicus collected from the vegetation, agricultural fields and grazing cattle, with a prevalence rate of 7%; transstadial and transovarial transmission of B. occultans were also demonstrated [103]. Orkun et al. reported this pathogen in 0.6% of H. marginatum infesting humans [26]. In our study B. occultans was present in 3.4% of H. marginatum, strongly supporting the presence of this pathogen not only in ticks infesting animals but also humans. The 18SrRNA genes of Corum B. occultans strains showed a 99% similarity to B. occultans isolate Trender1with accession number KP745626 (Annex 5).

Babesia ovis is the causative agent of sheep babesiosis and mainly prevalent in Africa, Asia, and Europe, the vectors of this pathogen are R. bursa and R. turanicus [2]. In Turkey, in ticks collected from sheep and goats the prevalence was 16.37% [79]. B. ovis was detected by us in one R. bursa infesting a patient. According to 18SrRNA gene nucleotide Blast and phylogenetic analyses (Annex 5), B. ovis Corum strains was 99% identical to B. ovis isolate tick20.3D with accession number KT587794 (Annex 5).

Recent studies show that ticks collected from cats and dogs may be responsible for the transmission of Toxoplasma gondii [21]. Leishmania infantum was also found on ticks infesting dogs [22]. In our study, these agents could not be detected.

Hepatozoon canis and Hepatozoon felis are the causative agents of hepatozoonosis in dogs and cats. These pathogens are transmitted by Rhipicephalus sanguineus, Hae. longicornis, and R. turanicus [2]. In Turkey, H. canis and H. felis were for the first time identified in R. sanguineus ticks removed from dogs [83], while H. canis infection was also reported in dogs [104]. We demonstrated the presence of H. canis in D. marginatus and of H. felis in R. turanicus. The 18SrRNA genes of Corum H. canis strain showed a 99% similarity to H. canis isolate 204B/13b (accession number KP216425), while the Corum H. felis strain showed a 99% similarity to H. felis, clone 8533, accession number KC138533 (Annex 5).

Theileria spp. are the pathological agents of theileriosis of ruminants, equids and felids, the vectors being ticks from the genera Hyalomma and Rhipicephalus [1,2]. A transstadial but not transovarial transmission was reported in these ticks [105]. In our study Theileria spp. was demonstrated in Hyalomma spp. infesting humans and the prevalence rate was 1.6%. According to 18SrRNA genes, the Corum strain of Theileria spp showed a 92% similarity to Theileria youngi (accession number AF245279) (Annex 5).

Hemolivia mauritanica is a pathogen of tortoises and transmitted by H. aegyptium [106]. In the present study, this pathogen was found only in Hyalomma spp. nymphs infesting humans and the prevalence rate was 2.1%. According to 18SrRNA genes, Corum H. mauritanica strains showed a 99% similarity to H. mauritanica isolate SY-45-10 (accession number KF992707 (Annex 5).

In conclusion, ticks in Corum province carry a large variety of human and zoonotic pathogens. There are indications showing that there is an increase in the rate of ticks carrying spotted fever group and lymphangitis-associated Rickettsiae, while Ehrlichia spp. and Anaplasma spp. were reported for the first time in the region. To the best of our knowledge B. microti was detected for the first time in H. marginatum infesting humans. The presence of pathogens such as B. occultans, B. ovis, Hepatozoon spp., Theileria spp. and H. mauritanica show the role of ticks for diseases of veterinary importance. Pathogens are detected not only in ticks known as vectors but in a variety of other ticks, indicating wider vector diversity. Patients with a tick bite history in Corum region should be followed not only for CCHF but also for other pathogens of medical importance.

Phylogenetic tree of rickettsial ompA gene.

Phylogenetic tree based on aligned sequences of the rickettsial ompA gene, constructed using UPMGA in MEGA5.1 software. GenBank accession numbers of the Rickettsiae are given after the names of bacteria.

(TIF)

Click here for additional data file.

Phylogenetic tree of rickettsial gltA gene.

Phylogenetic tree based on aligned sequences of the rickettsial gltA gene, constructed using UPGMA in MEGA5.1 software. GenBank accession numbers of sequences are given after the names of bacteria.

(TIF)

Click here for additional data file.

Phylogenetic tree of Ehrlichia heat shock protein (groEL) gene.

Phylogenetic tree based on aligned sequences of the heat shock protein (groEL) gene, constructed using UPGMA in MEGA5.1 software. GenBank accession numbers of sequences are given after the names of bacteria.

(TIF)

Click here for additional data file.

Phylogenetic tree of Borrelia flaB gene.

Phylogenetic tree based on aligned sequences of the Borrelia flaB gene, constructed using UPGMA in MEGA5.1 software. GenBank accession numbers of sequences are given after the names of bacteria.

(TIF)

Click here for additional data file.

Phylogenetic tree of 18S ribosomal RNA gene.

Phylogenetic tree based on aligned sequences of 18S ribosomal RNA gene, constructed using UPGMA in MEGA5.1 software. GenBank accession numbers of sequences are given after the names of the protozoa.

(TIF)

Click here for additional data file.