Literature DB >> 29499945

circ-SHKBP1 Regulates the Angiogenesis of U87 Glioma-Exposed Endothelial Cells through miR-544a/FOXP1 and miR-379/FOXP2 Pathways.

Qianru He1, Lini Zhao1, Yunhui Liu2, Xiaobai Liu2, Jian Zheng2, Hai Yu2, Heng Cai2, Jun Ma1, Libo Liu1, Ping Wang1, Zhen Li2, Yixue Xue3.   

Abstract

Circular RNAs (circRNAs) are a type of endogenous non-coding RNAs, which have been considered to mediate diverse tumorigenesis including angiogenesis. The present study aims to elucidate the potential role and molecular mechanism of circ-SHKBP1 in regulating the angiogenesis of U87 glioma-exposed endothelial cells (GECs). The expression of circ-SHKBP1, but not linear SHKBP1, was significantly upregulated in GECs compared with astrocyte-exposed endothelial cells (AECs). circ-SHKBP1 knockdown inhibited the viability, migration, and tube formation of GECs dramatically. The expressions of miR-379/miR-544a were downregulated in GECs, and circ-SHKBP1 functionally targeted miR-544a/miR-379 in an RNA-induced silencing complex (RISC) manner. Dual-luciferase reporter assay demonstrated that forkhead box P1/P2 (FOXP1/FOXP2) were targets of miR-544a/miR-379. The expressions of FOXP1/FOXP2 were upregulated in GECs, and silencing of FOXP1/FOXP2 inhibited the viability, migration, and tube formation of GECs. Meanwhile, FOXP1/FOXP2 promoted angiogenic factor with G patch and FHA domains 1 (AGGF1) expression at the transcriptional level. Furthermore, knockdown of AGGF1 suppressed the viability, migration, and tube formation of GECs via phosphatidylinositol 3-kinase (PI3K)/AKT and extracellular signal-regulated kinase (ERK)1/2 pathways. Taken together, the present study demonstrated that circ-SHKBP1 regulated the angiogenesis of GECs through miR-544a/FOXP1 and miR-379/FOXP2 pathways, and these findings might provide a potential target and effective strategy for combined therapy of gliomas.
Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Entities:  

Keywords:  FOXP1/FOXP2; angiogenesis; circ-SHKBP1; circular RNA; gliomas; miR-544a/miR-379

Year:  2017        PMID: 29499945      PMCID: PMC5862134          DOI: 10.1016/j.omtn.2017.12.014

Source DB:  PubMed          Journal:  Mol Ther Nucleic Acids        ISSN: 2162-2531            Impact factor:   8.886


Introduction

Malignant gliomas are the most common primary cancers in the central nervous system. Despite advances in surgery, radiation therapy, chemotherapeutics, and molecular targeted therapy, the mortality rate of malignant gliomas remains obstinately high. Gliomas are typical vascular-dependent solid cancers.2, 3 Glioma angiogenesis is a vital event in the progression of malignant gliomas and a major obstacle for effective treatment, although it is different from normal vasculogenesis. It is described as a complicated process involving proliferation, migration, tube formation of endothelial cells, and degradation of extracellular matrix.4, 5 Due to the effect of autocrine and paracrine, various factors such as vascular endothelial growth factor (VEGF), basic fibroblast growth factor (bFGF), and matrix metallopeptidase 9 (MMP-9) were secreted by vascular endothelial cells and glioma cells to promote cellular growth.6, 7 Therefore, anti-angiogenesis therapeutics is considered as a key point of the treatment for malignant glioma.8, 9 Circular RNA (circRNA) is a newly discovered class of endogenous non-coding RNAs whose covalently closed loop structure is relatively stable without 5′-cap and 3′-polyadenylated tail. circRNA is considered to have characteristics of highly abundant, relatively stable, and evolutionally conserved in vivo compared with their linear counterparts. The majority of circRNAs identified in animal cells are composed of exonic circRNAs, which are localized in cytoplasm. The biological function of circRNA has drawn considerable attention in the last few years, especially in the development and progression of tumor and inflammation. As reported in the relevant research of circRNA and tumor, some circRNAs serves as competitive endogenous RNA (ceRNAs), also known as microRNA (miRNA) sponge, to regulate downstream gene expression at the transcriptional or post-transcriptional level.11, 12 Some circRNAs can be regarded as biomarkers for diagnosis and potential targets for tumor treatment. Salzman et al. performed the analysis of circRNA expression profiles in different human cell samples and revealed multiple circRNAs were upregulated in endothelial cell lines, and high abundance of circ-SHKBP1 (hsa_circ_0000936) was found in many endothelial cells. However, the function of circ-SHKBP1 remains poorly defined. The biological functions of miRNA, a member of single-stranded non-coding RNAs, have been studied extensively.15, 16 miRNA, acting as either oncogene or tumor suppressor, is involved in the development and progression of various tumors and has become a biological marker for tumor diagnosis and prognosis.17, 18, 19 Both miR-379 and miR-544a are members of the miR-379-410 gene cluster, which is located on chromosome 14q32.31. miR-379/miR-544a exert different functions in different tumor tissues and cells. For example, miR-379 is highly expressed and promotes epithelial-to-mesenchymal transition and bone metastasis of prostate cancer. However, miR-379, acting as tumor suppressor, is significantly downregulated in chemo-resistant non-small-cell lung cancer tissues and cells, as well as malignant pleural mesothelioma.21, 22 Moreover, miR-379 presents lower expression in glioblastoma tissues and cells.23, 24 Additionally, miR-544a is upregulated and promotes migration and invasion in colorectal cancer cells, whereas miR-544 is significantly downregulated in osteosarcoma and glioblastoma tissues compared with low-grade gliomas tissues, indicating miR-544 may play the role of tumor suppressor, and its possible mechanism needs to be further investigated. Nevertheless, the roles of miR-544a/miR-379 in glioma-exposed endothelial cells (GECs) and their potential molecular mechanisms have not been clarified. Forkhead box (FOX) proteins are an evolutionarily conserved transcription factor family, which constitute a large group of transcription factors with an evolutionary conserved DNA-binding domain and play critical roles in regulating cell function. FOXP1 is upregulated and plays an oncogenic role in glioma tissues and U87 cells.29, 30 FOXP1 also participates in the regulation of vascular function. For example, FOXP1 promotes angiogenesis by repressing the inhibitory guidance protein semaphorin 5B in endothelial cells. Moreover, FOXP1 is upregulated in endothelial cells, smooth muscle cells, macrophages, and T cells of atherosclerotic plaque and is involved in the formation of stable plaques. As another member of the FOXP family, FOXP2 plays an important role in the development of language.33, 34 FOXP2 is upregulated in the SH-SY5Y human neuroblastoma cell line, and a high level of FOXP2 leads to poor overall and relapse-free survival in patients. FOXP2 is increased in ERG fusion-negative prostate cancer and is significantly linked to prostate-specific antigen (PSA) and Ki67 labeling index. FOXP2 is upregulated in CD138+ plasma cells of multiple myeloma and is involved in regulating the onset of multiple myeloma. At present, the expression level and role of FOXP2 in glioma-exposed vascular endothelial cells still remain unknown. Angiogenic factor with G patch and FHA domains 1 (AGGF1) is found to be a novel angiogenic protein, which is highly expressed in vascular endothelial cells. AGGF1, similar to VEGF, promotes angiogenesis in various pathological conditions including cancer. Recent studies have revealed that AGGF1 can promote angiogenesis by stimulating proliferation, migration, and sprouting of endothelial cells, and overexpression of AGGF1 leads to increased angiogenesis by activating the AKT pathway in zebrafish embryos.39, 40 However, it is entirely unknown whether AGGF1-mediated signaling pathways contribute to the roles of circ-SHKBP1 in the viability, migration, and angiogenesis of GECs in vitro. In the present study, we first investigated the endogenous expressions and functions of circ-SHKBP1, miR-379/miR-544a, FOXP1/FOXP2, and AGGF1 in GECs and further clarified the possible regulating relationships of the above-mentioned factors and their roles in angiogenesis of GECs in vitro. The aim is to provide a potential target for glioma treatment with regard to anti-angiogenesis.

Results

circ-SHKBP1, but Not Linear SHKBP1, Was Upregulated in Glioma Microvessels and GECs, and Knockdown of circ-SHKBP1 Inhibited the Angiogenesis of GECs and the Expression of AGGF1

To elucidate the expression levels of circ-SHKBP1, we captured human glioma microvessels from glioma tissue specimens, including high-grade glioma (HGG) and low-grade glioma (LGG), while normal brain microvessels were captured from normal brain tissues (NBTs). As shown in Figure 1A, the expression of circ-SHKBP1 was significantly increased in LGG (2.020 ± 0.2367-fold) and HGG (3.4580 ± 0.2831-fold) groups compared with that in the NBT group, and it was significantly increased in the HGG group (1.7119 ± 0.2154-fold) compared with the LGG group. The expression and localization of circ-SHKBP1 in GECs and astrocyte-exposed endothelial cells (AECs) were analyzed by qRT-PCR and fluorescence in situ hybridization (FISH). As shown in Figure 1B, the expression of circ-SHKBP1 was significantly upregulated (1.942 ± 0.1158-fold) in GECs compared with AECs. Simultaneously, FISH was performed to further ascertain the location of circ-SHKBP1. The result demonstrated circ-SHKBP1 localized in the cytoplasm of GECs and AECs, and the fluorescence in GECs was stronger than that in AECs (Figure 1C). However, there was no significant difference of linear SHKBP1 between GECs and AECs (Figure 1D). RNase R, an RNA exonuclease that degrades linear RNAs with short 3′ tails regardless of secondary structure but does not degrade circular forms, was used to confirm the circular form RNA. As Figures S1A and S1B showed, circ-SHKBP1 was resistant to RNase R treatment, while linear SHKBP1 was significantly reduced in AECs and GECs treated with RNase R. Then the shRNA of circ-SHKBP1 was transfected into cells to knock down circ-SHKBP1 to further explore the potential role of circ-SHKBP1 in GECs, and the transfection efficiency was shown in Figure S1C. In addition, the expression of SHKBP1 was detected after knockdown of circ-SHKBP1 to confirm the circular form instead of linear form of SHKBP1 was inhibited. As shown in Figure S1D, there was no significant difference in SHKBP1 expression between the circ-SHKBP1 (−) group and the circ-SHKBP1 (−) negative control (NC) group. Meanwhile, SHKBP1 was knocked down to detect whether sh-SHKBP1 influenced circ-SHKBP1 expression. Transfection efficiency of SHKBP1 was verified (Figure S1E), and there was also no significant change of circ-SHKBP1 expression between the sh-SHKBP1 group and short hairpin (sh)-NC group (Figure S1F). Furthermore, knockdown of circ-SHKBP1 significantly inhibited the viability, migration, and tube formation (black arrows pointing to tube structures; gray arrows pointing to tube branches) of GECs in the circ-SHKBP1 (−) group compared with the circ-SHKBP1 (−) NC group (Figures 1E–1G). The protein expression of AGGF1 in the circ-SHKBP1 (−) group was dramatically decreased compared with the circ-SHKBP1 (−) NC group (Figure 1H). These data suggest that knockdown of circ-SHKBP1 impaired the angiogenesis of human glioma.
Figure 1

circ-SHKBP1 Expression in Glioma Microvessels and GECs, and Knockdown of circ-SHKBP1 Inhibited the Angiogenesis of U87 Glioma and the Expression of AGGF1

(A) Normal brain microvessels and glioma microvessels were respectively captured from NBTs and glioma tissues using laser capture microdissection. Relative expressions of circ-SHKBP1 in normal brain microvessels or glioma microvessels were shown. Data represent means ± SD (n = 5, each group). **p < 0.01 versus NBTs group; ##p < 0.01 versus LGG group. (B) The relative expression of circ-SHKBP1 was detected in AECs and GECs by qRT-PCR. GAPDH was used as an endogenous control. Data represent means ± SD (n = 5, each group). **p < 0.01 versus AECs group. (C) FISH was used to determine the expression and location of circ-SHKBP1 in AECs and GECs (red, circ-SHKBP1; blue, DAPI nuclear staining). Scale bars represent 5 μm. (D) The relative expression of SHKBP1 was detected in AECs and GECs by qRT-PCR. GAPDH was used as an endogenous control. Data represent means ± SD (n = 5, each group). (E) The effects of circ-SHKBP1 knockdown on the viability of GECs were detected by CCK-8 assay. Values are means ± SD (n = 5, each group). **p < 0.01 versus circ-SHKBP1 (−) NC group. (F) The effects of circ-SHKBP1 knockdown on the migration of GECs were determined by Transwell assay. Values are means ± SD (n = 5, each group). *p < 0.05 versus circ-SHKBP1 (−) NC group. Scale bar represents 30 μm. (G) The effects of circ-SHKBP1 knockdown on the tube formation of GECs were evaluated by Matrigel tube formation assay (black arrows, tube structures; gray arrows, tube branches). Values are means ± SD (n = 5, each group). *p < 0.05; **p < 0.01 versus circ-SHKBP1 (−) NC group. Scale bar represents 30 μm. (H) The effects of circ-SHKBP1 knockdown on the expression of AGGF1 in GECs by western blot. GAPDH was used as an endogenous control. Values are means ± SD (n = 5, each group). **p < 0.01 versus circ-SHKBP1 (−) NC group.

circ-SHKBP1 Expression in Glioma Microvessels and GECs, and Knockdown of circ-SHKBP1 Inhibited the Angiogenesis of U87 Glioma and the Expression of AGGF1 (A) Normal brain microvessels and glioma microvessels were respectively captured from NBTs and glioma tissues using laser capture microdissection. Relative expressions of circ-SHKBP1 in normal brain microvessels or glioma microvessels were shown. Data represent means ± SD (n = 5, each group). **p < 0.01 versus NBTs group; ##p < 0.01 versus LGG group. (B) The relative expression of circ-SHKBP1 was detected in AECs and GECs by qRT-PCR. GAPDH was used as an endogenous control. Data represent means ± SD (n = 5, each group). **p < 0.01 versus AECs group. (C) FISH was used to determine the expression and location of circ-SHKBP1 in AECs and GECs (red, circ-SHKBP1; blue, DAPI nuclear staining). Scale bars represent 5 μm. (D) The relative expression of SHKBP1 was detected in AECs and GECs by qRT-PCR. GAPDH was used as an endogenous control. Data represent means ± SD (n = 5, each group). (E) The effects of circ-SHKBP1 knockdown on the viability of GECs were detected by CCK-8 assay. Values are means ± SD (n = 5, each group). **p < 0.01 versus circ-SHKBP1 (−) NC group. (F) The effects of circ-SHKBP1 knockdown on the migration of GECs were determined by Transwell assay. Values are means ± SD (n = 5, each group). *p < 0.05 versus circ-SHKBP1 (−) NC group. Scale bar represents 30 μm. (G) The effects of circ-SHKBP1 knockdown on the tube formation of GECs were evaluated by Matrigel tube formation assay (black arrows, tube structures; gray arrows, tube branches). Values are means ± SD (n = 5, each group). *p < 0.05; **p < 0.01 versus circ-SHKBP1 (−) NC group. Scale bar represents 30 μm. (H) The effects of circ-SHKBP1 knockdown on the expression of AGGF1 in GECs by western blot. GAPDH was used as an endogenous control. Values are means ± SD (n = 5, each group). **p < 0.01 versus circ-SHKBP1 (−) NC group.

Overexpression of miR-544a and miR-379 Inhibited the Angiogenesis of GECs In Vitro

As shown in Figures 2A and 2B, the endogenous expressions of miR-544a and miR-379 were significantly downregulated (0.6064 ± 0.1108 and 0.5283 ± 0.0987-fold) in GECs compared with AECs. Overexpression or silencing of miR-544a/miR-379 was performed to further understand their role in the angiogenesis of GECs, and the transfection efficiency was evaluated by qRT-PCR (Figures S1G and S1H). Overexpression of miR-544a/miR-379 inhibited the viability, migration, and tube formation of GECs, whereas silencing of miR-544a/miR-379 produced the opposite results (Figures 2C–2H). These data indicated that miR-544a and miR-379 significantly inhibited the angiogenesis of GECs.
Figure 2

Overexpression of miR-544a/miR-379 Suppressed Angiogenesis of U87 Glioma

(A and B) The relative expressions of miR-544a (A) and miR-379 (B) in AECs and GECs were detected by qRT-PCR. U6 was used as an inner control. Data represent means ± SD (n = 5, each group). *p < 0.05 versus AECs group. (C and D) The effects of miR-544a (C) and miR-379 (D) on the viability of GECs were determined by CCK-8 assay. Values are means ± SD (n = 5, each group). **p < 0.01 versus miR-544a/miR-379 (+) NC group; ##p < 0.01 versus miR-544a/miR-379 (−) NC group. (E and F) The effects of miR-544a (E) and miR-379 (F) on the migration of GECs by Transwell assay. Values are means ± SD (n = 5, each group). **p < 0.01 versus miR-544a/miR-379 (+) NC group; ##p < 0.01 versus miR-544a/miR-379 (−) NC group. Scale bar represents 30 μm. (G and H) The effects of miR-544a (G) and miR-379 (H) on the tube formation of GECs were evaluated by Matrigel tube formation assay (black arrows, tube structures; gray arrows, tube branches). Values are means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus miR-544a/miR-379 (+) NC group; #p < 0.05, ##p < 0.01 versus miR-544a/miR-379 (−) NC group. Scale bar represents 30 μm.

Overexpression of miR-544a/miR-379 Suppressed Angiogenesis of U87 Glioma (A and B) The relative expressions of miR-544a (A) and miR-379 (B) in AECs and GECs were detected by qRT-PCR. U6 was used as an inner control. Data represent means ± SD (n = 5, each group). *p < 0.05 versus AECs group. (C and D) The effects of miR-544a (C) and miR-379 (D) on the viability of GECs were determined by CCK-8 assay. Values are means ± SD (n = 5, each group). **p < 0.01 versus miR-544a/miR-379 (+) NC group; ##p < 0.01 versus miR-544a/miR-379 (−) NC group. (E and F) The effects of miR-544a (E) and miR-379 (F) on the migration of GECs by Transwell assay. Values are means ± SD (n = 5, each group). **p < 0.01 versus miR-544a/miR-379 (+) NC group; ##p < 0.01 versus miR-544a/miR-379 (−) NC group. Scale bar represents 30 μm. (G and H) The effects of miR-544a (G) and miR-379 (H) on the tube formation of GECs were evaluated by Matrigel tube formation assay (black arrows, tube structures; gray arrows, tube branches). Values are means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus miR-544a/miR-379 (+) NC group; #p < 0.05, ##p < 0.01 versus miR-544a/miR-379 (−) NC group. Scale bar represents 30 μm. Furthermore, overexpression of both miR-544a and miR-379 was simultaneously performed to detect the co-effects on the viability, migration, tube formation of GECs, and angiogenesis in vivo. As shown in Figure S2, the viability, migration, and tube formation of GECs were significantly inhibited in the miR-544 (+) + miR-379 (+) group compared with the miR-544 (+) + miR-379 (+) NC and miR-544 (+) NC + miR-379 (+) groups (Figure S2A–S2C). Matrigel plug assay in vivo was applied to further determine the angiogenesis in vivo. The co-transfection was conducted prior to the assessment of angiogenesis in vivo. Results revealed that the amount of hemoglobin in the miR-544 (+) + miR-379 (+) group was significantly decreased compared with the miR-544 (+) + miR-379 (+) NC and miR-544 (+) NC + miR-379 (+) groups (Figures S2D and S2E).

miR-544a/miR-379 Functionally Targeted circ-SHKBP1, but Not SHKBP1, and Reversed the circ-SHKBP1-Mediated Angiogenesis of GECs

Accumulated studies have reported that circRNA may serve as a competing endogenous RNA (ceRNA) or a molecular sponge to interact with miRNA.11, 12 To further ascertain the characteristics of circ-SHKBP1, we scanned SHKBP1 genomic DNA and circBase (http://www.circbase.org/) and found that exons 5 and 6 of the SHKBP1 gene formed an endogenous circRNA (Figure 3A). The spliced sequence of circ-SHKBP1 (hsa_circ_0000936) is shown in Figure 3B, which contains 205 bp. The putative binging site and sequences of miR-544a (blue) and miR-379 (green) were predicted with the help of starBase v2.0 (http://starbase.sysu.edu.cn/). Dual-luciferase reporter assay was conducted to verify this prediction. As expected, the relative luciferase activity was markedly suppressed (0.4934 ± 0.1050-fold) in the circ-SHKBP1 wild-type (WT) + miR-544a (+) group compared with that in the circ-SHKBP1 WT + miR-544a (+) NC group. Nevertheless, there was no significant difference between the circ-SHKBP1 mutant (Mut) + miR-544a (+) group and the circ-SHKBP1 Mut + miR-544a (+) NC group (Figure 3C). Additionally, similar results were achieved between circ-SHKBP1 and miR-379 (Figure 3D). Meanwhile, a potential target was identified in linear SHKBP1 with miR-544a/miR-379. As shown in Figures S1I and S1J, the relative luciferase activity was significantly reduced in the SHKBP1 WT + miR-544a (+) group and the SHKBP1 WT + miR-379 (+) group.
Figure 3

miR-544a/miR-379 Functional Targeted circ-SHKBP1

(A) Cartoon of circ-SHKBP1 arose from SHKBP1 gene by scanning SHKBP1 genomic DNA and circBase (blue, miR-544a binging site; green, miR-379 binging site). (B) The spliced sequence and putative binging site of circ-SHKBP1 (hsa_circ_0000936) are shown with the help of starBase v2.0 (blue, the putative binging site and sequences of miR-544a; green, the putative binging site and sequences of miR-379). (C and D) The putative binding sites between circ-SHKBP1 and miR-544 (C) and miR-379 (D) were predicted, and the relative luciferase activity was expressed as firefly/Renilla luciferase activity. Values are means ± SD (n = 5, each group). **p < 0.01 versus circ-SHKBP1 WT + miR-544a/miR-379 (+) NC group. (E and F) The expression of miR-544a (E) and miR-379 (F) was measured after knockdown of circ-SHKBP1 by qRT-PCR. U6 was used as an inner control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus circ-SHKBP1 (−) NC group. (G and H) miR-544a (G) and miR-379 (H) regulated the expression of circ-SHKBP1 in GECs. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus miR-544a/miR-379 (+) NC group; ##p < 0.01 versus miR-544a/miR-379 (−) NC group. (I–L) miR-544a/miR-379 was identified in the circ-SHKBP1-RISC complex. Relative expressions of circ-SHKBP1 (I), miR-544a (J), circ-SHKBP1 (K), and miR-379 (L) were measured using qRT-PCR. Data represent means ± SD (n = 5, each group). *p < 0.05 versus anti-IgG group; #p < 0.05 versus anti-Ago2 in control group. (M and N) The co-effects of circ-SHKBP1 and miR-544a (M) and circ-SHKBP1 and miR-379 (N) on the viability of GECs were evaluated by CCK-8 assay. Data are presented as the means ± SD (n = 5, each group). **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-544a/miR-379 (+) NC group. (O and P) The co-effects of circ-SHKBP1 and miR-544a (O) and circ-SHKBP1 and miR-379 (P) on the migration of GECs were evaluated by Transwell assay. Data are presented as the means ± SD (n = 5, each group). **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-544a/miR-379 (+) NC group. Scale bar represents 30 μm. (Q and R) The co-effects of circ-SHKBP1 and miR-544a (Q) and circ-SHKPB1 and miR-379 (R) on the tube formation of GECs were evaluated by Matrigel tube formation assay (black arrows, tube structures; gray arrows, tube branches). Data are presented as the means ± SD (n = 5, each group). **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-544a/miR-379 (+) NC group. Scale bar represents 30 μm.

miR-544a/miR-379 Functional Targeted circ-SHKBP1 (A) Cartoon of circ-SHKBP1 arose from SHKBP1 gene by scanning SHKBP1 genomic DNA and circBase (blue, miR-544a binging site; green, miR-379 binging site). (B) The spliced sequence and putative binging site of circ-SHKBP1 (hsa_circ_0000936) are shown with the help of starBase v2.0 (blue, the putative binging site and sequences of miR-544a; green, the putative binging site and sequences of miR-379). (C and D) The putative binding sites between circ-SHKBP1 and miR-544 (C) and miR-379 (D) were predicted, and the relative luciferase activity was expressed as firefly/Renilla luciferase activity. Values are means ± SD (n = 5, each group). **p < 0.01 versus circ-SHKBP1 WT + miR-544a/miR-379 (+) NC group. (E and F) The expression of miR-544a (E) and miR-379 (F) was measured after knockdown of circ-SHKBP1 by qRT-PCR. U6 was used as an inner control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus circ-SHKBP1 (−) NC group. (G and H) miR-544a (G) and miR-379 (H) regulated the expression of circ-SHKBP1 in GECs. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus miR-544a/miR-379 (+) NC group; ##p < 0.01 versus miR-544a/miR-379 (−) NC group. (I–L) miR-544a/miR-379 was identified in the circ-SHKBP1-RISC complex. Relative expressions of circ-SHKBP1 (I), miR-544a (J), circ-SHKBP1 (K), and miR-379 (L) were measured using qRT-PCR. Data represent means ± SD (n = 5, each group). *p < 0.05 versus anti-IgG group; #p < 0.05 versus anti-Ago2 in control group. (M and N) The co-effects of circ-SHKBP1 and miR-544a (M) and circ-SHKBP1 and miR-379 (N) on the viability of GECs were evaluated by CCK-8 assay. Data are presented as the means ± SD (n = 5, each group). **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-544a/miR-379 (+) NC group. (O and P) The co-effects of circ-SHKBP1 and miR-544a (O) and circ-SHKBP1 and miR-379 (P) on the migration of GECs were evaluated by Transwell assay. Data are presented as the means ± SD (n = 5, each group). **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-544a/miR-379 (+) NC group. Scale bar represents 30 μm. (Q and R) The co-effects of circ-SHKBP1 and miR-544a (Q) and circ-SHKPB1 and miR-379 (R) on the tube formation of GECs were evaluated by Matrigel tube formation assay (black arrows, tube structures; gray arrows, tube branches). Data are presented as the means ± SD (n = 5, each group). **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-544a/miR-379 (+) NC group. Scale bar represents 30 μm. Subsequently, the expressions of miR-544a/miR-379 were significantly increased in the circ-SHKBP1 (−) group compared with the circ-SHKBP1 (−) NC group (Figures 3E and 3F). Similarly, the expression of circ-SHKBP1 was significantly enhanced (1.5500 ± 0.1114 or 1.6900 ± 0.1153-fold) in the miR-544a (−) or miR-379 (−) group (Figures 3G and 3H). However, overexpression or silencing of miR-544a/miR-379 did not affect the expression of linear SHKBP1 (Figures S1K and S1L). Furthermore, RNA-binding protein immunoprecipitation (RIP) assay was conducted to investigate whether circ-SHKBP1 and miR-544a/miR-379 were involved in the expected RNA-induced silencing complex (RISC). The relative abundance of circ-SHKBP1 and miR-544a was increased in the anti-Ago2 group compared with the anti-IgG group (Figures 3I and 3J). In the miR-544a (−) group, the relative abundance of circ-SHKBP1 and miR-544a immunoprecipitated with Ago2 was lower than that in the control group, respectively (Figures 3I and 3J). Similar results were obtained in the relative abundance of circ-SHKBP1 and miR-379 (Figures 3K and 3L). These results suggested that circ-SHKBP1 reduced the expressions of miR-544a/miR-379 in an RISC manner, and there might be a reciprocal repression feedback loop between circ-SHKBP1 and miR-544a/miR-379. To further clarify whether miR-544a/miR-379 was involved in circ-SHKBP1-mediated regulation of angiogenesis, GECs with stable knockdown of circ-SHKBP1 were transiently transfected with miR-544a/miR-379 agomir or antagomir. The viability (Figures 3M and 3N), migration (Figures 3O and 3P), and tube formation (Figures 3Q and 3R) of GECs in the circ-SHKBP1 (−) + miR-544a/miR-379 (+) group were significantly decreased compared with those in the circ-SHKBP1 (−) NC + miR-544a/miR-379 (+) NC group, which indicated miR-544a/miR-379 reversed circ-SHKBP1 knockdown-mediated inhibition of viability, migration, and tube formation of GECs.

FOXP1 Was a Target of miR-544a, FOXP2 Was a Target of miR-379, and They Were Involved in circ-SHKBP1 and miR-544a/379-Mediated Angiogenesis of GECs

The potential targets of miR-544a/miR-379 were investigated with the help of microRNA.org (http://34.236.212.39/microrna/microrna/home). A putative binding site was found in the 3′ UTR of FOXP1 or FOXP2 mRNA, which was a completely complementary sequence of the seed region of miR-544a/miR-379. The relative luciferase activity in the FOXP1/FOXP2 WT + miR-544a/miR-379 (+) group was significantly impaired compared with that in the FOXP1/FOXP2 WT + miR-544a/miR-379 (+) NC group, while the relative luciferase activity in the FOXP1/FOXP2 Mut + miR-544a/miR-379 (+) group was not affected (Figures 4A and 4B). The expressions of FOXP1/FOXP2 in GECs were respectively detected by qRT-PCR and western blot. As shown in Figures 4C–4F, the mRNA and protein expressions of FOXP1/FOXP2 were upregulated (1.7680 ± 0.2713/1.961 ± 0.1695-fold and 1.9800 ± 0.1617/2.2240 ± 0.3062-fold) in GECs compared with in AECs. In addition, the mRNA and protein expressions of FOXP1/FOXP2 were significantly reduced (0.5633 ± 0.1012/0.5567 ± 0.0982-fold and 0.5867 ± 0.0862/0.5933 ± 0.0851-fold) in the circ-SHKBP1 (−) group compared with the circ-SHKBP1 (−) NC group (Figures 4G–4J). Meanwhile, the mRNA and protein expressions of FOXP1/FOXP2 were significantly decreased (0.3500 ± 0.0889/0.4267 ± 0.0643 folds and 0.3600 ± 0.0781/0.4533 ± 0.1222-fold) in the miR-544a/miR-379 (+) group compared with those in the miR-544a/miR-379 (+) NC group (Figures 4K–4N). Furthermore, the mRNA and protein expressions of FOXP1/FOXP2 were significantly reduced (0.3333 ± 0.1285/0.2600 ± 0.0458 folds and 0.3100 ± 0.1277/0.2800 ± 0.0600-fold) in the circ-SHKBP1 (−) + miR-544a/miR-379 (+) group compared with those in the circ-SHKBP1 (−) NC + miR-544a/miR-379 (+) NC group (Figures 4O–4R). However, there was no significant difference between the circ-SHKBP1 (−) + miR-544a/miR-379 (−) and circ-SHKBP1 (−) NC + miR-544a/miR-379 (−) NC groups, which indicated the reduction of FOXP1/FOXP2 mediated by circ-SHKBP1 knockdown was reversed by miR-544a/miR-379 silencing.
Figure 4

FOXP1/FOXP2 Were Respectively Targets of miR-544a/miR-379

(A and B) The putative binding sites between FOXP1 and miR-544a (A) and FOXP2 and miR-379 (B) were predicted, respectively, and the relative luciferase activity was expressed as firefly/Renilla luciferase activity. Values are means ± SD (n = 5, each group). *p < 0.05 versus FOXP1/FOXP2 WT + miR-544a/miR-379 (+) NC group. (C and D) The mRNA (C) and protein (D) expressions of FOXP1 were measured in AECs and GECs by qRT-PCR and western blot. GAPDH was used as an endogenous control. Values represent the means < SD (n = 5, each group). **p < 0.01 versus AECs group. (E and F) The mRNA (E) and protein (F) expressions of FOXP2 were measured in AECs and GECs by qRT-PCR and western blot. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus AECs group. (G and H) The mRNA (G) and protein (H) expressions of FOXP1 were inhibited after knockdown of circ-SHKBP1. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus the circ-SHKBP1 (−) NC group. (I and J) The mRNA (I) and protein (J) expressions of FOXP2 were inhibited after knockdown of circ-SHKBP1. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). *p < 0.05; **p < 0.01 versus the circ-SHKBP1 (−) NC group. (K and L) The mRNA (K) and protein (L) expressions of FOXP1 were regulated by miR-544a. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus the miR-544a (+) NC group; ##p < 0.01 versus the miR-544a (−) NC group. (M and N) The mRNA (M) and protein (N) expressions of FOXP2 were regulated by miR-379. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the miR-379 (+) NC group; #p < 0.05, ##p < 0.01 versus the miR-379 (−) NC group. (O and P) The mRNA (O) and protein (P) expressions of FOXP1 were co-regulated by both circ-SHKBP1 and miR-544a. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-544a (+) NC group. IDV, integrated density value. (Q and R) The mRNA (Q) and protein (R) expressions of FOXP2 were co-regulated by both circ-SHKBP1 and miR-379. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-379 (+) NC group. IDV, integrated density value.

FOXP1/FOXP2 Were Respectively Targets of miR-544a/miR-379 (A and B) The putative binding sites between FOXP1 and miR-544a (A) and FOXP2 and miR-379 (B) were predicted, respectively, and the relative luciferase activity was expressed as firefly/Renilla luciferase activity. Values are means ± SD (n = 5, each group). *p < 0.05 versus FOXP1/FOXP2 WT + miR-544a/miR-379 (+) NC group. (C and D) The mRNA (C) and protein (D) expressions of FOXP1 were measured in AECs and GECs by qRT-PCR and western blot. GAPDH was used as an endogenous control. Values represent the means < SD (n = 5, each group). **p < 0.01 versus AECs group. (E and F) The mRNA (E) and protein (F) expressions of FOXP2 were measured in AECs and GECs by qRT-PCR and western blot. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus AECs group. (G and H) The mRNA (G) and protein (H) expressions of FOXP1 were inhibited after knockdown of circ-SHKBP1. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus the circ-SHKBP1 (−) NC group. (I and J) The mRNA (I) and protein (J) expressions of FOXP2 were inhibited after knockdown of circ-SHKBP1. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). *p < 0.05; **p < 0.01 versus the circ-SHKBP1 (−) NC group. (K and L) The mRNA (K) and protein (L) expressions of FOXP1 were regulated by miR-544a. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus the miR-544a (+) NC group; ##p < 0.01 versus the miR-544a (−) NC group. (M and N) The mRNA (M) and protein (N) expressions of FOXP2 were regulated by miR-379. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the miR-379 (+) NC group; #p < 0.05, ##p < 0.01 versus the miR-379 (−) NC group. (O and P) The mRNA (O) and protein (P) expressions of FOXP1 were co-regulated by both circ-SHKBP1 and miR-544a. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-544a (+) NC group. IDV, integrated density value. (Q and R) The mRNA (Q) and protein (R) expressions of FOXP2 were co-regulated by both circ-SHKBP1 and miR-379. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-379 (+) NC group. IDV, integrated density value.

FOXP1/FOXP2 Overexpression Prompted the Angiogenesis of GECs by Activating AGGF1 Expression

To further explore the effect of FOXP1/FOXP2 on the angiogenesis of GECs, both overexpression and silencing of FOXP1/FOXP2 were constructed in GECs, and the stable transfection efficiency of FOXP1/FOXP2 was respectively shown in Figures S1M and S1N. The overexpression of FOXP1/FOXP2 enhanced the viability (Figures 5A and 5B), migration (Figures 5C and 5D), and tube formation (Figures 5E and 5F) of GECs, while silencing of FOXP1/FOXP2 presented the opposite results.
Figure 5

FOXP1/FOXP2 Regulated the Angiogenesis of GECs by Activating AGGF1 Expression

(A and B) FOXP1 (A) and FOXP2 (B) regulated the viability of GECs. Values are means ± SD (n = 5, each group). **p < 0.01 versus the FOXP1/FOXP2 (+) NC group; ##p < 0.01 versus the FOXP1/FOXP2 (−) NC group. (C and D) FOXP1 (C) and FOXP2 (D) regulated the migration of GECs. Values are means ± SD (n = 5, each group). **p < 0.01 versus the FOXP1/FOXP2 (+) NC group; ##p < 0.01 versus the FOXP1/FOXP2 (−) NC group. Scale bar represents 30 μm. (E and F) FOXP1 (E) and FOXP2 (F) regulated the tube formation of GECs (black arrows, tube structures; gray arrows, tube branches). Values are means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the FOXP1/FOXP2 (+) NC group; #p < 0.05, ##p < 0.01 versus the FOXP1/FOXP2 (−) NC group. Scale bar represents 30 μm. (G and H) Schematic representation of human AGGF1 promoter region in 3,000 bp upstream or 200 bp downstream of transcription start site (designated as +1). ChIP PCR products for putative FOXP1 (G) and FOXP2 (H) binding sites and an upstream region not expected to associate with FOXP1/FOXP2 are depicted with bold lines. (I and J) qRT-PCR and western blot detection of FOXP1 regulated the mRNA (I) and protein (J) expressions of AGGF1. GAPDH was used as an endogenous control. Values are means ± SD (n = 5, each group). **p < 0.01 versus FOXP1 (+) NC group; ##p < 0.01 versus FOXP1 (−) NC group. IDV, integrated density value. (K and L) qRT-PCR and western blot detection of FOXP2 regulated the mRNA (K) and protein (L) expressions of AGGF1. GAPDH was used as an endogenous control. Values are means ± SD (n = 5, each group). **p < 0.01 versus FOXP2 (+) NC group; ##p < 0.01 versus FOXP2 (−) NC group. IDV, integrated density value.

FOXP1/FOXP2 Regulated the Angiogenesis of GECs by Activating AGGF1 Expression (A and B) FOXP1 (A) and FOXP2 (B) regulated the viability of GECs. Values are means ± SD (n = 5, each group). **p < 0.01 versus the FOXP1/FOXP2 (+) NC group; ##p < 0.01 versus the FOXP1/FOXP2 (−) NC group. (C and D) FOXP1 (C) and FOXP2 (D) regulated the migration of GECs. Values are means ± SD (n = 5, each group). **p < 0.01 versus the FOXP1/FOXP2 (+) NC group; ##p < 0.01 versus the FOXP1/FOXP2 (−) NC group. Scale bar represents 30 μm. (E and F) FOXP1 (E) and FOXP2 (F) regulated the tube formation of GECs (black arrows, tube structures; gray arrows, tube branches). Values are means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the FOXP1/FOXP2 (+) NC group; #p < 0.05, ##p < 0.01 versus the FOXP1/FOXP2 (−) NC group. Scale bar represents 30 μm. (G and H) Schematic representation of human AGGF1 promoter region in 3,000 bp upstream or 200 bp downstream of transcription start site (designated as +1). ChIP PCR products for putative FOXP1 (G) and FOXP2 (H) binding sites and an upstream region not expected to associate with FOXP1/FOXP2 are depicted with bold lines. (I and J) qRT-PCR and western blot detection of FOXP1 regulated the mRNA (I) and protein (J) expressions of AGGF1. GAPDH was used as an endogenous control. Values are means ± SD (n = 5, each group). **p < 0.01 versus FOXP1 (+) NC group; ##p < 0.01 versus FOXP1 (−) NC group. IDV, integrated density value. (K and L) qRT-PCR and western blot detection of FOXP2 regulated the mRNA (K) and protein (L) expressions of AGGF1. GAPDH was used as an endogenous control. Values are means ± SD (n = 5, each group). **p < 0.01 versus FOXP2 (+) NC group; ##p < 0.01 versus FOXP2 (−) NC group. IDV, integrated density value. Furthermore, chromatin immunoprecipitation (ChIP) assays were performed to clarify whether FOXP1/FOXP2 directly bound to the promoters of AGGF1 in GECs. The transcription start site (TSS) of AGGF1 was predicted by DBTSS HOME (https://dbtss.hgc.jp/). Three putative FOXP1/FOXP2 binding sites were respectively identified after analyzing the “AAACA” DNA sequence in the 1,000-bp region upstream and 200-bp region downstream of TSS. The results revealed that there was an association of FOXP1/FOXP2 with putative binding sites of AGGF1, respectively (Figures 5G and 5H), but there was no relationship between all of the control regions. Subsequently, the mRNA and protein expressions of AGGF1 were detected in GECs after FOXP1/FOXP2 overexpression and silencing. The overexpression of FOXP1/FOXP2 upregulated the expression of AGGF1, whereas silencing of FOXP1/FOXP2 downregulated its expression (Figures 5I–5L). These results indicate that FOXP1/FOXP2 promotes the angiogenesis of GECs by transcriptionally upregulating AGGF1.

Knockdown of AGGF1 Suppressed the Angiogenesis of GECs via PI3K/AKT and ERK1/2 Pathways

As shown in Figures 6A and 6B, the mRNA and protein expressions of AGGF1 were upregulated (1.894 ± 0.2701/2.2280 ± 0.3380-fold) in GECs compared with AECs. Then AGGF1 was knocked down to further investigate its function in GECs, and the stable transfection efficiency of AGGF1 was verified (Figure S1O). The viability, migration, and tube formation of GECs were significantly attenuated in the AGGF1 (−) group compared with the AGGF1 (−) NC group (Figures 6C–6E). To investigate whether AGGF1 promoted angiogenesis by activating phosphatidylinositol 3-kinase (PI3K)/AKT and extracellular signal-regulated kinase (ERK)1/2 pathways, the protein expressions of PI3K/AKT and ERK1/2 were evaluated in GECs. As shown in Figures 6F–6H, the expressions of p-PI3K/t-PI3K, p-AKT/t-AKT, and p-ERK1/2/t-ERK1/2 were significantly decreased in the AGGF1 (−) group compared with the AGGF1 (−) NC group.
Figure 6

Knockdown of AGGF1 Suppressed the Angiogenesis of GECs via PI3K/AKT and ERK1/2 Pathways

(A and B) The mRNA (A) and protein (B) expressions of AGGF1 in AECs and GECs were evaluated by qRT-PCR and western blot. GAPDH was used as an endogenous control. Data represent means ± SD (n = 5, each group). **p < 0.01 versus AECs group. (C) The effects of AGGF1 knockdown on the viability of GECs were detected by CCK-8 assay. Values are means ± SD (n = 5, each group). **p < 0.01 versus AGGF1 (−) NC group. (D) The effects of AGGF1 knockdown on the migration of GECs were determined by Transwell assay. Values are means ± SD (n = 5, each group). *p < 0.05 versus AGGF1 (−) NC group. Scale bar represents 30 μm. (E) The effects of AGGF1 knockdown on the tube formation of GECs were evaluated by Matrigel tube formation assay (black arrow, tube structures; gray arrow, tube branches). Values are means ± SD (n = 5, each group). *p < 0.05; **p < 0.01 versus AGGF1 (−) NC group. Scale bar represents 30 μm. (F–H) The protein expressions of PI3K (F), AKT (G) and ERK1/2 (H) in GECs were determined by western blot. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus AGGF1 (−) NC group.

Knockdown of AGGF1 Suppressed the Angiogenesis of GECs via PI3K/AKT and ERK1/2 Pathways (A and B) The mRNA (A) and protein (B) expressions of AGGF1 in AECs and GECs were evaluated by qRT-PCR and western blot. GAPDH was used as an endogenous control. Data represent means ± SD (n = 5, each group). **p < 0.01 versus AECs group. (C) The effects of AGGF1 knockdown on the viability of GECs were detected by CCK-8 assay. Values are means ± SD (n = 5, each group). **p < 0.01 versus AGGF1 (−) NC group. (D) The effects of AGGF1 knockdown on the migration of GECs were determined by Transwell assay. Values are means ± SD (n = 5, each group). *p < 0.05 versus AGGF1 (−) NC group. Scale bar represents 30 μm. (E) The effects of AGGF1 knockdown on the tube formation of GECs were evaluated by Matrigel tube formation assay (black arrow, tube structures; gray arrow, tube branches). Values are means ± SD (n = 5, each group). *p < 0.05; **p < 0.01 versus AGGF1 (−) NC group. Scale bar represents 30 μm. (F–H) The protein expressions of PI3K (F), AKT (G) and ERK1/2 (H) in GECs were determined by western blot. GAPDH was used as an endogenous control. Values represent the means ± SD (n = 5, each group). **p < 0.01 versus AGGF1 (−) NC group.

miR-544a/miR-379 Suppressed FOXP1/FOXP2-Mediated Promotion of the Angiogenesis of GECs and the Expression of AGGF1

Furthermore, agomir and antagomir of miR-544a/miR-379 were transfected into GECs with stably overexpressed FOXP1/FOXP2. As shown in Figures 7A–7F, the viability, migration, and tube formation of GECs were significantly decreased in the miR-544a/miR-379 (+) + FOXP1/FOXP2 (+) NC group compared with the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) NC group. However, the effects in the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) group were significantly increased compared with the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) NC group, and the effects in the miR-544a/miR-379 (+) + FOXP1/FOXP2 (+) group were significantly decreased compared with the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) group. In addition, the changes of AGGF1 expression were in accordance with the changes of viability, migration, and tube formation (Figures 7G and 7H). As a matter of fact, these findings indicated that miR-544a/miR-379-suppressed FOXP1/FOXP2 mediated the promotion of the angiogenesis of GECs.
Figure 7

The Co-effects of miR-544a/miR-379 and FOXP1/FOXP2 on the Angiogenesis of GECs and the Expression of AGGF1

(A and B) The co-effects of miR-544a and FOXP1 (A), miR-379 and FOXP2 (B) on the viability of GECs were evaluated by CCK8 assay. Data are presented as the means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) NC group; #p < 0.05, ##p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) group. (C and D) The co-effects of miR-544a and FOXP1 (C), miR-379 and FOXP2 (D) on the migration of GECs were evaluated by Transwell assay. Data are presented as the means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) NC group; #p < 0.05, ##p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) group. Scale bar represents 30 μm. (E and F) The co-effects of miR-544a and FOXP1 (E), miR-379 and FOXP2 (F) on the tube formation of GECs were evaluated by Matrigel tube formation assay (black arrows, tube structures; gray arrows, tube branches). Data are presented as the means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) NC group; #p < 0.05, ##p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) group. Scale bar represents 30 μm. (G and H) The co-effects of miR-544a and FOXP1 (G), miR-379 and FOXP2 (H) on the expression of AGGF1 in GECs were evaluated by western blot. Data are presented as the means ± SD (n = 5, each group). **p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) NC group; ##p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) group.

The Co-effects of miR-544a/miR-379 and FOXP1/FOXP2 on the Angiogenesis of GECs and the Expression of AGGF1 (A and B) The co-effects of miR-544a and FOXP1 (A), miR-379 and FOXP2 (B) on the viability of GECs were evaluated by CCK8 assay. Data are presented as the means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) NC group; #p < 0.05, ##p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) group. (C and D) The co-effects of miR-544a and FOXP1 (C), miR-379 and FOXP2 (D) on the migration of GECs were evaluated by Transwell assay. Data are presented as the means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) NC group; #p < 0.05, ##p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) group. Scale bar represents 30 μm. (E and F) The co-effects of miR-544a and FOXP1 (E), miR-379 and FOXP2 (F) on the tube formation of GECs were evaluated by Matrigel tube formation assay (black arrows, tube structures; gray arrows, tube branches). Data are presented as the means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) NC group; #p < 0.05, ##p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) group. Scale bar represents 30 μm. (G and H) The co-effects of miR-544a and FOXP1 (G), miR-379 and FOXP2 (H) on the expression of AGGF1 in GECs were evaluated by western blot. Data are presented as the means ± SD (n = 5, each group). **p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) NC group; ##p < 0.01 versus the miR-544a/miR-379 (+) NC + FOXP1/FOXP2 (+) group.

circ-SHKBP1 Knockdown Combined with miR-544a/379 Overexpression Suppressed Glioma Angiogenesis In Vivo

Eventually, Matrigel plug assay in vivo was applied to further determine whether the angiogenesis in vivo was suppressed after circ-SHKBP1 knockdown and miR-544a/379 overexpression. The co-transfection was conducted prior to the assessment of angiogenesis in vivo. Results revealed that the amount of hemoglobin in the circ-SHKBP1 (−), miR-544a (+), and circ-SHKBP1 (−) + miR-544a (+) groups was significantly decreased compared with the circ-SHKBP1 (−) NC + miR-544a (+) NC group, and the amount of hemoglobin in the circ-SHKBP1 (−) + miR-544a (+) group was the smallest (Figures 8A and 8B). Similar results were obtained in the combination of circ-SHKBP1 and miR-379 (Figures 8C and 8D). These findings infer that circ-SHKBP1 knockdown combined with miR-544a/379 overexpression suppressed glioma angiogenesis in vivo. Finally, the schematic cartoon underlying the mechanism of circ-SHKBP1 on the angiogenesis of GECs was presented in Figure 8E.
Figure 8

circ-SHKBP1 Knockdown Combined with miR-544a/miR-379 Overexpression Suppressed Angiogenesis In Vivo

(A) The co-effect of circ-SHKBP1 and miR-544a on the angiogenesis in vivo was evaluated by Matrigel plug assay. (B) The amount of hemoglobin was measured after combination of circ-SHKBP1 and miR-544a. Data represent the means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-544a (+) NC group; #p < 0.05 versus the circ-SHKBP1 (−) group; &p < 0.05 versus the miR-544a (+) group. (C) The co-effect of circ-SHKBP1 and miR-379 on the angiogenesis in vivo was detected by Matrigel plug assay. (D) The amount of hemoglobin was measured after combination of circ-SHKBP1 and miR-379. Data represent the means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-379 (+) NC group; #p < 0.05 versus the circ-SHKBP1 (−) group; &p < 0.05 versus the miR-379 (+) group. (E) The schematic cartoon underlying the mechanism of circ-SHKBP1 on the angiogenesis of GECs.

circ-SHKBP1 Knockdown Combined with miR-544a/miR-379 Overexpression Suppressed Angiogenesis In Vivo (A) The co-effect of circ-SHKBP1 and miR-544a on the angiogenesis in vivo was evaluated by Matrigel plug assay. (B) The amount of hemoglobin was measured after combination of circ-SHKBP1 and miR-544a. Data represent the means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-544a (+) NC group; #p < 0.05 versus the circ-SHKBP1 (−) group; &p < 0.05 versus the miR-544a (+) group. (C) The co-effect of circ-SHKBP1 and miR-379 on the angiogenesis in vivo was detected by Matrigel plug assay. (D) The amount of hemoglobin was measured after combination of circ-SHKBP1 and miR-379. Data represent the means ± SD (n = 5, each group). *p < 0.05, **p < 0.01 versus the circ-SHKBP1 (−) NC + miR-379 (+) NC group; #p < 0.05 versus the circ-SHKBP1 (−) group; &p < 0.05 versus the miR-379 (+) group. (E) The schematic cartoon underlying the mechanism of circ-SHKBP1 on the angiogenesis of GECs.

Discussion

Emerging research has reported that circRNA plays regulatory roles in malignant biological behaviors of glioma cells.41, 42 However, our present study focuses on the effect of circ-SHKBP1 in GECs. The expression of circ-SHKBP1 was upregulated in GECs compared with AECs. Knockdown of circ-SHKBP1 inhibited the viability, migration, and tube formation of GECs and the expression of AGGF1, which indicated that circ-SHKBP1 functioned as an oncogene in GECs. As previously reported, SHKBP1 protein expression in the serum of patients with primary neuroendocrine tumor, lymph node metastasis, and liver metastasis was significantly elevated compared with healthy individual’s serum. The expression of linear SHKBP1 was not upregulated in GECs, inferring that circ-SHKBP1 and linear SHKBP1 are two mutually independent RNA and might perform different functions, which is consistent with the role of circ-TTBK2 and circ-HIPK3.41, 44 Accumulated evidence has confirmed that circRNA serves as miRNA sponges by targeting miRNA.45, 46, 47 Our finding verified the binding sites between circ-SHKBP1 and miR-544a/miR-379, and indicated circ-SHKBP1 might act as an miR-544a/miR-379 sponge to modulate their functions in GECs. Meanwhile, the same binding sites exist between linear SHKBP1 and miR-544a/miR-379, but fall within the coding DNA sequence (CDS) region of linear SHKBP1. As a consequence, the combination of linear SHKBP1 and miR-544a/miR-379 did not affect the function of GECs. Further studies manifested knockdown of circ-SHKBP1 significantly upregulated the expression of miR-544a/miR-379. Moreover, silencing of miR-544a/miR-379 increased the expression of circ-SHKBP1, and vice versa. These findings suggested the reciprocal repression between circ-SHKBP1 and miR-544a/miR-379 might exist in an RISC manner. In fact, the role of circ-SHKBP1 in the viability, migration, and tube formation of GECs was mediated by targeting miR-544a/miR-379. Furthermore, the co-effect of circ-SHKBP1 and miR-544a/miR-379 in the viability, migration, and tube formation of GECs was verified. The present study uncovered that miR-544a/miR-379 was downregulated in GECs and miR-544a/miR-379 overexpression inhibited the viability, migration, and tube formation of GECs, and vice versa, which indicated that miR-544a/miR-379 acted as a tumor suppressor in GECs. Much other research is consistent with our result. miRNA-544 is decreased in cervical cancer tissues compared with normal cervical tissues, which is involved in cell-cycle regulation and suppresses cervical cancer cell proliferation, colony formation, migration, and invasion in a manner associated with YWHAZ downregulation. Ma et al. reported that miR-544 was significantly decreased in anaplastic glioma or glioblastoma tissue compared with LGG tissue, but not in serum, indicating miR-544 is a potential biomarker for malignant glioma. Previous studies have revealed that miR-379 acted as tumor suppressor and was significantly downregulated in chemo-resistant non-small-cell lung cancer tissues and cells, malignant pleural mesothelioma, and especially in glioblastoma tissues and cells.21, 22, 23, 24 Consistent with our results, miR-379 can play a tumor suppressor role in glioblastoma tissues, cells, and GECs. Therefore, it is possible that downregulation of miR-544/miR-379 can contribute to retard gliomagenesis in a patient and provide an alternative strategy for glioma treatment. The overexpression of FOXP1/FOXP2 has been reported to be associated with various types of tumors.49, 50, 51 In the present study, FOXP1/FOXP2 was upregulated in GECs compared with AECs, and FOXP1/FOXP2 silencing attenuated the viability, migration, and tube formation of GECs, and vice versa. These findings were consistent with the result of FOXP1 in glioma tissues and U87 glioma cells,29, 30 indicating that FOXP1/FOXP2 might act as an oncogene in malignant glioma tissues or cells and GECs. Our results further illuminated that FOXP1/FOXP2 were respectively the targets of miR-544a/miR-379. Additionally, the roles of miR-544a/miR-379 in the viability, migration, and tube formation ability of GECs were corroborated by negatively regulating FOXP1/FOXP2, respectively. One of the most common mechanisms of miRNA is that miRNA inhibits gene expression at the transcriptional and post-transcriptional levels by binding to 3′ UTR of target mRNA. miR-544a/miR-379 and FOXP1/FOXP2 play important roles in various cancer tissues and cells. miR-544a can influence the functions of hepatocellular carcinoma (HCC) by binding to the selenoprotein K (SELK) 3′ UTR region. miR-379 targeted the 3′ UTR region of EIF4G2 and decreased its mRNA and protein expressions to inhibit the proliferation, migration, and invasion of human osteosarcoma cells. In addition, miR-504 inhibited cell proliferation by targeting the FOXP1 3′ UTR region in human glioma cells, and miR-190 was characterized as an oncogene in gastric cancer and regulated the expression of FOXP2 by targeting its 3′ UTR. Our study proved that circ-SHKBP1 knockdown combined with miR-544a/miR-379 overexpression significantly reduced the expressions of FOXP1/FOXP2, while circ-SHKBP1 knockdown combined with miR-544a/miR-379 silencing exerted no significant changes of FOXP1/FOXP2. Furthermore, circ-SHKBP1 knockdown combined with miR-544a/miR-379 overexpression significantly suppressed the viability, migration, and tube formation in GECs, which indicated these effects were induced by inhibiting expressions of FOXP1/FOXP2. As an angiogenic factor, the expression of AGGF1 was significantly upregulated in gastric cancer, medulloblastoma, and hepatocellular carcinoma.55, 56, 57 However, the expression and role of AGGF1 in GECs are still unknown. Our present study manifested that AGGF1 was upregulated in GECs and exerted oncogene function in GECs owing to AGGF1 knockdown-mediated inhibition of the viability, migration, and tube formation of GECs. Another report is consistent with our findings. Knockdown of AGGF1 promoted endothelial cells apoptosis and inhibited endothelial cells migration and capillary vessel formation. Furthermore, ChIP assays certified that FOXP1/FOXP2 was directly associated with the AGGF1 promoter, and FOXP1/FOXP2 upregulated AGGF1 expression by directly activating its promoter. A previous report has confirmed that FOXP1/FOXP2 serves as an activator in the transcriptional regulation of targeted genes. FOXP1 activated FBXL7 promoter and promoted its transcription to regulate drug resistance and prognosis of gastric cancer. FOXP2 targeted and activated the promoter of very low density lipoprotein receptor (VLDLR) to promote its transcription. In the present study, further findings demonstrated that overexpression of miR-544a/miR-379 decreased AGGF1 expression, yet overexpression of FOXP1/FOXP2 increased AGGF1 expression. Moreover, our data indicated that miR-544a/miR-379 downregulated the expressions of AGGF1 and inhibited the viability, migration, and tube formation of GECs by negatively regulating FOXP1/FOXP2. Finally, our results demonstrated that the expressions of FOXP1/FOXP2 were decreased after stable knockdown of circ-SHKBP1 combined with miR-544a/miR-379 overexpression. The above suggests knockdown of circ-SHKBP1 negatively regulates the expression of FOXP1/FOXP2 by targeting miR-544a/miR-379 and further downregulates AGGF1 expression to inhibit the viability, migration, and tube formation of GECs. Altogether, circ-SHKBP1 regulates the angiogenesis of gliomas by targeting miR-544a/FOXP1/AGGF1 and miR-379/FOXP2/AGGF1 pathways. Other reports on glioma present similar results with our findings: circ-TTBK2 promotes the malignant biological behavior of glioma cells via the miR-217/HNF1β/Derlin-1 pathway and circ-cZNF292 suppresses the tube formation of glioma via the Wnt/β-catenin signaling pathway. AGGF1 promoted angiogenesis by activating the PI3K/AKT signaling pathway in Klippel-Trenaunay syndrome. AGGF1 increased vein differentiation by inducing activation of AKT signaling during embryogenesis. Liu et al. reported AGGF1-regulated angiogenesis and protected from myocardial ischemia/reperfusion injury by activating ERK1/2. Our study demonstrated that p-PI3K/PI3K, p-AKT/AKT, and p-ERK1/2/ERK1/2 expressions were significantly decreased in GECs after knockdown of AGGF1. These results indicate that AGGF1 regulate glioma angiogenesis by activating PI3K/AKT and ERK1/2 pathways. In conclusion, the present study investigated that circ-SHKBP1, FOXP1/FOXP2, and AGGF1 expressions were increased and miR-544a/miR-379 were decreased in GECs for the first time. circ-SHKBP1 knockdown reduced the expression of AGGF1 via the miR-544a/FOXP1 or miR-379/FOXP2 pathway to further inhibit the viability, migration, and tube formation of GECs by AGGF1 itself or via PI3K/AKT and ERK1/2 pathways. These findings may contribute to provide potential targets for the anti-angiogenesis therapies of glioma.

Materials and Methods

Human Glioma Tissue Specimens and Laser Capture Microdissection

Human glioma tissue specimens were obtained from patients undergoing surgical resection at the Department of Neurosurgery of Shengjing Hospital of China Medical University. Glioma tissue specimens were divided into two groups, grade I–II glioma group (LGG tissues, n = 5) and grade III–IV glioma group (HGGs, n = 5), by two experienced clinical pathologists in a blinded manner according to the World Health Organization (WHO) classification. NBTs (n = 5) were obtained from patients with fresh autopsy material and were used as NC. The above clinical materials were approved by the Hospital Ethical Committee. Glioma tissue specimens were frozen-sectioned. Sections for microdissection were stained with a fluorescent dye-tagged lectin, Ulex europaeus lectin I (UEA-I) (Vector Laboratories, Burlington, ON, Canada). Laser capture microdissection was used to collect enriched brain endothelium RNA as previously described. LCM was performed using the ArcturusXT Microdissection Instrument. The captured microvessels were placed on CapSure LCM Caps (Applied Biosystems, Foster City, CA, USA) and further processed for RNA isolation.

Cells Lines and Culture

The immortalized human cerebral microvascular endothelial cell line hCMEC/D3 was friendly provided by Dr. Couraud (Institut Cochin, Paris, France). The passage of cells was within 30. hCMEC/D3 cells were cultured as described previously. The culture medium contained endothelial basal medium (EBM-2) supplemented with 5% fetal bovine serum (FBS) “Gold,” 1% penicillin-streptomycin, 1% chemically defined lipid concentrate, 1 ng/mL bFGF, 1.4 μM hydrocortisone, 5 μg/mL ascorbic acid, and 10 mM N-2-hydroxyethylpiperazine-N-ethane-sulphonicacid (HEPES). Cells were maintained in a humidified incubator at 37°C and 5% CO2, and the medium was refreshed every 48 hr. Human astrocytes were obtained from Sciencell Research Laboratories (Carlsbad, CA, USA) and cultured in astrocyte medium RPMI-1640 (GIBCO, Carlsbad, CA, USA). The human glioblastoma cell line (U87MG) and HEK293T cell line were obtained from the Shanghai Institutes for Biological Sciences Cell Resource Center, and they were cultured in high-glucose DMEM (GIBCO, Carlsbad, CA, USA) containing 10% FBS. Cells were maintained at 37°C in a humidified incubator with 5% CO2 and refreshed medium every 48 hr. Glioma conditioned medium was collected from the indicated human glioma cells grown in 100-mm-diameter Petri dishes. When cells nearly reached confluency, the cells were washed twice with serum-free medium and incubated in serum-free EBM-2 medium for 24 hr. Then the supernatant was harvested and centrifuged at 2,000 × g at 4°C for 10 min. The supernatant was supplemented with 5% FBS, 1% penicillin-streptomycin, 1 ng/mL bFGF, 1.4 μM hydrocortisone, 5 μg/mL ascorbic acid and 10 mM HEPES, and 1% chemically defined lipid concentrate. Astrocyte-conditioned medium was obtained as the same method. The hCMEC/D3 cells were separately cultured with the above-mentioned glioma conditioned medium and astrocyte conditioned medium; thus, they were called GECs and AECs, respectively. In the subsequent experiments, either un-transfected or transfected hCMEC/D3 cells were GECs, unless otherwise indicated.

FISH

For identification of circ-SHKBP1 localization in cells, circ-SHKBP1 probe (5′-ACCTCCTGGACTGGTCTTG-3′, red-labeled; Biosense, Guangzhou, China) was used. In brief, slides were treated with PCR-grade Proteinase K (Roche Diagnostics, Mannheim, Germany) blocked after with prehybridization buffer (3% BSA in 4× saline sodium citrate [SSC]). The hybridization mix was prepared with circ-SHKBP1 probe in hybridization solution. Then the slides were washed with washing buffer; the sections were stained with anti-digoxin rhodamine conjugate (1:100; Exon Biotech, Guangzhou, China) at 37°C for 1 hr away from light. The sections were stained with DAPI (Beyotime, China) for nuclear staining subsequently. All fluorescence images (×100) were captured using a fluorescence microscope (Leica, Germany).

Plasmid Construction and Cell Transfection

Silencing plasmid of circ-SHKBP1 and SHKBP1 were constructed in pGPU6/GFP/Neo vector (GenePharma, Shanghai, China), and a non-targeting sequence was used as a NC. Overexpression plasmids of FOXP1 (NM_001244810.1)/FOXP2 (NM_148898.3) with pIRES2-EGFP (GenScript, Piscataway, NJ, USA) and silencing plasmid of FOXP1/FOXP2 and AGGF1 (NM_018046.4) with pGPU6/GFP/Neo (GenePharma, Shanghai, China) were constructed, respectively. An empty vector was used as a blank control. Transfection was performed at about 80% confluency of GECs in 24-well plates with Opti-MEM I and Lipofectamine LTX and Plus Reagents (Life Technologies Corporation, Carlsbad, CA, USA). The stable transfected cells were selected by the culture medium containing 0.4 mg/mL G418 (Sigma-Aldrich, St. Louis, MO, USA). After approximately 4 weeks, G418-resistant cell clones were established. The stable transfected efficiencies were assessed by qRT-PCR. Furthermore, miR-544a/miR-379 agomir [miR-544a/miR-379 (+); GenePharma, Shanghai, China], NC of agomir [miR-544a/379 (+) NC], miR-544a/miR-379 antagomir [miR-544a/miR-379 (−)], and NC of antagomir [miR-544a/miR-379 (−) NC] were transiently transfected into GECs, which were stable cell lines with Lipofectamine 3000 Reagents (Life Technologies Corporation, Carlsbad, CA, USA), respectively. After 48 hr, the transient transfected cells were used. Sequences of shcirc-SHKBP1, shSHKBP1, shFOXP1, shFOXP2, shAGGF1, and shNC were shown in Table 1. The transfection efficiency of shcirc-SHKBP1, shSHKBP1, miR-379/miR-544a, FOXP1/FOXP2, and AGGF1 were shown in Figure S1.
Table 1

Sequences of shRNA Template

GeneSequences (5′→3′)
circ-SHKBP1senseCACCGCCCAAGACCAGTCCAGGAGGTTTCAAGAGAACCTCCTGGACTGGTCTTGGGTTTTTTG
antisenseGATCCAAAAAACCCAAGACCAGTCCAGGAGGTTCTCTTGAAACCTCCTGGACTGGTCTTGGGC
SHKBP1senseCACCGCAGCCCATCACCAGTTATGATTCAAGAGATCATAACTGGTGATGGGCTGCTTTTTTG
antisenseGATCCAAAAAAGCAGCCCATCACCAGTTATGATCTCTTGAATCATAACTGGTGATGGGCTGC
FOXP1senseCACCGCCCATTTCGTCAGCAGATATTTCAAGAGAATATCTGCTGACGAAATGGGCTTTTTTG
antisenseGATCCAAAAAAGCCCATTTCGTCAGCAGATATTCTCTTGAAATATCTGCTGACGAAATGGGC
FOXP2senseCACCGCAGTACGTCATAATCTTAGCTTCAAGAGAGCTAAGATTATGACGTACTGCTTTTTTG
antisenseGATCCAAAAAAGCAGTACGTCATAATCTTAGCTCTCTTGAAGCTAAGATTATGACGTACTGC
AGGF1senseCACCGCTGGTACCGATAGAACAGAAATTCAAGAGATTTCTGTTCTATCGGTACCAGTTTTTTG
antisenseGATCCAAAAAACTGGTACCGATAGAACAGAAATCTCTTGAATTTCTGTTCTATCGGTACCAGC
NCsenseCACCGTTCTCCGAACGTGTCACGTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTG
antisenseGATCCAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGACGTGACACGTTCGGAGAAC
Sequences of shRNA Template

Cell Viability Assay

Cell Counting Kit-8 assay (CCK-8, Dojin, Japan) was performed to determine the viability of endothelial cells. The endothelial cells were seeded in 96-well plates at the density of 2 × 103 cells/well. Then cells were cultured for 24 hr with glioma-exposed medium respectively. 10 μL of CCK-8 solution was added into each well to test the viability. Optical density value was evaluated at 450 nm using the SpectraMax M5 microplate reader (Molecular Devices, USA).

Cell Migration Assay

The migration of endothelial cell in vitro was assessed by 24-well Transwell inserts (6.5 mm in diameter, 8-μm pore size; Costar, Corning, NY, USA). The hCMEC/D3 cells were suspended with serum-free medium at the density of 5 × 105 cells/mL. 100 μL suspension was added to the upper compartment and 600 μL of EBM-2 medium (or glioma-conditioned medium) supplemented with 10% FBS was added into the lower compartment. Non-migrated cells on the top surface of membrane were removed with cotton swabs carefully after incubation for 48 hr. Migrated cells in the lower surface of the membrane were fixed with methanol/glacial acetic acid mixture for 30 min. After being washed twice with PBS gently, cells were stained with 10% Giemsa solution for 30 min at 37°C and washed twice with PBS gently. Then the pictures of stained cells were taken with an inverted microscope. And the cell numbers in five random fields were counted. Data were collected from five repeated independent experiments.

Tube Formation Assay

Matrigel assay was performed to evaluate endothelial tube formation in vitro as previously described. 96-well plates (Corning, NY, USA) were coated with 100 μL of Matrigel (BD Biosciences, Bedford, MA, USA) in each well and incubated to polymerize at 37°C for 30 min. Endothelial cells were harvested and suspended in fresh EBM-2 medium or glioma-conditioned medium at the density of 4 × 105 cells/mL. 100 μL of cell suspension was seeded on the surface of polymerized Matrigel in 96-well plates and incubated at 37°C for 24 hr. Three or more random pictures of each culture were taken with a digital camera system (Olympus, Tokyo, Japan), and total tubule length and number of branches were analyzed by ImageJ software. Five repeated independent experiments were performed.

qRT-PCR

Total RNA was extracted from the cultured cells with TRIzol reagent according to the manufacturer (Life Technologies Corporation, Carlsbad, CA, USA). The concentration and quality of RNA were determined for each sample with the 260/280 nm ratio with a NanoDrop Spectrophotometer (ND-100; Thermo Fisher Scientific, Waltham, MA, USA). The expression of circ-SHKBP1 was measured using one-step PrimeScript RT-PCR Kit (RR064A; Takara, Japan). In addition, RNase-R was used to confirm the existence of circ-SHKBP1 and eliminated the influence of linear RNAs. RT-PCR and real-time PCR amplification were carried out using TaqMan MicroRNA Reverse Transcription Kit and TaqMan Universal Master Mix II to quantify miR-544a/miR-379 expression, which was normalized to that of U6 housekeeping gene with the 2−ΔΔCt formula. One Step SYBR PrimeScript RT-PCR Kit (Takara Biomedical Technology, Dalian, China) was used to qualify the expressions of SHKBP1, FOXP1/FOXP2, and AGGF1. Their expressions were normalized to endogenous control GAPDH, and fold-change was calculated using relative quantification (2−ΔΔ Ct). For details, see Table 2.
Table 2

Primers and Probes Used for qRT-PCR

Primer or ProbeGeneSequence (5′→3′) or Assay ID
Primercirc-SHKBP1F: AGGTCAGGCAGAGGAAGTCA
R: CGCGTCATAACTGGTGATGG
P: FAM+TCAGTGTCTACCTCACCCCCAAGACC+BHQ1
GAPDHF: GGACCTGACCTGCCGTCTAG
R: TAGCCCAGGATGCCCTTGAG
P: FAM+CCTCCGACGCCTGCTTCACCACCT+Eclipse
SHKBP1F: ATCTGAATGTGGGAGGCAAG
R: CTCCGGTCTCATCTTTCAGC
FOXP1F: AACCATCAGCCCTCTAGGAGT
R: TTAGGCTGACACACAGGTCC
FOXP2F: TCAAAGCCACCATCAGACAA
R: GACGCCAAAACAATCACAGA
AGGF1F: ATGAGGATGGTTTGCCTGTC
R: TGGAGAAGATGGGTTGGAAG
ProbemiR-544a001138 (Applied Biosystems)
miR-3794427975 (Applied Biosystems)
U6001973 (Applied Biosystems)
Primers and Probes Used for qRT-PCR

Western Blot Assay

Western blot assay was performed to detect the expressions of FOXP1/FOXP2, AGGF1, PI3K/AKT, and ERK. Cells were lysed with ice-cold radioimmunoprecipitation assay (RIPA) buffer supplemented with protease inhibitors (Beyotime Institute of Biotechnology). The proteins were separated by SDS-PAGE and transferred onto PVDF membrane (Millipore, USA). Non-specific bindings were blocked with 5% fat-free milk in tris-buffered saline Tween-20 (TBST). The membranes were subsequently incubated with primary antibody against FOXP1 (1:500; Abcam, Cambridge, MA, USA), FOXP2 (1:1,000; Proteintech, Chicago, IL, USA), AGGF1 (1:1,000; Proteintech, Chicago, IL, USA), p-ERK (1:1,000; Cell Signaling, Beverly, MA, USA), ERK (1:1,000; Cell Signaling, Beverly, MA, USA), p-AKT (1:1,000; Cell Signaling, Beverly, MA, USA), AKT (1:1,000; Cell Signaling, Beverly, MA, USA), p-PI3K (1:500; Bioworld, MN, USA), PI3K (1:1,000; Cell Signaling, Beverly, MA, USA), and GAPDH (1:10,000; Proteintech, Chicago, IL, USA) at 4°C overnight. The membranes were washed and incubated with respective HRP-conjugated secondary antibody. Immunoblots were visualized by enhanced chemiluminescence (ECL Kit; Beyotime Institute of Biotechnology, Jiangsu, China) and scanned with Chemi Imager 5500 V2.03 software, and the relative integrated density values (IDVs) were calculated by Fluor Chen 2.0 software and then normalized with that of GAPDH. Image is representative of five independent experiments.

Dual-Luciferase Reporter Assay

The interactions of circ-SHKBP1 and miR-544a/miR-379 were predicted with starBase v2.0 (http://starbase.sysu.edu.cn/), and the binding sites of miR-544a/miR-379 and FOXP1/FOXP2 were predicted with microRNA.org (http://34.236.212.39/microrna/microrna/home). The putative miR-544a/miR-379 target binding sequences and mutant sequences in circ-SHKBP1 (or SHKBP1) were synthesized and cloned into the pmirGLO promoter vector (Promega, Madison, WI, USA). WT pmirGLO-circ-SHKBP1/SHKBP1 (or mutated-type pmirGLO-circ-SHKBP1/SHKBP1) reporter plasmid and miR-544a/miR-379 agomir (or agomir NC) were co-transfected into HEK293T cells. The pmirGLO empty vector was transfected as “Control” group. The luciferase activity was measured 48 hr after transfection with the Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA). The Renilla luciferase activity was used as internal control to normalize the value. The relative luciferase activity was expressed as the ratio of firefly luciferase activity to Renilla luciferase activity. To examine whether miR-544a/miR-379 targeted FOXP1/FOXP2, respectively, WT FOXP1/FOXP2-3′ UTR reporter plasmid (FOXP1/FOXP2-WT) and mutated-type FOXP1/FOXP2-3′ UTR reporter plasmid (FOXP1/FOXP2-mut) were constructed with pmirGLO-promoter vector. The transfection approach and measurement of luciferase activities were performed as described above.

RIP Assay

Whole cell lysate was incubated with RIP buffer containing magnetic beads conjugated with human anti-Ago2 antibody, or NC normal mouse IgG. The samples were incubated with Proteinase K and then immunoprecipitated RNA was isolated. The RNA concentration was measured by a spectrophotometer (NanoDrop, Thermo Scientific, Waltham, MA, USA), and the RNA quality was assessed using a bioanalyzer (Agilent, Santa Clara, CA, USA). Furthermore, purified RNAs were extracted and analyzed by qRT-PCR to demonstrate the presence of the binding targets.

ChIP Assay

ChIP assay was performed with Simple ChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology, Danvers, MA, USA) according to the manufacturer’s protocol. Cells were crosslinked with 1% formaldehyde and collected in lysis buffer. 2% aliquots of lysates was used as an input control, and the remaining lysates were immunoprecipitated with normal rabbit IgG or FOXP1/FOXP2 antibody. Immunoprecipitated DNA was amplified by PCR using primers, which were listed in Table 3.
Table 3

Primers Used for ChIP Experiments

GeneBinding Site or ControlSequences (5′→3′)Product Size (bp)Annealing Temperature (°C)
AGGF1PCR1F: AGAGCATCATAGTCCCCACAAA16558.2
R: GAAGCCCTAAGAGCGACAGG
PCR2F: GGCCAATCTACCAGGGACTC13961.9
R: TTCCTGCCTCTCTATGGGACC
PCR3F: TGGCAAGGGAGAAATGTGACT12858
R: ATGAGGCACCATACCCCTCA
PCR4F: GCATCACAGGGGACATACCA21759.8
R: CTTGTGCACTGCCCACTAGA
Primers Used for ChIP Experiments

In Vivo Matrigel Plug Assay

All animal procedures were performed in accordance to the protocols approved by the Animal Care Committee of the Shengjing Hospital. Four-week-old BALB/C athymic nude mice were obtained from the National Laboratory Animal Center (Beijing, China). The animals were fed with autoclaved food and water during the study. The nude mice were divided into five groups: control group, circ-SHKBP1 (−) NC + miR-544a/miR-379 (+) NC group, circ-SHKBP1 (−) group, miR-544a/379 (+) group, and circ-SHKBP1 (−) + miR-544a/miR-379 (+) group. Angiogenesis was measured by a Matrigel plug assay as previously described. In brief, 3 × 106 GECs in 400 μL of solution containing 80% Matrigel were subcutaneously injected. Plugs were harvested after 4 days, weighed, photographed, and dispersed in 400 μL of PBS (overnight incubation at 4°C) to collect the hemoglobin. Hemoglobin content was measured using Drabkin’s solution (Sigma) according to the manufacturer’s recommendations.

Statistical Analysis

Experimental data were presented as mean ± SD from at least three independent experiments. All statistical analyses were performed with SPSS 18.0 statistical software. Student’s t test (two tailed) or one-way ANOVA followed by Bonferroni’s post-test were utilized to determine the significant differences. p < 0.05 was considered to be statistically significant.

Author Contributions

Study concept and design: Y.X. and Y.L. Acquisition of data: Q.H., X.L., J.Z., H.Y., J.M., and H.C. Analysis and interpretation of data: Q.H., L.Z., and Z.L. Drafting of the manuscript: Q.H. and L.Z. Critical revision of the manuscript for important intellectual content: Y.X. and L.Z. Final approval of the version to be published: Y.X. Administrative, technical, and material support: Y.X., Y.L., P.W., and L.L. Besides this they all agree to be accountable for all aspects of the work.

Conflicts of Interest

The authors disclose no potential conflicts of interest.
  63 in total

1.  VEGF and PlGF promote adult vasculogenesis by enhancing EPC recruitment and vessel formation at the site of tumor neovascularization.

Authors:  Bin Li; Emerson E Sharpe; Amanda B Maupin; Amylynn A Teleron; Amy L Pyle; Peter Carmeliet; Pampee P Young
Journal:  FASEB J       Date:  2006-06-05       Impact factor: 5.191

Review 2.  Circular RNAs: splicing's enigma variations.

Authors:  Matthias W Hentze; Thomas Preiss
Journal:  EMBO J       Date:  2013-03-05       Impact factor: 11.598

3.  Involvement of Foxo transcription factors in angiogenesis and postnatal neovascularization.

Authors:  Michael Potente; Carmen Urbich; Ken-ichiro Sasaki; Wolf K Hofmann; Christopher Heeschen; Alexandra Aicher; Ramya Kollipara; Ronald A DePinho; Andreas M Zeiher; Stefanie Dimmeler
Journal:  J Clin Invest       Date:  2005-08-11       Impact factor: 14.808

4.  Haploinsufficiency of Klippel-Trenaunay syndrome gene Aggf1 inhibits developmental and pathological angiogenesis by inactivating PI3K and AKT and disrupts vascular integrity by activating VE-cadherin.

Authors:  Teng Zhang; Yufeng Yao; Jingjing Wang; Yong Li; Ping He; Vinay Pasupuleti; Zhengkun Hu; Xinzhen Jia; Qixue Song; Xiao-Li Tian; Changqing Hu; Qiuyun Chen; Qing Kenneth Wang
Journal:  Hum Mol Genet       Date:  2016-12-01       Impact factor: 6.150

5.  Natural RNA circles function as efficient microRNA sponges.

Authors:  Thomas B Hansen; Trine I Jensen; Bettina H Clausen; Jesper B Bramsen; Bente Finsen; Christian K Damgaard; Jørgen Kjems
Journal:  Nature       Date:  2013-02-27       Impact factor: 49.962

6.  The expression and functional characterization of ABCG2 in brain endothelial cells and vessels.

Authors:  Wandong Zhang; Jelena Mojsilovic-Petrovic; Moises F Andrade; Hong Zhang; Marguerite Ball; Danica B Stanimirovic
Journal:  FASEB J       Date:  2003-09-04       Impact factor: 5.191

Review 7.  The role of microRNAs in glioma initiation and progression.

Authors:  Ying Zhang; Anindya Dutta; Roger Abounader
Journal:  Front Biosci (Landmark Ed)       Date:  2012-01-01

8.  circRNA_100290 plays a role in oral cancer by functioning as a sponge of the miR-29 family.

Authors:  L Chen; S Zhang; J Wu; J Cui; L Zhong; L Zeng; S Ge
Journal:  Oncogene       Date:  2017-04-03       Impact factor: 9.867

9.  TTBK2 circular RNA promotes glioma malignancy by regulating miR-217/HNF1β/Derlin-1 pathway.

Authors:  Jian Zheng; Xiaobai Liu; Yixue Xue; Wei Gong; Jun Ma; Zhuo Xi; Zhongyou Que; Yunhui Liu
Journal:  J Hematol Oncol       Date:  2017-02-20       Impact factor: 17.388

10.  Silencing of cZNF292 circular RNA suppresses human glioma tube formation via the Wnt/β-catenin signaling pathway.

Authors:  Ping Yang; Zhijun Qiu; Yuan Jiang; Lei Dong; Wensheng Yang; Chao Gu; Guang Li; Yu Zhu
Journal:  Oncotarget       Date:  2016-09-27
View more
  48 in total

Review 1.  Role of circular RNAs in brain development and CNS diseases.

Authors:  Suresh L Mehta; Robert J Dempsey; Raghu Vemuganti
Journal:  Prog Neurobiol       Date:  2020-01-10       Impact factor: 11.685

Review 2.  Circular RNAs: Functions and Prospects in Glioma.

Authors:  Zheng Hao; Si Hu; Zheng Liu; Weixin Song; Yeyu Zhao; Meihua Li
Journal:  J Mol Neurosci       Date:  2018-11-20       Impact factor: 3.444

3.  Circular RNA CircSHKBP1 accelerates the proliferation, invasion, angiogenesis, and stem cell-like properties via modulation of microR-766-5p/high mobility group AT-hook 2 axis in laryngeal squamous cell carcinoma.

Authors:  Fu Chen; Haiyan Zhang; Jie Wang
Journal:  Bioengineered       Date:  2022-05       Impact factor: 6.832

4.  CircFOXO3 promotes glioblastoma progression by acting as a competing endogenous RNA for NFAT5.

Authors:  Shuai Zhang; Keman Liao; Zengli Miao; Qing Wang; Yifeng Miao; Zhongye Guo; Yun Qiu; Binghong Chen; Li Ren; Zilong Wei; Yingying Lin; Xiaojie Lu; Yongming Qiu
Journal:  Neuro Oncol       Date:  2019-10-09       Impact factor: 12.300

Review 5.  Circular RNAs open a new chapter in cardiovascular biology.

Authors:  Simona Aufiero; Yolan J Reckman; Yigal M Pinto; Esther E Creemers
Journal:  Nat Rev Cardiol       Date:  2019-08       Impact factor: 32.419

6.  FMR1/circCHAF1A/miR-211-5p/HOXC8 feedback loop regulates proliferation and tumorigenesis via MDM2-dependent p53 signaling in GSCs.

Authors:  Yang Jiang; Zhenlin Wang; Chenting Ying; Jiangfeng Hu; Tao Zeng; Liang Gao
Journal:  Oncogene       Date:  2021-05-20       Impact factor: 9.867

Review 7.  Function and clinical significance of circRNAs in solid tumors.

Authors:  Yiting Geng; Jingting Jiang; Changping Wu
Journal:  J Hematol Oncol       Date:  2018-07-31       Impact factor: 17.388

Review 8.  Targeting the forkhead box protein P1 pathway as a novel therapeutic approach for cardiovascular diseases.

Authors:  Xin-Ming Liu; Sheng-Li Du; Ran Miao; Le-Feng Wang; Jiu-Chang Zhong
Journal:  Heart Fail Rev       Date:  2022-01       Impact factor: 4.214

9.  Landscape of cell heterogeneity and evolutionary trajectory in ulcerative colitis-associated colon cancer revealed by single-cell RNA sequencing.

Authors:  Quan Wang; Zhu Wang; Zhen Zhang; Wei Zhang; Mengmeng Zhang; Zhanlong Shen; Yingjiang Ye; Kewei Jiang; Shan Wang
Journal:  Chin J Cancer Res       Date:  2021-04-30       Impact factor: 5.087

10.  Micro-Raman Characterization of Structural Features of High-k Stack Layer of SOI Nanowire Chip, Designed to Detect Circular RNA Associated with the Development of Glioma.

Authors:  Yuri D Ivanov; Kristina A Malsagova; Vladimir P Popov; Igor N Kupriyanov; Tatyana O Pleshakova; Rafael A Galiullin; Vadim S Ziborov; Alexander Yu Dolgoborodov; Oleg F Petrov; Andrey V Miakonkikh; Konstantin V Rudenko; Alexander V Glukhov; Alexander Yu Smirnov; Dmitry Yu Usachev; Olga A Gadzhieva; Boris A Bashiryan; Vadim N Shimansky; Dmitry V Enikeev; Natalia V Potoldykova; Alexander I Archakov
Journal:  Molecules       Date:  2021-06-18       Impact factor: 4.411

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.