Literature DB >> 29499747

Prevalence and genetic diversity of Trichomonas vaginalis clinical isolates in a targeted population in Xinxiang City, Henan Province, China.

Zhenchao Zhang1, Lixia Kang2, Weijuan Wang2, Xin Zhao2, Yuhua Li3, Qing Xie1, Shuai Wang4, Tong He1, Han Li1, Tingwei Xiao1, Yunchao Chen1, Suqiong Zuo1, Lingmin Kong1, Pengju Li1, Xiangrui Li5,6.   

Abstract

BACKGROUND: Trichomonas vaginalis (TV) is a protozoan parasite that causes trichomoniasis, a sexually transmitted disease, worldwide. In this study, we investigated the prevalence and genetic characterization of T. vaginalis and contrasted the most prevalent strains of T. vaginalis isolated from Xinxiang City, Henan Province, China.
RESULTS: In Xinxiang from September 2015 to September 2017, a total of 267 (1.64%, 95% confidence interval, CI: 1.45-1.85) clinical T. vaginalis-positive samples from vaginal secretions were observed by wet mount microscopy from 16,294 women with some clinical symptoms of trichomoniasis. We found that trichomoniasis frequently occurred in the 21- to 40-year-old age group and in winter. After the 267 clinical T. vaginalis positive samples were cultured, 68 isolates of T. vaginalis were harvested and identified as genotype E (58.82%), H (17.65%), mixed 1 (17.65%) and mixed 2 (5.88%) using a sensitive and reliable polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) typing method on the actin gene. The phylogenetic diversity analysis showed that the genotype E samples fell within a separate clade compared to the other T. vaginalis isolates, while the samples of the genotype H separated into two clades.
CONCLUSIONS: Our results demonstrate a notable gene polymorphism of clinical isolates from the targeted population and provide insight into the performance of these genetic markers in the molecular epidemiology of trichomoniasis. However, further studies are needed to clarify the association between a certain genotype and the pathogenicity of T. vaginalis.

Entities:  

Keywords:  China; Genetic diversity; Prevalence; Trichomonas vaginalis

Mesh:

Substances:

Year:  2018        PMID: 29499747      PMCID: PMC5834841          DOI: 10.1186/s13071-018-2753-4

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Background

Trichomonas vaginalis (TV), which causes non-viral sexually transmitted disease, is a protozoan that parasitizes the urogenital tract of humans, leading to trichomoniasis. The World Health Organization (WHO) estimated that 248 million people were infected with TV in 2005, and by 2008, this number had increased by 11.2% to 276.4 million [1]. The pathogen infects not only women but also men, and the infection is frequently asymptomatic in both women and men. In women, the disease may range from the absence of symptoms (in up to 50% of women) to severe vaginitis and urethritis symptoms, and patients infected with TV are at high risk of cervical cancer and adverse pregnancy outcomes [2]. Although men are often asymptomatic carriers of T. vaginalis, dysuria and discharge have also been reported, and T. vaginalis infection also increases the risk of infertility and prostate cancer in men [3]. Moreover, the infection of T. vaginalis has been linked with increased risk and transmission of HIV infection [4]. Trichomoniasis is primarily treated with drugs; metronidazole is a common drug used to treat this disease [5]. However, the Centers for Disease Control and Prevention (CDC) has predicted that 2–5% of clinical T. vaginalis isolates have some level of drug resistance to metronidazole [6]. Despite the public health importance and global distribution of trichomoniasis, we have little knowledge of the various features of the infection of T. vaginalis. Moreover, the pathogenicity, drug resistance and other epidemiological aspects of T. vaginalis have still not been clarified. Thus, studies based on the genetic analysis of the parasite would be useful. PCR and its related methods are widely used in molecular epidemiology for genetic studies of organisms, depending on their sensitivity and reliability [7]. Thus far, these methods for studying the genetic diversity of parasites include PCR-hybridization, PCR-size polymorphism, random amplification of polymorphic DNA (RAPD) and PCR-RFLP [8]. PCR-RFLP possesses both the reliability of RFLP and the sensitivity of PCR; therefore, it is an appropriate method of strain typing assessment [8]. With approximately 60,000 protein-coding genes, the genome of T. vaginalis is 160 Mb. Many repeated and transposable elements are contained in the genome that can vary in position, and the genome may explain the noticeable genetic variability of T. vaginalis [9]. As the structural proteins present in the eukaryotic cytoskeleton, the protein of actin is encoded by a gene family that includes no fewer than nine members in T. vaginalis [10]. Morphological changes of T. vaginalis, such as surface adhesion and the form alternation from flagellate to amoeboid, are considered to be influenced by actin. In addition, the actin protein has a conserved nature of ubiquity [11], which makes its use feasible for identifying intra-species molecular diversity. Until now, studies of the genetic diversity and molecular epidemiology of T. vaginalis were rare in China. To obtain more knowledge regarding the genetic properties of T. vaginalis in Xinxiang City, Henan Province, China, based on the actin gene, we assessed the situation of genetic diversity in T. vaginalis isolates through PCR-RFLP and sequence analysis.

Methods

Trichomonas vaginalis isolates

From September 2015 to September 2017, vaginal secretions were collected by medical staff through swabs from 16,294 women with some clinical symptoms of trichomoniasis at the Third Affiliated Hospital of Xinxiang Medical University. These samples were examined by wet mount microscopy, and the positive samples of clinical T. vaginalis were cultured on TYM medium with antibiotics (50 mg/ml ciprofloxacin, 100 mg/ml ceftriaxone), fungicides (2.5 mg/ml amphotericin B) and 10% calf serum at a temperature of 37 °C. We harvested the parasites by centrifugation at the stationary phase (2 × 106 parasites) and applied DNA extraction directly.

DNA extraction

We washed the trophozoite of T. vaginalis three times in PBS (pH 7.2) at 5000 rpm for 5 min and then extracted the nucleic acids with E.Z.N.A.® Tissue DNA Kit (OMEGA, Zhengzhou, China), in accordance with the manufacturer’s instructions.

PCR-RFLP

We chose the target of the nested PCR based on the actin gene (GenBank: AF237734). The selection of outer primers (OPs) and inner primers (IPs) was done according to references [12, 13], and the primer sequences are provided in Table 1. The length of the target was 1100 bp. The PCR amplification was conducted using a thermocycler (Bio-Rad, USA) in two steps. The first step of the PCR reaction was composed of 5 μl DNA, 12.5 μl master mix (Yi Fei Xue Biotechnology, Nanjing, China), and 2 μl OPs (20 pmol each of OP-F and OP-R) in 25 μl of final volume. The second step of the PCR reaction was composed of 5 μl first stage PCR products, 25 μl master mix, and 4 μl IPs (20 pmol each of IP-F and IP-R) in 50 μl of final volume. There were 35 cycles in the first step. Each cycle was composed of denaturation (95 °C for 45 s), annealing (55 °C for 30 s), and extension (72 °C for 1 min). Denaturation at 95 °C was conducted for 5 min before the first cycle, and a 10 min final extension at 72 °C was conducted after the last cycle. There were also 35 cycles in the second step. The denaturation and extension were the same as those in the first step, but the temperature for annealing was 50 °C. After PCR, we analyzed 5 μl PCR product through electrophoresis on 1% agarose gel in Tris-acetate-EDTA buffer (TAE, pH 8.5) and then visualized it under UV light with 0.5 μg/ml ethidium bromide staining (Applichem, Biochemica, Darmstadt, Germany). The length of the target was 1100 bp, which is only 28 bp shorter than the size of the actin gene’s open reading frame.
Table 1

Oligonucleotide primer sequences used for Nested PCR in this research

NameSequences (5'-3')Description
OP-FTCTGGAATGGCTGAAGAAGACGForward primer for the actin gene of T. vaginalis in the first stage
OP-RCAGGGTACATCGTATTGGTCReverse primer for the actin gene of T. vaginalis in the first stage
IP-FCAGACACTCGTTATCGForward primer for the actin gene of T. vaginalis in the second stage
IP-RCGGTGAACGATGGATGReverse primer for the actin gene of T. vaginalis in the second stage
Oligonucleotide primer sequences used for Nested PCR in this research For RFLP, we digested 10 μl amplified product using 0.5 μl of each restriction endonuclease HindII (10 U/μl, 500 units), MseI (10 U/μl, 300 units) and RsaI (10 U/μl, 1000 units), separately (Yi Fei Xue Biotechnology, Nanjing, China). We incubated the reaction at 37 °C for 4 h. We separated the fragments on a 3% agarose gel in TAE buffer, as previously described. Ultimately, we stained the gel using ethidium bromide and visualized it with a transilluminator. We measured the size of the amplified products with a 100 bp commercial weight marker (Yi Fei Xue Biotechnology, Nanjing, China).

Sequence analysis

All clinical isolates were sequenced using the Sanger technique (Genewiz, Suzhou, China) for determination of the fragments size and confirmation of the banding patterns. We edited and aligned the sequences using Clustal W (http://www.ebi.ac.uk/Tools/msa/clustalo/) and compared them with the reference sequences of GenBank (EU076580, AF237734, EU076582, EU076584, EU076579, EU076578, EU076585, EU076583, EU076586 and AB468096). For the analysis of phylogenetic diversity of T. vaginalis, we built a phylogenetic tree with molecular evolutionary genetics analysis (MEGA) software (version 6.0) [14] using the neighbor-joining (NJ) algorithm, containing sequences representing T. vaginalis isolates from GenBank.

Statistical analysis

We performed all statistical analyses with the SPSS 20 software for Windows (SPSS Inc, Chicago, IL, USA). The Chi-square test was used for statistical analyses of the prevalence of T. vaginalis under the different variables, and P < 0.05 was considered to indicate a statistically significant difference.

Results

The prevalence of T. vaginalis

A total of 267 (1.64%, 95% CI: 1.45–1.85%) clinically positive T. vaginalis samples from vaginal secretions were collected from 16,294 women with some clinical symptoms of trichomoniasis, including vaginitis, urethritis, low birth weight infants and preterm delivery, premature rupture of membranes, and infertility. After the 267 clinically positive T. vaginalis samples were cultured on TYM medium with antibiotics, fungicides and 10% calf serum at 37 °C, 68 isolates of T. vaginalis were harvested and observed through a microscope. In the present study, as shown in Fig. 1a and Table 2, a significant difference was observed in the prevalence of T. vaginalis in different age groups (χ2 = 104.71, df = 4, P < 0.001). In the 267 women infected with T. vaginalis, higher infection rates were detected in 21- to 30-year-old women (31.09%, n = 83) and 31- to 40-year-old women (32.21%, n = 86), followed by the infection rate (22.85%, n = 61) in 41- to 50-year-old women, while the infection rates found in women ≤ 20 years of age and ≥ 51 years of age were 5.24% (n = 14) and 8.61% (n = 23), respectively. In the ≤ 30 years of age group, the infection rate of T. vaginalis in women increased significantly (χ2 = 59.98, df = 1, P < 0.001) following age increase, while in the ≥ 31 years of age group, the infection rate decreased significantly (χ2 = 45.09, df = 2, P < 0.001) following age increase. The infection rate of T. vaginalis in women was highest (63.30%, n = 169) in the 21- to 40-year-old age group.
Fig. 1

Epidemic characteristics of trichomoniasis by age and season in Xinxiang. a Prevalence of T. vaginalis in different age groups. b Prevalence of T. vaginalis in the four seasons of the year

Table 2

The prevalence of T. vaginalis in women in Xinxiang City, Henan Province, China

VariableNo. of infectionsInfection rate (%)
Age (years)
 ≤ 20145.24a
 21–308331.09b
 31–408632.21b
 41–506122.85c
 ≥ 51238.61a
Season
 Spring5319.85a
 Summer5821.72a
 Autumn6725.09a
 Winter8933.33b
Total267100

Note: Values bearing a different superscript letter (a-c) within a column differ significantly from one another (P < 0.05)

Epidemic characteristics of trichomoniasis by age and season in Xinxiang. a Prevalence of T. vaginalis in different age groups. b Prevalence of T. vaginalis in the four seasons of the year The prevalence of T. vaginalis in women in Xinxiang City, Henan Province, China Note: Values bearing a different superscript letter (a-c) within a column differ significantly from one another (P < 0.05) In addition, a significant difference was observed in the prevalence of T. vaginalis in the four seasons of the year (χ2 = 15.20, df = 3, P = 0.002) (Fig. 1b, Table 2). In the 267 women infected with T. vaginalis, 19.85% (n = 53) and 21.72% (n = 58) of infections were found in the spring and summer, respectively, and 25.09% (n = 67) was found in autumn, while the infection rate found in women in winter was 33.33% (n = 89). Thus, the infection rate of T. vaginalis in women was highest in winter in the city of Xinxiang.

Nested PCR

The amplification of the actin gene of T. vaginalis by nested PCR demonstrated a 1100 bp fragment among all isolates, and agarose gel electrophoresis indicated that there was no difference in the length of the 68 amplicons.

Trichomonas vaginalis actin genotypes

The actin genotypes, length of DNA fragments and pattern groups of the T. vaginalis isolates are demonstrated in Table 3. The restriction enzyme HindII digested the amplified products into two patterns: four distinct DNA fragments of 60, 213, 401 and 426 bp or three DNA fragments of 60, 213 and 827 bp. Digestion of the amplified product using RsaI produced four patterns, including six distinct DNA fragments of 87, 103, 106, 116, 236 and 452 bp; five DNA fragments of 106, 116, 190, 236 and 452 bp; five DNA fragments of 87, 103, 106, 236 and 568 bp; and four DNA fragments of 106, 190, 236 and 568 bp. Digestion of the amplified product using MseI produced three patterns, including: three distinct fragments of 186, 333 and 581 bp and two DNA fragments of 519 and 581 bp.
Table 3

Size of fragments, pattern groups and actin genotypes of the T. vaginalis (extracted from [12])

GenotypeRestriction with HindII (bp)Restriction with RsaI (bp)Restriction with MseI (bp)
A827, 213, 60568, 236, 190, 106581, 519
E827, 213, 60568, 236, 106, 103, 87581, 315, 204
G426, 401, 213, 60568, 236, 190, 106581, 519
H426, 401, 213, 60568, 236, 106, 103, 87581, 519
I426, 401, 213, 60452, 236, 190, 116, 106581, 519
M426, 401, 213, 60568, 236, 190, 106581, 333, 186
N426, 401, 213, 60568, 236, 106, 103, 87581, 333, 186
P426, 401, 213, 60452, 236, 116, 106, 103, 87581, 333, 186
Size of fragments, pattern groups and actin genotypes of the T. vaginalis (extracted from [12]) Separation of the DNA fragments after gel electrophoresis is shown in Fig. 2. The figure demonstrates the patterns of DNA fragments of isolates 14, 19, 42 and 56, which display actin genotypes E, H, mixed 1 and mixed 2, respectively. As shown in Fig. 3, the major genotype was type E (58.82%), followed by type H (17.65%), type mixed 1 (17.65%), and type mixed 2 (5.88%). In addition, the actin genotypes of A, G, I, M, N and P were not found in these isolates.
Fig. 2

DNA fragment patterns of isolates after the digestion of actin genotypes E (a), H (b), mixed 1 (c) and mixed 2 (d) on 3% agarose gel. Lane M: 2000 bp DNA marker; Lane 1: banding patterns after digestion with HindII; Lane 2: banding patterns after digestion with RsaI; Lane 3: banding patterns after digestion with MseI

Fig. 3

Percentage of actin genotypes E, H, mixed 1 and mixed 2 of the isolates

DNA fragment patterns of isolates after the digestion of actin genotypes E (a), H (b), mixed 1 (c) and mixed 2 (d) on 3% agarose gel. Lane M: 2000 bp DNA marker; Lane 1: banding patterns after digestion with HindII; Lane 2: banding patterns after digestion with RsaI; Lane 3: banding patterns after digestion with MseI Percentage of actin genotypes E, H, mixed 1 and mixed 2 of the isolates

Phylogenetic diversity

In addition to the samples of type mixed, 52 sequences of the actin gene from the remaining T. vaginalis isolates were obtained and analyzed. In these sequences, there were 2 different sequences in genotype H and 3 different sequences in genotype E. The 5 sequences were submitted to GenBank under the accession numbers MG253641, MG253642, MG253643, MG253644 and MG253645. To assess genetic diversity among the T. vaginalis isolates, we conducted a multiple alignment of the various T. vaginalis actin genotypes with the sequences found in this study and reference isolates and constructed a tree with the NJ algorithm (Fig. 4). The five sequences detected in the present study are shown with a dark square in this phylogenetic tree. We drew branch lengths to scale, according to genetic distances between isolates, and this figure demonstrates that T. vaginalis 24 (H) is heterogeneous and not located in the cluster of type H. The phylogenetic diversity analysis showed that the genotype E samples fell within a separate clade compared to the other T. vaginalis isolates, while the samples of the genotype H separated into two clades.
Fig. 4

A phylogenetic tree of Xinxiang and reference trichomonad isolates, based on the actin gene. The five sequence types identified in this study are shown with a dark square

A phylogenetic tree of Xinxiang and reference trichomonad isolates, based on the actin gene. The five sequence types identified in this study are shown with a dark square

Discussion

Trichomoniasis is a common sexually transmitted disease. Between 2011 and 2014, the prevalence of T. vaginalis was 2.4 % in Granada, Southern Spain [15]. In Korea, a cross-sectional analysis was implemented to investigate the prevalence of sexually transmitted infections triggered by the pathogens T. vaginalis, Neisseria gonorrhoeae, human immunodeficiency virus (HIV), herpes simplex virus (HSV), Mycoplasma genitalium, Chlamydia trachomatis, Mycoplasma hominis, Ureaplasma parvum, Treponema pallidum and Ureaplasma urealyticum, and among them, the prevalence of T. vaginalis was 0.8% [16]. In Western Canada, the prevalence of T. vaginalis (2.8%) in female sexually transmitted infection clinic attendees was within the prevalence of gonorrhea (1.8%) and chlamydia (5.8%), while the prevalence of T. vaginalis was low for male attendees (0.2%) [3]. Moreover, a cross-sectional study was conducted in a city of Yunnan Province in southern China, and the prevalence of T. vaginalis was 9.0% in 734 female sex workers [17]. In the present study, 16,294 vaginal secretions were collected from women with some clinical symptoms of trichomoniasis in the city of Xinxiang, Henan Province, China, and among them, 267 (1.64%, 95% CI: 1.45–1.85%) clinically positive T. vaginalis samples were observed by wet mount microscopy. In addition, our study showed that the infection rate of T. vaginalis was highest in women 21 to 40 years old, and the infection rate increased significantly (χ2 = 59.98, df = 1, P < 0.001) as age increased in the ≤ 30 years of age group and decreased significantly (χ2 = 45.09, df = 2, P < 0.001) as age increased in the ≥ 31 years of age group. The infection rate of T. vaginalis in winter was higher than that in other seasons. The diagnostic method of wet mount microscopy for T. vaginalis has been shown to have low sensitivity. Thus, the result of infection rate of T. vaginalis might be influenced by this diagnostic method. Because of the lack of awareness about the genetic distribution and mapping of parasites, there have been few studies on T. vaginalis transmission routes, virulence factors and the prevalence and sensitivity to metronidazole of various genotypes [18]. The technique of strain typing is important for investigating the epidemiology of parasitic infections. Thus far, the techniques of molecular typing for T. vaginalis include multilocus sequence typing (MLST), RAPD-PCR, PCR-RFLP and sequencing polymorphism based on multifarious markers, for instance, ITS and microsatellite [12, 19, 20]. In these techniques, PCR-RFLP based on the actin gene was used for strain typing of T. vaginalis clinical isolates as a reproducible and sensitive tool. A promising study has been conducted through PCR-RFLP analysis of the actin gene with three restriction enzymes (MseI, RsaI and HindII); the digestion patterns showed that 8 different genotypes were identified as the prominent genotypes in Zambia and Kinshasa, and the actin genotypes G and E were the predominant genotypes [12]. Moreover, in the isolates from Kerman and Shiraz, Tavakoli Oliaee et al [14] identified various genotypes of T. vaginalis, among which the H and I genotypes were the most frequent types, respectively. Although actin genotypes A and P of T. vaginalis have been found in previous studies, neither were identified in the targeted population [14]. In Kenya, five actin genotypes were revealed by RFLP analysis in 2015, and 50.0% of the isolates were of actin genotype E, 27.3% of actin genotype N, 13.6% of actin genotype G and 4.5% of actin genotypes I and P [21]. Based on 18S rRNA gene sequences, genetic variants among T. vaginalis were found in the cities of Anyang, Zhengzhou, Shangqiu, Luoyang, Pingdingshan, Zhumadian and Xinyang, Henan Province, China, and the results indicated that the T. vaginalis isolates identified could be regarded as a single population [22]. In this study, two kinds of T. vaginalis actin genotypes were identified through PCR-RFLP, which targeted the actin gene. Various fragment patterns gained from RFLP have demonstrated that the types of E and H were confirmed through the designation of their nucleotide sequences, with frequencies of 58.82% and 17.65%, respectively. However, other actin genotypes of T. vaginalis (A, G, I, M, N and P) were not found in this study. In addition, the patterns of mixed 1 and mixed 2 genotypes were identified only in the city of Xinxiang, with frequencies of 17.65% and 5.88%, respectively. However, classification of mixed 1 and mixed 2 genotypes requires further study. In this study, 2 different sequences and 3 different sequences were found in types H and E, respectively. The analysis of phylogenetic diversity showed that T. vaginalis 6, T. vaginalis 16 and T. vaginalis 22 belonged to genotype E, which was consistent with the result of PCR-RFLP. However, according to the phylogenetic diversity results, T. vaginalis 21 and T. vaginalis 24 were genotype H and G, respectively, which differed from the analysis of PCR-RFLP. Sequence alignment indicated that the “T” nucleotide was replaced by the “C” nucleotide (T→C) in the nucleic acid sequence sites 149, 914 and 917 of T. vaginalis 24. Thus, the nucleic acid sequence sites 149, 914 and 917 might be the key sites of the T. vaginalis gene polymorphism. Moreover, the genotyping technique for T. vaginalis needs further study. Although T. vaginalis is recognized as having the feature of high-level diversity, this heterogenetic protozoan is a parasite with a unique population structure, including two different types with equivalent proportions worldwide [18]. In the present study, the result of phylogenetic diversity showed that the genotypes of T. vaginalis came originally from two different clades, and this finding was consistent with other studies [20, 23, 24]. Moreover, our study showed that the E genotype of T. vaginalis, as the major genotype, was present in the same clade, while the H genotype was derived from two distinct clades.

Conclusions

Even though genetic variants of T. vaginalis have already been analyzed based on 18S rRNA in Henan Province [22], the content samples were limited, and the city of Xinxiang was not included. In this study, we found that 1.64% (95% CI: 1.45–1.85%) of women were observed to be infected by T. vaginalis according to wet mount microscopy of 16,294 women with some clinical symptoms of trichomoniasis in the city of Xinxiang, Henan Province, China, and the disease occurred frequently in the 21- to 40-year-old group and in winter. After being cultured, 68 isolates of T. vaginalis were harvested and identified as genotype E, H, mixed 1 or mixed 2 based on the actin gene. The phylogenetic diversity indicated that the genotypes of T. vaginalis were derived from two distinct clades. The findings provided an insight into evaluating the performance of these genetic markers in molecular epidemiology of trichomoniasis. However, more studies are needed to clarify the association between a certain genotype and the manifestation of a clinical infection.
  24 in total

1.  Centers for Disease Control and Prevention sexually transmitted diseases treatment guidelines.

Authors:  Kimberly A Workowski; Stuart M Berman
Journal:  Clin Infect Dis       Date:  2007-04-01       Impact factor: 9.079

2.  Trichomonas vaginalis Prevalence and Correlates in Women and Men Attending STI Clinics in Western Canada.

Authors:  Jennifer Gratrix; Sabrina Plitt; LeeAnn Turnbull; Petra Smyczek; Judith Brandley; Ron Scarrott; Prenilla Naidu; Lindsay Bertholet; Max Chernesky; Ron Read; Ameeta E Singh
Journal:  Sex Transm Dis       Date:  2017-10       Impact factor: 2.830

3.  Characterization of trichomonad species and strains by PCR fingerprinting.

Authors:  S Vanácová; J Tachezy; J Kulda; J Flegr
Journal:  J Eukaryot Microbiol       Date:  1997 Nov-Dec       Impact factor: 3.346

Review 4.  Molecular methods for diagnosis and epidemiological studies of parasitic infections.

Authors:  B Singh
Journal:  Int J Parasitol       Date:  1997-10       Impact factor: 3.981

5.  Prevalence and genetic diversity of Trichomonas vaginalis in the general population of Granada and co-infections with Gardnerella vaginalis and Candida species.

Authors:  José Antonio Carrillo-Ávila; María Luisa Serrano-García; Jorge Fernández-Parra; Antonio Sorlózano-Puerto; José María Navarro-Marí; C Rune Stensvold; Jose Gutiérrez-Fernández
Journal:  J Med Microbiol       Date:  2017-10-04       Impact factor: 2.472

6.  Genetic diversity of Trichomonas vaginalis clinical isolates determined by EcoRI restriction fragment length polymorphism of heat-shock protein 70 genes.

Authors:  John C Meade; Jacqueline de Mestral; Jonathan K Stiles; W Evan Secor; Richard W Finley; John D Cleary; William B Lushbaugh
Journal:  Am J Trop Med Hyg       Date:  2009-02       Impact factor: 2.345

7.  Draft genome sequence of the sexually transmitted pathogen Trichomonas vaginalis.

Authors:  Jane M Carlton; Robert P Hirt; Joana C Silva; Arthur L Delcher; Michael Schatz; Qi Zhao; Jennifer R Wortman; Shelby L Bidwell; U Cecilia M Alsmark; Sébastien Besteiro; Thomas Sicheritz-Ponten; Christophe J Noel; Joel B Dacks; Peter G Foster; Cedric Simillion; Yves Van de Peer; Diego Miranda-Saavedra; Geoffrey J Barton; Gareth D Westrop; Sylke Müller; Daniele Dessi; Pier Luigi Fiori; Qinghu Ren; Ian Paulsen; Hanbang Zhang; Felix D Bastida-Corcuera; Augusto Simoes-Barbosa; Mark T Brown; Richard D Hayes; Mandira Mukherjee; Cheryl Y Okumura; Rachel Schneider; Alias J Smith; Stepanka Vanacova; Maria Villalvazo; Brian J Haas; Mihaela Pertea; Tamara V Feldblyum; Terry R Utterback; Chung-Li Shu; Kazutoyo Osoegawa; Pieter J de Jong; Ivan Hrdy; Lenka Horvathova; Zuzana Zubacova; Pavel Dolezal; Shehre-Banoo Malik; John M Logsdon; Katrin Henze; Arti Gupta; Ching C Wang; Rebecca L Dunne; Jacqueline A Upcroft; Peter Upcroft; Owen White; Steven L Salzberg; Petrus Tang; Cheng-Hsun Chiu; Ying-Shiung Lee; T Martin Embley; Graham H Coombs; Jeremy C Mottram; Jan Tachezy; Claire M Fraser-Liggett; Patricia J Johnson
Journal:  Science       Date:  2007-01-12       Impact factor: 47.728

8.  Molecular typing of Trichomonas vaginalis isolates by actin gene sequence analysis and carriage of T. vaginalis viruses.

Authors:  Simon C Masha; Piet Cools; Tania Crucitti; Eduard J Sanders; Mario Vaneechoutte
Journal:  Parasit Vectors       Date:  2017-10-30       Impact factor: 3.876

9.  Considerable Genetic Diversity of Trichomonas vaginalis Clinical Isolates in a Targeted Population in South of Iran.

Authors:  Razieh Tavakoli Oliaee; Zahra Babaei; Gholam Reza Hatam; Amir Tavakoli Kareshk; Hosein Mahmoudvand; Arghavan Vafafar; Naser Ziaali
Journal:  Iran J Parasitol       Date:  2017 Apr-Jun       Impact factor: 1.012

10.  Prevalence of and Risk Factors for Sexually Transmitted Infections among Korean Adolescents under Probation.

Authors:  Jin Ju Park; Yu Bin Seo; Sookyung Jeong; Jacob Lee
Journal:  J Korean Med Sci       Date:  2017-11       Impact factor: 2.153

View more
  4 in total

1.  Molecular typing of the actin gene of Trichomonas vaginalis isolates in Tehran, Iran.

Authors:  Farah Bokharaei-Salim; Neda Hedayati; Khadijeh Khanaliha; Maryam Esghaei; Sara Minaeian; Mojgan Oshaghi; Borna Salemi
Journal:  J Parasit Dis       Date:  2022-05-17

2.  Trichomoniasis in a tertiary hospital of Madrid, Spain (2013-2017): prevalence and pregnancy rate, coinfections, metronidazole resistance, and endosymbiosis.

Authors:  Celia Bolumburu; Vega Zamora; María Muñoz-Algarra; Francisca Portero-Azorín; José Antonio Escario; Alexandra Ibáñez-Escribano
Journal:  Parasitol Res       Date:  2020-05-14       Impact factor: 2.289

3.  Development of a convenient detection method for Trichomonas vaginalis based on loop-mediated isothermal amplification targeting adhesion protein 65.

Authors:  Yuhua Li; Shuai Wang; Haoran Li; Xiaoxiao Song; Hao Zhang; Yujuan Duan; Chengyang Luo; Bingli Wang; Sifan Ji; Qing Xie; Zhenchao Zhang
Journal:  BMC Infect Dis       Date:  2020-05-01       Impact factor: 3.090

4.  Establishment and application of a CRISPR-Cas12a-based RPA-LFS and fluorescence for the detection of Trichomonas vaginalis.

Authors:  Shan Li; Xiaocen Wang; Yanhui Yu; Songgao Cao; Juan Liu; Panpan Zhao; Jianhua Li; Xichen Zhang; Xin Li; Nan Zhang; Min Sun; Lili Cao; Pengtao Gong
Journal:  Parasit Vectors       Date:  2022-09-30       Impact factor: 4.047

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.