| Literature DB >> 29435024 |
Zhuanpeng Chen1, Ping Yang1, Wanglin Li1, Feng He1, Jianchang Wei1, Tong Zhang1, Junbin Zhong1, Huacui Chen1, Jie Cao1.
Abstract
Enhancer of zeste homolog 2 (EZH2), the critical component of polycomb group protein family, has been demonstrated to be overexpressed in various types of human cancer, including hepatocellular carcinoma, breast, bladder and lung cancer. The mechanism of how EZH2 promotes oncogenesis has also been well studied. However, little is known about the role of EZH2 in colorectal cancer (CRC). The main purpose of the present study was to analyze the association between EZH2 expression and the clinicopathological features of CRC. Therefore, the mRNA and protein expression levels were analyzed in tumor tissues and adjacent non-cancerous tissues by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The expression of EZH2 was demonstrated to be significantly increased in tumor tissues compared with adjacent noncancerous tissues, according to the results of western blot analysis and RT-qPCR in the majority of cases. Patients with low EZH2 expression had a longer overall survival rate compared with those with high EZH2 expression. An analysis of the association between clinicopathological features and EZH2 expression indicated that high EZH2 expression was significantly associated with tumor stage, tumor size, histological differentiation and lymph node metastasis. Multivariate analysis demonstrated that high EZH2 expression was an independent predictor of overall survival. In conclusion, to the best of our knowledge, the data presented in the present study is the first to indicate that EZH2 is upregulated in CRC and may serve as a predictor of poor outcome for patients with CRC.Entities:
Keywords: clustered regularly interspaced short palindromic repeats; colorectal cancer; enhancer of zeste homolog; polycomb group protein; prognosis
Year: 2017 PMID: 29435024 PMCID: PMC5778885 DOI: 10.3892/ol.2017.7647
Source DB: PubMed Journal: Oncol Lett ISSN: 1792-1074 Impact factor: 2.967
Donor sequences used in this study.
| Mutation type | Sequence |
|---|---|
| EZH2 Y641F | ctgaacgatggtcattgcagaggaccaacaccaccaaaaggttttctgtaagacagagattcttatctgctgtataaggaaaacataatgttcatagccattctcagcagctttcacgttgactgaagctgtgtgcccaattactgccttagaacaaacaggtctgaggatttacagtgatagcttttgttttcattctgtagtctactttgtccccagtccattttcaccctccttttttgatgatgtgattgtgttttattctctagcatctattgctggcaccatctgacgtggcaggctgggggatttttatcaaagatcctgtgcagaaaaatgaattcatctcagaa |
| EZH2 Y641N | ctgaacgatggtcattgcagaggaccaacaccaccaaaaggttttctgtaagacagagattcttatctgctgtataaggaaaacataatgttcatagccattctcagcagctttcacgttgactgaagctgtgtgcccaattactgccttagaacaaacaggtctgaggatttacagtgatagcttttgttttcattctgtagtctactttgtccccagtccattttcaccctccttttttgatgatgtgattgtgttttattctctagcatctattgctggcaccatctgacgtggcaggctgggggatttttatcaaagatcctgtgcagaaaaatgaattcatctcagaa |
| EZH2 Y641S | ctgaacgatggtcattgcagaggaccaacaccaccaaaaggttttctgtaagacagagattcttatctgctgtataaggaaaacataatgttcatagccattctcagcagctttcacgttgactgaagctgtgtgcccaattactgccttagaacaaacaggtctgaggatttacagtgatagcttttgttttcattctgtagtctactttgtccccagtccattttcaccctccttttttgatgatgtgattgtgttttattctctagcatctattgctggcaccatctgacgtggcaggctgggggatttttatcaaagatcctgtgcagaaaaatgaattcatctcagaa |
| EZH2Y641C | ctgaacgatggtcattgcagaggaccaacaccaccaaaaggttttctgtaagacagagattcttatctgctgtataaggaaaacataatgttcatagccattctcagcagctttcacgttgactgaagctgtgtgcccaattactgccttagaacaaacaggtctgaggatttacagtgatagcttttgttttcattctgtagtctactttgtccccagtccattttcaccctccttttttgatgatgtgattgtgttttattctctagcatctattgctggcaccatctgacgtggcaggctgggggatttttatcaaagatcctgtgcagaaaaatgaattcatctcagaa |
| EZH2 Y641H | ctgaacgatggtcattgcagaggaccaacaccaccaaaaggttttctgtaagacagagattcttatctgctgtataaggaaaacataatgttcatagccattctcagcagctttcacgttgactgaagctgtgtgcccaattactgccttagaacaaacaggtctgaggatttacagtgatagcttttgttttcattctgtagtctactttgtccccagtccattttcaccctccttttttgatgatgtgattgtgttttattctctagcatctattgctggcaccatctgacgtggcaggctgggggatttttatcaaagatcctgtgcagaaaaatgaattcatctcagaa |
Bold letters indicate nuclotide sequence used to obtain the mutant type of EZH2.
Association between EZH2 expression and clinicopathological features of colorectal cancer.
| EZH2 expression | ||||
|---|---|---|---|---|
| Variable | No. of cases | High | Low | P-value |
| Sex | ||||
| Male | 54 | 40 | 14 | NS |
| Female | 41 | 26 | 15 | |
| Age, years | ||||
| ≥50 | 49 | 34 | 15 | NS |
| <50 | 46 | 32 | 12 | |
| Tumor size, cm | ||||
| ≥5 | 63 | 48 | 15 | 0.046 |
| <5 | 32 | 18 | 14 | |
| Lymph node metastasis | ||||
| Absent | 53 | 42 | 11 | 0.041 |
| Present | 42 | 24 | 18 | |
| Histological differentiation | ||||
| Well/moderate | 44 | 26 | 18 | 0.041 |
| Poor | 51 | 40 | 11 | |
| Tumor stage | ||||
| I–II | 59 | 46 | 13 | 0.021 |
| III–IV | 36 | 20 | 16 | |
NS, not significant; EZH2, enhancer of zeste homolog 2.
Figure 1.EZH2 expression status in CRC cell lines and normal colon colorectal cell line. (A) Reverse transcription-quantitative polymerase chain reaction analysis of the EZH2 mRNA expression level in CRC HCT-116 and SW480 cell lines, normal colon colorectal cell line and siRNA-transfected HCT-116 cell line. (B) Western blot analysis of the protein expression of EZH2 in CRC cell lines HCT-116 and SW480, normal colon colorectal cell line HCEC and siRNA-transfected HCT-116 cell line. (C) MTT assay to determine the cell proliferation rate of CRC cell lines HCT-116 and SW480, normal colon colorectal cell line HCEC and siRNA-transfected HCT-116 cell line. ***P<0.001, **P<0.01. NS, not significant; EZH2, enhancer of zeste homolog 2; CRC, colorectal cancer; siRNA, small interfering RNA; OD, optical density.
Figure 2.Expression of EZH2 variants in HCEC cell lines. (A) Expression of EZH2 variants in HCEC cell lines. (B) MTT assay to determine the cell proliferation rate of HCEC cell lines containing EZH2 variants. The significance was measured by comparing the HCEC cell lines containing EZH2 variants with wild-type HCEC cell line. ***P<0.001, *P<0.05. NS, not significant; EZH2, enhancer of zeste homolog 2; OD, optical density.
Figure 3.EZH2 expression status in patients with CRC. (A) EZH2 mRNA expression in patients with CRC. Patients with high EZH2 expression were classified into overexpressed group and those with low expression were into under-expressed group (cut-off value, 0.39). (B) EZH2 protein expression in patients with CRC. (C) Immunohistochemical analysis of EZH2 expression in patients with CRC. Images were captured at ×200 magnification. ***P<0.001. NS, not significant; CRC, colorectal cancer; EZH2, enhancer of zeste homolog 2.
Figure 4.Overall survival rate assessed by Kaplan-Meier curves. Patients with CRC with EZH2 overexpression presented with shorter 5-year survival rates compared with those with EZH2 under-expression. CRC, colorectal cancer; EZH2, enhancer of zeste homolog 2.
Univariate analysis and multivariate analyses of overall survival in patients with colorectal cancer.
| A, Univariate analysis | |||
|---|---|---|---|
| Variables | HR | 95% CI | P-value |
| EZH2 expression | 2.872 | 1.204–6.349 | 0.009 |
| Age | 2.142 | 0.936–4.898 | 0.071 |
| Sex | 1.983 | 0.851–4.619 | 0.113 |
| Tumor size | 2.290 | 1.019–5.148 | 0.045 |
| Lymph node metastases | 2.297 | 1.022–5.164 | 0.044 |
| Histological differentiation | 2.448 | 1.107–5.414 | 0.027 |
| Tumor stage | 2.717 | 1.209–6.108 | 0.016 |
| EZH2 expression | 2.625 | 1.204–5.722 | 0.015 |
| Age | – | – | – |
| Sex | – | – | – |
| Tumor size | 2.499 | 1.128–5.537 | 0.024 |
| Lymph node metastases | 2.485 | 1.122–5.505 | 0.025 |
| Histological differentiation | 2.551 | 1.168–5.573 | 0.019 |
| Tumor stage | 2.737 | 1.270–5.900 | 0.010 |
HR, hazard ratio, CI, confidence interval; EZH2, enhancer of zeste homolog 2.