| Literature DB >> 29434575 |
Isabel Hottmann1, Valentina M T Mayer2, Markus B Tomek2, Valentin Friedrich2, Matthew B Calvert3,4,5, Alexander Titz3,4,5, Christina Schäffer2, Christoph Mayer1.
Abstract
Tannerella forsythia is an anaerobic, Gram-negative oral pathogen that thrives in multispecies gingival biofilms associated with periodontitis. The bacterium is auxotrophic for the commonly essential bacterial cell wall sugar N-acetylmuramic acid (MurNAc) and, thus, strictly depends on an exogenous supply of MurNAc for growth and maintenance of cell morphology. A MurNAc transporter (Tf_MurT; Tanf_08375) and an ortholog of the Escherichia coli etherase MurQ (Tf_MurQ; Tanf_08385) converting MurNAc-6-phosphate to GlcNAc-6-phosphate were recently described for T. forsythia. In between the respective genes on the T. forsythia genome, a putative kinase gene is located. In this study, the putative kinase (Tf_MurK; Tanf_08380) was produced as a recombinant protein and biochemically characterized. Kinetic studies revealed Tf_MurK to be a 6-kinase with stringent substrate specificity for MurNAc exhibiting a 6 × 104-fold higher catalytic efficiency (kcat/Km ) for MurNAc than for N-acetylglucosamine (GlcNAc) with kcat values of 10.5 s-1 and 0.1 s-1 and Km values of 200 μM and 116 mM, respectively. The enzyme kinetic data suggest that Tf_MurK is subject to substrate inhibition (Ki[S] = 4.2 mM). To assess the role of Tf_MurK in the cell wall metabolism of T. forsythia, a kinase deletion mutant (ΔTf_murK::erm) was constructed. This mutant accumulated MurNAc intracellularly in the exponential phase, indicating the capability to take up MurNAc, but inability to catabolize MurNAc. In the stationary phase, the MurNAc level was reduced in the mutant, while the level of the peptidoglycan precursor UDP-MurNAc-pentapeptide was highly elevated. Further, according to scanning electron microscopy evidence, the ΔTf_murK::erm mutant was more tolerant toward low MurNAc concentration in the medium (below 0.5 μg/ml) before transition from healthy, rod-shaped to fusiform cells occurred, while the parent strain required > 1 μg/ml MurNAc for optimal growth. These data reveal that T. forsythia readily catabolizes exogenous MurNAc but simultaneously channels a proportion of the sugar into peptidoglycan biosynthesis. Deletion of Tf_murK blocks MurNAc catabolism and allows the direction of MurNAc solely to peptidoglycan biosynthesis, resulting in a growth advantage in MurNAc-depleted medium. This work increases our understanding of the T. forsythia cell wall metabolism and may pave new routes for lead finding in the treatment of periodontitis.Entities:
Keywords: MurNAc auxotrophy; N-acetylmuramic acid kinase; cell wall recycling; oral pathogen; peptidoglycan metabolism; red complex consortium
Year: 2018 PMID: 29434575 PMCID: PMC5790795 DOI: 10.3389/fmicb.2018.00019
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Oligonucleotide primers used for PCR amplification reactions.
| Primer | Sequence (5′-3′) |
|---|---|
| 1068for | GCG |
| 1068rev | GCG |
| 622 | ATAATCCCGGATCATGGTCGTTCG |
| 623 | CTTTGCGCACCCGACGAGATGATG |
| 624 | TTCAGACGCCGGAAGAGATG |
| 625 | GGATTGCGAACGATTGTACC |
| 1068upfor | ACACCGACCGACCTCGTATTTCCTTTC |
| 1068uprev | |
| 1068downfor | |
| 1068downrev | GGTAAGCGGTCATCATCTCTCGTCGG |
| 524 | GTAAAACGAACGGGCAATTTCTTTTTTGTCAT |
| 525 | CCCTGAAAAATTTCATCCTTCGTAG |
| 460 | ATGACAAAAAAGAAATTGCCCGTTCGTTTTAC |
| 461 | CTACGAAGGATGAAATTTTTCAGGGACAAC |
Kinetic parameters of Tf_MurK.
| Substrate | |||||
|---|---|---|---|---|---|
| MurNAc | 113 | 39.5 | 7.9 | 69910 | nd |
| GlcNAc | 116700 | 0.5 | 0.1 | 0.86 | nd |
| MurNAc | 200 | 52.6 | 10.5 | 52550 | 4.2 |