Lingtong Zhi1, Yonglin Yu1, Zhixia Jiang1, Dayong Wang2. 1. Key Laboratory of Developmental Genes and Human Diseases in Ministry of Education, Medical School, Southeast University, Nanjing, 210009, China. 2. Key Laboratory of Developmental Genes and Human Diseases in Ministry of Education, Medical School, Southeast University, Nanjing, 210009, China. dayongw@seu.edu.cn.
Abstract
We performed a systematic identification of microRNAs (miRNAs) involved in the control of innate immunity. We identified 7 novel miRNA mutants with altered survival, colony forming in the body, and expression pattern of putative antimicrobial genes after Pseudomonas aeruginosa infection. Loss-of-function mutation of mir-45, mir-75, mir-246, mir-256, or mir-355 induced resistance to P. aeruginosa infection, whereas loss-of-function mutation of mir-63 or mir-360 induced susceptibility to P. aeruginosa infection. DAF-2 in the insulin signaling pathway acted as a target for intestinal mir-355 to regulate innate immunity. mir-355 functioned as an important link between p38 MAPK signaling pathway and insulin signaling pathway in the regulation of innate immunity. Our results provide an important molecular basis for further elucidation of the functions of various miRNAs in the regulation of innate immunity.
We performed a systematic identification of microRNAs (miRNAs) involved in the control of innate immunity. We identified 7 novel miRNA mutants with altered survival, colony forming in the body, and expression pattern of putative antimicrobial genes after Pseudomonas aeruginosainfection. Loss-of-function mutation of mir-45, mir-75, mir-246, mir-256, or mir-355 induced resistance to P. aeruginosa infection, whereas loss-of-function mutation of mir-63 or mir-360 induced susceptibility to P. aeruginosa infection. DAF-2 in the insulin signaling pathway acted as a target for intestinal mir-355 to regulate innate immunity. mir-355 functioned as an important link between p38 MAPK signaling pathway and insulin signaling pathway in the regulation of innate immunity. Our results provide an important molecular basis for further elucidation of the functions of various miRNAs in the regulation of innate immunity.
microRNAs (miRNAs), a class of non-coding RNAs with 19–22 nucleotides, are encoded within the genome in organisms[1]. miRNAs are initially transcribed as primary transcripts (pri-miRs). The pri-miRs are further cleaved to produce 70 nucleotide-long precursor miRNAs (pre-miRs) and then mature miRNAs, respectively[1]. The mature miRNAs regulate various fundamental biological processes by imperfectly binding their multiple targeted mRNAs and suppressing the expression of their targeted genes post-transcriptionally[2,3]. Bioinformatic or functional analyses has suggested that miRNAs can directly target multiple proteins, implying the property of multiple functions for miRNAs[4]. Caenorhabditis elegans is a powerful model animal to determine the functions and mechanisms of miRNAs in regulating certain biological processes, such as transition of developmental timing and longevity[5-7]. For example, lin-4 and let-7 have been proven to be involved in the control of transition of developmental timing[8,9]. lin-4 and let-7, two important founding members of miRNAs, were first identified in C. elegans via forward genetic screens[8,9].C. elegans is also a wonderful model for the study of innate immune response to pathogen infection or host-pathogen interactions, because its intestine consisting of 20 epithelial cells is full of microbes[10,11]. In C. elegans, once certain pathogenic bacteria are accumulated in the intestine, they will invade the host cells and even kill the animals during infectious processes[12]. Upon infection, C. elegans can potentially avoid the pathogens or activate an inducible innate immune system[13]. Innate immunity plays a pivotal role in being against pathogen infection in animal kingdom, and C. elegans can provide mechanistic insights into conserved signal transduction of innate immunity and host-pathogen interactions[13,14]. Some important and conserved signaling pathways, including p38 mitogen-activated protein kinase (MAPK), insulin, and TGF-β signaling pathways, have been identified to be required for the control of innate immunity in C. elegans
[15-17]. Recently, some miRNAs, such as let-7, mir-84, mir-241, mir-251, mir-252, and mir-233, have been further shown to be involved in the control of innate immune response to pathogen infection in C. elegans
[18-21]. Nevertheless, the potential involvement of most of miRNAs in the control of innate immunity is still unknown in C. elegans.Pseudomonas aeruginosa is considered to be toxic, and can cause a lethal intestinal infection on nematode host[22,23]. Upon early P. aeruginosa infection, C. elegans can upregulate mRNA expression of some defense genes, including genes encoding anti-microbial peptides[22]. In the present study, we performed a systematic identification of the possible miRNAs involved in the control of innate immune response to P. aeruginosa PA14 infection in C. elegans. Moreover, we focused on mir-355 to examine its molecular basis in the regulation of innate immunity. Our results provide an important basis for further understanding and systematically elucidating the functions of miRNAs in the regulation of innate immunity.
Results
Mutations of some miRNAs altered the survival of nematodes infected with P. aeruginosa PA14
Using deletion mutants, we performed a systematic identification of miRNAs involved in the control of P. aeruginosa PA14 infection and the corresponding innate immune response in nematodes. Based on phenotypic analysis of survival in miRNA mutants infected with P. aeruginosa PA14, we identified 11 miRNA mutants out of the examined 82 miRNA mutants with the abnormal survival compared with wild-type nematodes (Fig. 1, Table S1). These miRNA mutants were let-7(mg279), mir-45(n4280), mir-63(n4568), mir-75(n4472), mir-84(n4307), mir-233(n4761), mir-241(n4316), mir-246(n4636), mir-256(n4471), mir-355(n4618), and mir-360(n4635) (Fig. 1). Loss-of-function mutation of let-7, mir-45, mir-75, mir-84, mir-241, mir-246, or mir-256 caused the resistance to the adverse effect of P. aeruginosa PA14 infection on survival in nematodes (Fig. 1). In contrast, loss-of-function mutation of mir-63, mir-233, mir-360, or mir-355 resulted in the susceptibility to the adverse effect of P. aeruginosa PA14 infection on survival in nematodes (Fig. 1). Statistical comparisons of the survival plots demonstrated that, after P. aeruginosa PA14 infection, the survival of let-7(mg279), mir-45(n4280), mir-63(n4568), mir-75(n4472), mir-84(n4307), mir-233(n4761), mir-241(n4316), mir-246(n4636), mir-256(n4471), mir-355(n4618), or mir-360(n4635) was significantly (P < 0.001) different from that of wild-type nematodes (Table S1). Among these 11 candidate miRNA mutants, let-7(mg279), mir-84(n4307), mir-241(n4316), and mir-233(n4761) mutants have been reported in the previous studies[18-20,22]. We next examined the P. aeruginosa PA14 colony-forming unit (CFU) and the expression pattern of putative antimicrobial genes in the other 7 miRNA mutants infected with P. aeruginosa PA14.
Figure 1
Survival in miRNA mutants infected with P. aeruginosa PA14. Bars represent mean ± SD.
Survival in miRNA mutants infected with P. aeruginosa PA14. Bars represent mean ± SD.
P. aeruginosa PA14 CFU in the new identified miRNA mutants after infection
We employed the CFU to determine PA14 colony formation in the body of miRNA mutant after P. aeruginosa infection. After P. aeruginosa PA14 infection, we observed that loss-of-function mutation of mir-63, mir-360, or mir-355 significantly enhanced the PA14 colony formation in the body of nematodes (Fig. 2). Different from these, after P. aeruginosa PA14 infection, loss-of-function mutation of mir-45, mir-75, mir-246, or mir-256 significantly suppressed the PA14 colony formation in the body of nematodes (Fig. 2).
Figure 2
P. aeruginosa PA14 CFU in the body of miRNA mutants infected with P. aeruginosa PA14. Bars represent mean ± SD. **P < 0.01 vs wild-type.
P. aeruginosa PA14 CFU in the body of miRNA mutants infected with P. aeruginosa PA14. Bars represent mean ± SD. **P < 0.01 vs wild-type.
Expression patterns of putative antimicrobial genes in the new identified miRNA mutants after P. aeruginosa infection
We selected some putative antimicrobial genes (lys-1, lys-8, clec-85, dod-22, K08D8.5, F55G11.7, and F55G11.4) to further determine the innate immune response in P. aeruginosa PA14 infected miRNA mutants. P. aeruginosa PA14 infection significantly increases the transcriptional expression of these antimicrobial genes[14]. In C. elegans, lys-1 and lys-8 encode lysozymes, clec-85 encodes a C-type lectin protein, dod-22 and F55G11.7 encode orthologs of humanepoxide hydrolase 1, and K08D8.5 and F55G11.4 encode CUB-like domain-containing proteins. After P. aeruginosa PA14 infection, mutation of mir-45 increased the expression levels of lys-8, clec-85, dod-22, F55G11.7, and F55G11.4, mutation of mir-75 increased the expression levels of lys-1, lys-8, dod-22, F55G11.7, and F55G11.4, mutation of mir-246 increased the expression levels of lys-8, clec-85, dod-22, K08D8.5, and F55G11.7, and mutation of mir-256 increased the expression levels of lys-1, lys-8, clec-85, dod-22, and K08D8.5 (Fig. 3). In contrast, mutation of mir-63 decreased the expression levels of lys-1, dod-22, F55G11.7, and F55G11.4, mutation of mir-355 decreased the expression levels of lys-1, lys-8, K08D8.5, F55G11.7, and F55G11.4, and mutation of mir-360 decreased the expression levels of lys-8, dod-22, K08D8.5, and F55G11.7 (Fig. 3). Therefore, loss-of-function mutation of these 7 miRNAs may alter the innate immune response of nematodes to P. aeruginosa PA14 infection.
Figure 3
Expression patterns of putative antimicrobial genes in P. aeruginosa PA14 infected miRNA mutant nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD.
Expression patterns of putative antimicrobial genes in P. aeruginosa PA14 infected miRNA mutant nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD.
Prediction of targets for new identified miRNAs during the control of innate immune response to P. aeruginosa PA14 infection
We further used TargetScan software (http://www.targetscan.org/worm_52/) with preferentially conserved targeting (PCT) between 0 and 1 and miRBase (http://www.mirbase.org) with a score threshold of −0.1 to predict potential targets for new identified miRNAs in regulating the innate immune response by searching for the presence of conserved sites that match the seed region of new identified miRNAs[24,25]. In C. elegans, insulin and TGF-β signaling pathways are two important signaling pathways in the control of innate immune response to P. aeruginosa PA14 infection[16,17]. In the insulin signaling pathway, daf-2 gene encodes an insulin receptor. In the TGF-β signaling pathway, sma-3 gene encodes a Smad protein. Among the predicted targets, we found that SMA-3 in the TGF-β signaling pathway might function as the potential target for mir-246 in the regulation of innate immunity, and DAF-2 in the insulin signaling pathway might function as the potential target for mir-355 in the regulation of innate immunity. We next focused on the mir-355 to examine its molecular basis in the regulation of innate immune response to P. aeruginosa PA14 infection. In C. elegans, after P. aeruginosa PA14 infection, we observed the significant increase in the mir-355 expression (Fig. S1).
Genetic interaction between mir-355 and DAF-2 in the regulation of innate immune response to P. aeruginosa PA14 infection
We assumed that the daf-2 mutation would suppress the phenotypes in nematodes with mir-355 mutation, if DAF-2 is the target of mir-355. After P. aeruginosa PA14 infection, mutation of daf-2 significantly increased the survival, decreased the P. aeruginosa PA14 CFU, and enhanced the expression levels of putative antimicrobial genes (K08D8.5 and F55G11.7)[22] in mir-355(n4618) mutant (Fig. 4). Therefore, DAF-2 may be the target for mir-355 in the regulation of innate immune response to P. aeruginosa PA14 infection.
Figure 4
Genetic interaction between mir-355 and DAF-2 in the regulation of innate immune response to P. aeruginosa PA14 infection. (a) Genetic interaction between mir-355 and DAF-2 in the regulation of survival in P. aeruginosa PA14 infected nematodes. The survival was analyzed at 20 °C. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of mir-355(n4618);daf-2(e1370) was significantly different from that of mir-355(n4618) (P < 0.001). Bars represent mean ± SD. (b) Genetic interaction between mir-355 and DAF-2 in the regulation of P. aeruginosa PA14 CFU in the body of nematodes. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated). (c) Genetic interaction between mir-355 and DAF-2 in the regulation of expression patterns of putative antimicrobial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01.
Genetic interaction between mir-355 and DAF-2 in the regulation of innate immune response to P. aeruginosa PA14 infection. (a) Genetic interaction between mir-355 and DAF-2 in the regulation of survival in P. aeruginosa PA14 infected nematodes. The survival was analyzed at 20 °C. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of mir-355(n4618);daf-2(e1370) was significantly different from that of mir-355(n4618) (P < 0.001). Bars represent mean ± SD. (b) Genetic interaction between mir-355 and DAF-2 in the regulation of P. aeruginosa PA14 CFU in the body of nematodes. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated). (c) Genetic interaction between mir-355 and DAF-2 in the regulation of expression patterns of putative antimicrobial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01.
Effects of intestinal overexpression of daf-2 lacking 3′ UTR or containing 3′ UTR on innate immune response of nematodes overexpressing intestinal mir-355 to P. aeruginosa PA14 infection
In C. elegans, mir-355 is expressed in the intestine[26]. Meanwhile, the insulin signaling pathway can function in the intestine to regulate the innate immunity in nematodes[27]. To further confirm the role of DAF-2 as a molecular target of intestinal mir-355 in the regulation of innate immunity, we introduced the intestinal daf-2 lacking 3′ UTR (Ex(Pges-1-daf-2-3′UTR)) into the transgenic nematodes overexpressing intestinal mir-355. After P. aeruginosa PA14 infection, the transgenic strain Is(Pges-1-mir-355);Ex(Pges-1-daf-2-3′UTR) exhibited the similar survival to that in the transgenic strain Ex(Pges-1-daf-2-3′UTR) (Fig. 5a). The P. aeruginosa PA14 CFU in the transgenic strain Is(Pges-1-mir-355);Ex(Pges-1-daf-2-3′UTR) was similar to that in the transgenic strain Ex(Pges-1-daf-2-3′UTR) (Fig. 5b). Moreover, the expression patterns of putative antimicrobial genes (K08D8.5 and F55G11.7) in the transgenic strain Is(Pges-1-mir-355);Ex(Pges-1-daf-2-3′UTR) were similar to those in the transgenic strain Ex(Pges-1-daf-2-3′UTR) (Fig. 5c). Therefore, intestinal overexpression of daf-2 lacking 3′ UTR may effectively suppress the resistance of nematodes overexpressing intestinal mir-355 to P. aeruginosa PA14 infection.
Figure 5
Effects of intestinal overexpression of daf-2 lacking 3′ UTR on innate immune response to P. aeruginosa PA14 infection in nematodes overexpressing intestinal mir-355. (a) Effects of intestinal overexpression of daf-2 lacking 3′ UTR on survival of nematodes overexpressing intestinal mir-355 after P. aeruginosa PA14 infection. Statistical comparisons of the survival plots indicate that, after the P. aeruginosa PA14 infection, the survival of transgenic strain Is(Pges-1-mir-355);Ex(Pges-1-daf-2-3′UTR) was significantly different from that of transgenic strain Is(Pges-1-mir-355) (P < 0.001). Bars represent mean ± SD. (b) Effects of intestinal overexpression of daf-2 lacking 3′ UTR on P. aeruginosa PA14 CFU in the body of nematodes overexpressing intestinal mir-355. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated). (c) Effects of intestinal overexpression of daf-2 lacking 3′ UTR on expression patterns of putative antimicrobial genes of nematodes overexpressing intestinal mir-355 after P. aeruginosa PA14 infection. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01.
Effects of intestinal overexpression of daf-2 lacking 3′ UTR on innate immune response to P. aeruginosa PA14 infection in nematodes overexpressing intestinal mir-355. (a) Effects of intestinal overexpression of daf-2 lacking 3′ UTR on survival of nematodes overexpressing intestinal mir-355 after P. aeruginosa PA14 infection. Statistical comparisons of the survival plots indicate that, after the P. aeruginosa PA14 infection, the survival of transgenic strain Is(Pges-1-mir-355);Ex(Pges-1-daf-2-3′UTR) was significantly different from that of transgenic strain Is(Pges-1-mir-355) (P < 0.001). Bars represent mean ± SD. (b) Effects of intestinal overexpression of daf-2 lacking 3′ UTR on P. aeruginosa PA14 CFU in the body of nematodes overexpressing intestinal mir-355. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated). (c) Effects of intestinal overexpression of daf-2 lacking 3′ UTR on expression patterns of putative antimicrobial genes of nematodes overexpressing intestinal mir-355 after P. aeruginosa PA14 infection. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01.We also introduced the intestinal daf-2 containing the 3′ UTR (Ex(Pges-1-daf-2 + 3′UTR)) into the transgenic nematodes overexpressing intestinal mir-355. After P. aeruginosa PA14 infection, the transgenic strain Is(Pges-1-mir-355);Ex(Pges-1-daf-2 + 3′UTR) exhibited the similar survival to that in the transgenic strain Is(Pges-1-mir-355) (Fig. 6a). The P. aeruginosa PA14 CFU in the transgenic strain Is(Pges-1-mir-355);Ex(Pges-1 + daf-2 + 3′UTR) was also similar to that in the transgenic strain Is(Pges-1-mir-355) (Fig. 6b). Moreover, we observed that the expression patterns of antimicrobial genes (K08D8.5 and F55G11.7) in the transgenic strain Is(Pges-1-mir-355);Ex(Pges-1-daf-2 + 3′UTR) were similar to those in the transgenic strain Is(Pges-1-mir-355) (Fig. 6c). These results suggest that intestinal overexpression of mir-355 can inhibit the susceptibility of nematodes overexpressing intestinal daf-2 containing 3′ UTR.
Figure 6
Effects of intestinal overexpression of daf-2 containing 3′ UTR on innate immune response to P. aeruginosa PA14 infection in nematodes overexpressing intestinal mir-355. (a) Effects of intestinal overexpression of daf-2 containing 3′ UTR on survival of nematodes overexpressing intestinal mir-355 after P. aeruginosa PA14 infection. Statistical comparisons of the survival plots indicate that, after the P. aeruginosa PA14 infection, the survival of transgenic strain Is(Pges-1-mir-355);Ex(Pges-1-daf-2 + 3′UTR) was significantly different from that of transgenic strain of Ex(Pges-1-daf-2 + 3′UTR) (P < 0.001). Bars represent mean ± SD. (b) Effects of intestinal overexpression of daf-2 containing 3′ UTR on P. aeruginosa PA14 CFU in the body of nematodes overexpressing intestinal mir-355. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated). (c) Effects of intestinal overexpression of daf-2 containing 3′ UTR on expression patterns of putative antimicrobial genes of nematodes overexpressing intestinal mir-355 after P. aeruginosa PA14 infection. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01.
Effects of intestinal overexpression of daf-2 containing 3′ UTR on innate immune response to P. aeruginosa PA14 infection in nematodes overexpressing intestinal mir-355. (a) Effects of intestinal overexpression of daf-2 containing 3′ UTR on survival of nematodes overexpressing intestinal mir-355 after P. aeruginosa PA14 infection. Statistical comparisons of the survival plots indicate that, after the P. aeruginosa PA14 infection, the survival of transgenic strain Is(Pges-1-mir-355);Ex(Pges-1-daf-2 + 3′UTR) was significantly different from that of transgenic strain of Ex(Pges-1-daf-2 + 3′UTR) (P < 0.001). Bars represent mean ± SD. (b) Effects of intestinal overexpression of daf-2 containing 3′ UTR on P. aeruginosa PA14 CFU in the body of nematodes overexpressing intestinal mir-355. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated). (c) Effects of intestinal overexpression of daf-2 containing 3′ UTR on expression patterns of putative antimicrobial genes of nematodes overexpressing intestinal mir-355 after P. aeruginosa PA14 infection. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01.
In vivo 3′-UTR binding assay of daf-2
To further confirm whether mir-355 regulated the protein levels of DAF-2 through 3′-UTR, we generated a ges-1 promoter driven GFP vector containing 3′-UTR of daf-2(Pges-1::GFP-3′-UTR) (daf-2 wt) or Pges-1::GFP-3′-UTR (daf-2 mut). A daf-2 3′-UTR mutant reporter construct was generated by replacing the putative mir-355 binding site with an oligonucleotide containing the exact identical sequence of mir-355. A Pges-1::mCherry3′-UTR(tag-196) construct that drives the mCherry expression was employed as an internal control. After P. aeruginosa PA14 infection, the GFP expression was suppressed in wild-type nematodes (Fig. S2). In contrast, mutagenesis of putative binding site for mir-355 in daf-2 3′-UTR abolished this suppression of GFP expression in wild-type nematodes (Fig. S2). After P. aeruginosa PA14 infection, we observed the higher GFP expression in mir-355(n4618) mutant than that in wild-type nematodes (Fig. S2). These results demonstrate that mir-355 may inhibit the DAF-2 function through binding to its 3′-UTR and suppressing its translation in P. aeruginosa PA14 infected nematodes.
mir-355 acted downstream of PMK-1 to regulate the innate immune response to P. aeruginosa PA14 infection
In C. elegans, p38 MAPK signaling pathway is a conserved signaling pathway required for the pathogen resistance[13,15]. In the p38 MAPK signaling pathway, pmk-1 encodes a p38 MAPK. Overexpression of intestinal pmk-1 induced a resistance to P. aeruginosa PA14 infection, decreased P. aeruginosa PA14 CFU, and enhanced the expressions of putative antimicrobial genes (K08D8.5 and F55G11.7) (Fig. 7). In the transgenic strain overexpressing intestinal pmk-1, we found that mutation of mir-355 significantly suppressed the survival, increased the P. aeruginosa PA14 CFU, and inhibited the expressions of putative antimicrobial genes (K08D8.5 and F55G11.7) (Fig. 7). Moreover, after P. aeruginosa PA14 infection, pmk-1 mutation significantly decreased the expression of mir-355 (Fig. S3). These results suggest that mir-355 may act downstream of PMK-1 in the p38 MAPM signaling pathway to regulate the innate immune response to P. aeruginosa PA14 infection.
Figure 7
Genetic interaction between mir-355 and PMK-1 in the regulation of innate immune response to P. aeruginosa PA14 infection. (a) Genetic interaction between mir-355 and PMK-1 in the regulation of survival in P. aeruginosa PA14 infected nematodes. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of mir-355(n4618);Ex(Pges-1-pmk-1) was significantly different from that of Ex(Pges-1-pmk-1) (P < 0.001). Bars represent mean ± SD. (b) Genetic interaction between mir-355 and PMK-1 in the regulation of P. aeruginosa PA14 CFU in the body of nematodes. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated). (c) Genetic interaction between mir-355 and PMK-1 in the regulation of expression patterns of putative antimicrobial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01.
Genetic interaction between mir-355 and PMK-1 in the regulation of innate immune response to P. aeruginosa PA14 infection. (a) Genetic interaction between mir-355 and PMK-1 in the regulation of survival in P. aeruginosa PA14 infected nematodes. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of mir-355(n4618);Ex(Pges-1-pmk-1) was significantly different from that of Ex(Pges-1-pmk-1) (P < 0.001). Bars represent mean ± SD. (b) Genetic interaction between mir-355 and PMK-1 in the regulation of P. aeruginosa PA14 CFU in the body of nematodes. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated). (c) Genetic interaction between mir-355 and PMK-1 in the regulation of expression patterns of putative antimicrobial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01.
Genetic interaction between mir-355 and DAF-16 or SKN-1 in the regulation of innate immune response to P. aeruginosa PA14 infection
In C. elegans, DAF-16, a FOXO transcriptional factor, act downstream of DAF-2 in the insulin signaling pathway to regulate the innate immune response to pathogen infection[16]. SKN-1, a bZip transcriptional factor, functions in the p38 MAPK signaling pathway to regulate diverse biological processes, such as stress response[28]. Meanwhile, SKN-1 can be directly phosphorylated by some kinases downstream of DAF-2 in the insulin signaling pathway[29]. Additionally, the activation of SKN-1 in response to pathogens is dependent on p38 MAPK signaling[30]. We found that RNA interference (RNAi) knockdown of daf-16 or skn-1 suppressed the survival, increased the P. aeruginosa PA14 CFU, and decreased the expressions of putative antimicrobial genes (K08D8.5 and F55G11.7) in P. aeruginosa PA14 infected transgenic strain of Ex(Pges-1-mir-355) (Fig. 8a–c). After P. aeruginosa PA14 infection, we further found that the stain of daf-16(mu86);Is(Pges-1-mir-355);skn-1(RNAi) showed more severely suppressed survival compared with the strain of daf-16(mu86);Is(Pges-1-mir-355) or the strain of Is(Pges-1-mir-355);skn-1(RNAi) (Fig. S4).
Figure 8
Genetic interaction between mir-355 and DAF-16 or SKN-1 in the regulation of innate immune response to P. aeruginosa PA14 infection. (a) Genetic interaction between mir-355 and DAF-16 or SKN-1 in the regulation of survival in P. aeruginosa PA14 infected nematodes. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of daf-16(RNAi);Ex(Pges-1-mir-355) or Ex(Pges-1-mir-355);skn-1(RNAi) was significantly different from that of Ex(Pges-1-mir-355) (P < 0.001). Bars represent mean ± SD. (b) Genetic interaction between mir-355 and DAF-16 or SKN-1 in the regulation of P. aeruginosa PA14 CFU in the body of nematodes. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated). (c) Genetic interaction between mir-355 and DAF-16 or SKN-1 in the regulation of expression patterns of putative antimicrobial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01. (d) A diagram showing the molecular basis for mir-355 in the regulation of innate immune response to P. aeruginosa PA14 infection.
Genetic interaction between mir-355 and DAF-16 or SKN-1 in the regulation of innate immune response to P. aeruginosa PA14 infection. (a) Genetic interaction between mir-355 and DAF-16 or SKN-1 in the regulation of survival in P. aeruginosa PA14 infected nematodes. Statistical comparisons of the survival plots indicate that, after P. aeruginosa PA14 infection, the survival of daf-16(RNAi);Ex(Pges-1-mir-355) or Ex(Pges-1-mir-355);skn-1(RNAi) was significantly different from that of Ex(Pges-1-mir-355) (P < 0.001). Bars represent mean ± SD. (b) Genetic interaction between mir-355 and DAF-16 or SKN-1 in the regulation of P. aeruginosa PA14 CFU in the body of nematodes. Bars represent mean ± SD. **P < 0.01 vs wild-type (if not specially indicated). (c) Genetic interaction between mir-355 and DAF-16 or SKN-1 in the regulation of expression patterns of putative antimicrobial genes in P. aeruginosa PA14 infected nematodes. Normalized expression is presented relative to wild-type expression. Bars represent mean ± SD. **P < 0.01. (d) A diagram showing the molecular basis for mir-355 in the regulation of innate immune response to P. aeruginosa PA14 infection.After P. aeruginosa PA14 infection, mir-355 mutation induced a significant decrease in daf-16 expression (Fig. S5). In C. elegans, skn-1 has three different isoforms. skn-1a and skn-1c are expressed in the intestine, and skn-1b is expressed in the neurons. After P. aeruginosa PA14 infection, mir-355 mutation induced a significant decrease in skn-1a or skn-1c expression, whereas mir-355 mutation did not significantly affect the skn-1b expression (Fig. S5).
Discussion
In C. elegans, with the exception of lin-4, let-7, lsy-6, and mir-1, individual deletion of most of the miRNAs did not cause the overt phenotypes[31], and the majority of miRNA may be not essential for the developmental control[32]. In contrast to these, a large amount of miRNAs were differentially expressed during the aging, and some miRNAs have been shown to be involved in the control of aging on the level of organism lifespan, tissue aging or cellular senescence in C. elegans
[33]. In this study, we further performed the systematic identification of possible miRNAs involved in the control of innate immune response to P. aeruginosa PA14 infection. Based on the phenotypic analysis of survival, we identified 11 miRNAs (let-7, mir-45, mir-63, mir-75, mir-84, mir-241, mir-246, mir-256, mir-355, mir-233, and mir-360) having the function in the control of P. aeruginosa PA14 infection (Fig. 1). Among these 11 miRNAs, mir-45, mir-63, mir-75, mir-246, mir-256, mir-355, and mir-360 are new identified miRNAs with the function in the control of innate immunity. Among these new identified miRNA mutants, mir-45(n4280), mir-75(n4472), mir-246(n4636), and mir-256(n4471) mutants were resistant to P. aeruginosa PA14 infection, whereas mir-63(n4568), mir-355(n4618), and mir-360(n4635) mutants were susceptible to P. aeruginosa PA14 infection (Fig. 1). Under normal conditions, loss-of-function mutation of mir-45, mir-63, mir-75, mir-246, mir-256, or mir-355 did not obviously affect the longevity (data not shown). Under normal conditions, loss-of-function mutation of mir-360 also does not affect the longevity[21].In this study, the CFU assay demonstrated that the P. aeruginosa PA14 infectedmir-63(n4568), mir-355(n4618), and mir-360(n4635) mutants had the enhanced P. aeruginosa PA14 colony formation in the body compared with P. aeruginosa PA14 infected wild-type nematodes; however, the P. aeruginosa PA14 infectedmir-45(n4280), mir-75(n4472), mir-246(n4636), and mir-256(n4471) mutants had the decreased P. aeruginosa PA14 colony formation in the body compared with P. aeruginosa PA14 infected wild-type nematodes (Fig. 2). These results suggest that the observed susceptibility to P. aeruginosa PA14 infection in mir-63(n4568), mir-355(n4618), or mir-360(n4635) mutant may be at least partially due to the enhanced P. aeruginosa PA14 colony formation in the body of nematodes, and the observed resistance to P. aeruginosa PA14 infection in mir-45(n4280), mir-75(n4472), mir-246(n4636), or mir-256(n4471) mutant may be at least partially due to the suppressed P. aeruginosa PA14 colony formation in the body of nematodes. Moreover, the analysis on expression patterns of putative antimicrobial genes further suggested that the observed susceptibility to P. aeruginosa PA14 infection in mir-63(n4568), mir-355(n4618), or mir-360(n4635) mutant may be also largely due to the decreased expression of the examined antimicrobial genes, and the observed resistance to P. aeruginosa PA14 infection in mir-45(n4280), mir-75(n4472), mir-246(n4636), or mir-256(n4471) mutant may be largely due to the increased expression of the examined putative antimicrobial genes (Fig. 3). Interestingly, mutations of these miRNAs induced different expression patterns of the putative antimicrobial genes in P. aeruginosa PA14 infected nematodes (Fig. 3), implying that the new identified 7 miRNAs may regulate the innate immune response to P. aeruginosa PA14 infection through different molecular mechanisms.In C. elegans, mir-45 has been shown to be involved in the control of toxicity formation of multi-walled carbon nanotubes[34]. mir-63 was involved in the control of embryonic hypoxic response[35]. mir-246 regulates both the longevity and the embryonic hypoxic response[35,36]. It was reported that mir-355 could regulate the toxicity of multi-walled carbon nanotubes[34]. Besides the innate immune response to fungal infection[21], mir-360 has also been shown to be involved in the control of reproductive toxicity of graphene oxide and the beneficial effects of glycyrrhizic acid against the toxicity of graphene oxide[37,38]. In contrast, the biological functions of mir-75 and mir-256 are still unclear. In this study, our results further indicate the novel function of these 7 miRNAs in the regulation of innate immunity. After P. aeruginosa infection, we observed the significant increase in mir-355 expression (Fig. S1), which implies that the mir-355 expression may be activated to mediate a protection mechanism for nematodes against the P. aeruginosa infection in nematodes.Previous studies have identified the potential target(s) for some miRNAs involved in the control of innate immunity in nematodes. For example, mir-233 is directly targeted to SCA-1, a homologue of the sarco/endoplasmic reticulum Ca2+-ATPase, to regulate the innate immune response to P. aeruginosa infection[18]. let-7 might be directly target to LIN-41 or to HBL-1 to regulate the innate immunity in P. aeruginosa infected nematodes[20]. SKN-1/Nrf could act the direct target for both mir-84 and mir-241, another two members in the let-7 family, in the control of innate immune response to P. aeruginosa infection[19]. With the aid of TargetScan and miRBase, we found that some of the new identified 7 miRNAs may regulate the innate immune response to P. aeruginosa infection by at least suppressing the functions of insulin or TGF-β signaling pathway. This information further reflects the crucial roles of insulin and TGF-β signaling pathways in the regulation of innate immune response to P. aeruginosa infection. Moreover, the predicted targets in insulin and TGF-β signaling pathways provide important clues for further elucidating the underlying mechanisms of new identified miRNAs in the regulation of innate immunity.Importantly, some of the candidate miRNAs are conserved in human[39]. Among the new identified miRNAs involved in the control of innate immunity, mir-45 is the homologue of humanmiR-134 and miR-708, mir-63 is the homologue of humanmiR-96, miR-183, miR-200a, and miR-514, mir-75 is the homologue of humanmiR-9, miR-320, and miR-548a, and mir-256 is the homologue of humanmiR-1, miR-122, miR-206, and miR-519
[39]. The data obtained in C. elegans imply that the homologues of these C. elegans miRNAs in human might be also very important for the innate immunity regulation.In this study, based on the genetic interaction assay between mir-355 and DAF-2 (Fig. 4), we confirmed that DAF-2 in the insulin signaling pathway may act as the potential target for mir-355 in the regulation of innate immune response to P. aeruginosa PA14 infection. More importantly, the investigations on the effects of intestinal overexpression of daf-2 lacking 3′ UTR or containing 3′ UTR on innate immunity in nematodes overexpressing intestinal mir-355 suggested the 3′ UTR binding property of mir-355 to DAF-2 during the control of innate immune response to P. aeruginosa PA14 infection (Figs 5 and 6). Our results further imply the crucial function of mir-355-DAF-2 signaling cascade in the intestinal cells in the regulation of innate immune response to P. aeruginosa PA14 infection.Moreover, in this study, we found that mir-355 mutation could suppress the resistance of Ex(Pges-1-pmk-1) to P. aeruginosa PA14 infection (Fig. 7), and RNAi knockdown of daf-16 or skn-1 could suppress the resistance of Ex(Pges-1-mir-355) to P. aeruginosa PA14 infection (Fig. 8a–c). Therefore, mir-355 may act downstream of PMK-1 and upstream of DAF-16 or SKN-1 to regulate the innate immune response to P. aeruginosa PA14 infection. That is, a signaling cascade of PMK-1-mir-355-SKN-1 and a signaling cascade of mir-355-DAF-2-DAF-16 may be formed simultaneously in nematodes against the P. aeruginosa PA14 infection. Our results demonstrate the role of mir-355 in linking the p38 MAPK signaling pathway and the insulin signaling pathway in the regulation of innate immune response to P. aeruginosa PA14 infection (Fig. 8d). Our data further provide the important molecular basis for intestinal mir-355 in the regulation of innate immunity.In conclusion, we performed the large scale genetic screen of miRNAs involved in the control of innate immune response to P. aeruginosa PA14 infection using deletion miRNA mutants. Based on this large scale deletion studies, we identified 7 novel miRNAs involved in the control of innate immune response to P. aeruginosa PA14 infection. Among these 7 novel miRNAs, loss-of-function mutant of mir-45, mir-75, mir-246, or mir-256 was resistant to P. aeruginosa PA14 infection, whereas loss-of-function mutant of mir-63, mir-355, or mir-360 was susceptible to P. aeruginosa PA14 infection. Our results proved the novel functions of these 7 miRNAs in the regulation of innate immunity. Some proteins in the insulin or TGF-β signaling pathway might act as the potential targets for these 7 miRNAs in the regulation of innate immunity. Moreover, we found that DAF-2 in the insulin signaling pathway can act as the target for mir-355 in the intestine to regulate the innate immunity. During the control of innate immunity, mir-355 may function as an important molecular link between the p38 MAPK signaling pathway and the insulin signaling pathway.
Methods
C. elegans strains
Nematodes strains used in the present study were wild-type N2, mutants of let-7(mg279) X, lsy-6(ot71) V, lin-4(e912) II, mir-1(n4101) I, mir-2(n4108) I, mir-34(n4276) X, mir-35(gk262) II, mir-35-41(nDf50) II, mir-42-44(nDf49) II, mir-45(n4280) II, mir-46(n4475) III, mir-47(gk167) X, mir-51(n4473) IV, mir-52(n4100) IV, mir-53(n4113) IV, mir-54&55(nDf58) X, mir-57(gk175) II, mir-58(n4640) IV, mir-59(n4604) IV, mir-60(n4947) II, mir-61&250(nDf59) V, mir-62(n4539) X, mir-63(n4568) X, mir-64-66&229(nDf63) III, mir-67(n4899) III, mir-70(n4109) V, mir-71(n4115) I, mir-72(n4130) II, mir-73-74(nDf47) X, mir-75(n4472) X, mir-76(n4474) III, mir-77(n4286) II, mir-78(n4637) IV, mir-79(n4126) I, mir-80(nDf53) III, mir-81-82(nDf54) X, mir-83(n4638) IV, mir-84(n4307) X, mir-85(n4117) II, mir-86(n4607) III, mir-87(n4104) V, mir-124(n4255) IV, mir-228(n4382) IV, mir-230(n4535) X, mir-231(n4571) III, mir-232(nDf56) IV, mir-233(n4761) X, mir-234(n4520) II, mir-235(n4504) I, mir-237(n4296) X, mir-238(n4112) III, mir-239a&239b(nDf62) X, mir-240&786(n4541) X, mir-241(n4316) V, mir-242(n4605) IV, mir-243(n4759) IV, mir-244(n4367) I, mir-245(n4798) I, mir-246(n4636) IV, mir-247&797(n4505) X, mir-249(n4983) X, mir-251(n4606) X, mir-252(n4570) II, mir-253(nDf64) V, mir-254(n4470) X, mir-256(n4471) V, mir-257(n4548) V, mir-258.2(n4797) X, mir-259(n4106) V, mir-260(n4601) II, mir-261(n4594) II, mir-265(n4534) IV, mir-268(n4639) V, mir-269(n4641) IV, mir-270(n4595) IV, mir-273(n4438) I, mir-355(n4618) II, mir-357-358(nDf60) V, mir-359(n4540) X, mir-360(n4635) X, pmk-1(km25)IV, daf-2(e1370) III, and mir-355(n4618);daf-2(e1370), and transgenic strains of Ex(Pges-1-pmk-1), mir-355(n4618);Ex(Pges-1-pmk-1), Ex(Pges-1-daf-2-3′UTR), Ex(Pges-1-daf-2 + 3′UTR), Is(Pges-1-mir-355), daf-16(RNAi);Is(Pges-1-mir-355), daf-16(mu86);Is(Pges-1-mir-355), Is(Pges-1-mir-355);skn-1(RNAi), daf-16(mu86);Is(Pges-1-mir-355);skn-1(RNAi), Is(Pges-1-mir-355);Ex(Pges-1-daf-2-3′UTR), and Is(Pges-1-mir-355);Ex(Pges-1-daf-2 + 3′UTR). Is(Pges-1-mir-355) is a transgenic strain with multi-copy mir-355 insertion. All the used miRNA mutants are deletion mutants[8,9,31]. The mutants were backcrossed with wild-type for at least four times. In nDf64, mir-253 and part of F44E7.5 are deleted. Some of the used strains were from Caenorhabditis Genetics Center, which is funded by the NIH Office of Research Infrastructure Programs (P40 OD010440). Nematodes were normally maintained on nematode growth medium (NGM) plates seeded with Escherichia coli OP50 as a food source at 20 °C as described[40].
P. aeruginosa PA14 pathogenesis assay
Age synchronous populations of young adults were prepared, and infected with P. aeruginosa PA14 as described[41]. P. aeruginosa PA14 cultured in Luria broth was seeded on the killing plates containing a modified NGM (0.35% instead of 0.25% peptone). P. aeruginosa PA14 was incubated first at 37 °C for 24-h, and then at 25 °C for 24-h. P. aeruginosa PA14 infection was started by adding 60 young adult nematodes to the killing plates at 25 °C. Full-lawn PA14 killing plates were prepared for the P. aeruginosa PA14 infection.
Survival assay
Survival assay was performed basically as described[42]. During the P. aeruginosa PA14 infection, nematodes were scored for dead or live every 12-h. Nematodes were counted as dead, if no response was detected after prodding with a platinum wire. Nematodes were transferred daily at 25 °C (if not specially indicated) for the first 5 days of adulthood. For the survival assay, graphs are representative of three trials. The survival curves were considered to be significantly different from the control, when the p-values were less than 0.001.
Bacterial CFU assay
The CFU of P. aeruginosa PA14 was analyzed as described previously[43]. Young adult nematodes were infected with P. aeruginosa PA14 infection for 24-h. After P. aeruginosa infection, the examined nematodes were transferred into a M9 buffer containing 25 mM levamisole to stop pharyngeal pumping. The nematodes were placed onto a NGM plate containing ampicillin (1 mg/mL) and gentamicin (1 mg/mL) for 15-min to eliminate P. aeruginosa PA14 stuck onto the body surface of animals. The nematodes were transferred onto a new NGM plate containing ampicillin (1 mg/mL) and gentamicin (1 mg/mL) for 30-min to further eliminate the external P. aeruginosa PA14. The nematodes were lysed with a motorized pestle, and the lysates were serially diluted with M9 buffer. The diluted lysates were plated onto Luria-Bertani plates containing rifampicin (100 μg/mL) for the selection of P. aeruginosa PA14. After incubation at 37 °C overnight, colonies of P. aeruginosa PA14 were counted for the determination of CFU per nematode. Six replicates of ten nematodes each were performed.
The young adult nematodes were infected with P. aeruginosa PA14 for 24-h. Total RNA (~1 μg) of nematode was extracted using an RNeasy Mini kit (Qiagen), and reverse-transcribed using a cDNA Synthesis kit (Bio-Rad Laboratories). qRT-PCR was performed at an optimized annealing temperature of 58 °C. The examined putative antimicrobial genes were lys-1, lys-8, clec-85, dod-22, K08D8.5, F55G11.7, and F55G11.4. Relative quantification of targeted genes in comparison to the reference tba-1 gene encoding a tubulin was determined. The expression of mir-355 is presented as the relative expression ratio between mir-355 and F35C11.9, which encodes a small nuclear RNA U6. The primer used for the transcription of mir-355 was GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC CATAGCT. The primer for qRT-PCR of mir-355 was TGCTAC TTTGTTTTAGCCTGAG, and the common reward primer was GTGCAGGGTCCGAGGT. The primers for qRT-PCR of F35C11.9 were GAAGATTAGCATGAACCC and TTGGAACGCTTTATGAAT. The designed primers for targeted genes and reference tba-1 gene were shown in Table S2. Three replicates were performed.
RNAi assay
RNAi was basically performed by feeding nematodes with E. coli strain HT115 (DE3) expressing double-stranded RNA that is homologous to a targeted gene[44]. E. coli HT115 (DE3) grown in LB broth containing ampicillin (100 μg/mL) was plated onto NGM plants containing ampicillin (100 μg/mL) and isopropyl 1-thio-β-D-galactopyranoside (IPTG, 5 mM). L1 larvae nematodes were transferred onto RNAi plates for 2 days at 20 °C until they developed into the gravid. The gravid adults were transferred onto a fresh RNAi-expressing bacterial lawn to let them lay eggs so as to obtain the second generation of RNAi population. The eggs were allowed to develop into young adults for the subsequent assays of lifespan, CFU, and gene expression pattern.
DNA constructs and germline transformation
To generate entry vector carrying promoter sequence, the ges-1 promoter used for intestine-specific expression was amplified by PCR from C. elegans genomic DNA. The ges-1 promoter was inserted into pPD95_77 vector in the sense orientation. The mir-355, pmk-1, and daf-2/Y55D5A.5 g cDNA lacking 3′-UTR or containing 3′-UTR were amplified by PCR, and inserted into the corresponding entry vector behind the ges-1 promoter. Transgenic nematodes were generated as described by coinjecting testing DNA at a concentration of 10–40 μg/mL and marker DNA (Pdop-1::rfp) at a concentration of 60 μg/mL into the gonad of nematodes[45]. To generate the transgenic strain Is(Pges-1-mir-355), the integration of extrachromosomal array by UV irradiation was performed as described[46]. The designed primers for DNA construct generation were shown in Table S3.
3′-UTR reporters and microscopy
The 3′-UTR (wt) of daf-2 was amplified by PCR from the genomic DNA. The synthesized daf-2 3′-UTR (mut) sequence is: ATAGAATTCTAACCCCCAAAAAATCCCGCCTCTTAAATTATAAATTATCTCCCACATTATCATATCTCTACACGAATATCGGATTTTTTTTCAGATTTTTTCTGAAAAATTCTGAATAATTTTACCCCATTTTTCAAATCTCTGTATTTTTTTTTGTTATTACCCCCCATATACATTGTGACGAGTCCTAAGACAAGAGCCCCCTTGCAACAAAAAACCATCAAAAACTTCCCGTGAATTCCATAGATAGTGTCTTTCAAACAAGATTTTTTTCTGAGTTTGTACGTTCGCTGACGAAAATTTCATGTGAAAAATTGAATTTTTGTCGATTTTTTGAGCTTAAAATCGATAATTTTTGAATTTCCCGGTAAAAAACGATAATGTATCGATTAAAAGAATGCGGGGCCCTAT. The 3′ UTR reporter construct (Pges-1::GFP-3′-UTR (daf-2 wt) or Pges-1::GFP-3′-UTR (daf-2 mut)) and mCherry internal control (Pges-1::mCherry-3′-UTR (tag-196)) plasmid were coinjected into the gonad of nematodes as described[46]. The expression of GFP and mCherry was observed and analyzed under a fluorescence microscope (Olympus BX41, Olympus Corporation, Japan). The designed primers for DNA construct generation were shown in Table S3.
Statistical analysis
All data in this article were expressed as means ± standard deviation (SD). Graphs were generated using Microsoft Excel (Microsoft Corp., Redmond, WA). Statistical analysis was performed using SPSS 12.0 (SPSS Inc., Chicago, USA). Differences between groups were determined using analysis of variance (ANOVA). Probability levels of 0.05 and 0.01 were considered statistically significant. Lifespan was analyzed using the log-rank test.Supporting Information
Authors: Benjamin P Lewis; I-hung Shih; Matthew W Jones-Rhoades; David P Bartel; Christopher B Burge Journal: Cell Date: 2003-12-26 Impact factor: 41.582