Literature DB >> 29057765

Development of LAMP assays for the molecular detection of taeniid infection in canine in Tibetan rural area.

Kai Feng1, Wei Li2, Zhihong Guo2, Hong Duo2, Yong Fu2, Xiuying Shen2, Cheng Tie3, Rijie E3, Changqin Xiao3, Yanhong Luo4, Guo Qi4, Ma Ni4, Qingmei Ma4, Wataru Yamazaki5,6, Ayako Yoshida1,6,7, Yoichiro Horii1,6,7, Kinpei Yagi8, Nariaki Nonaka1,6,7.   

Abstract

For field-identification of taeniid cestodes in canine animals in Tibetan area, loop-mediated isothermal amplification (LAMP) assays for Echinococcus multilocularis, E. shiquicus, Taenia hydatigena, T. multiceps, T. pisiformis and T. crassiceps were developed and evaluated along with the reported assay for E. granulosus. The LAMP assays showed specific reaction with their corresponding target species DNA with the detection limit of 1 to 10 pg. Moreover, the assays for E. granulosus, E. multilocularis, T. hydatigena and T. multiceps could detect DNA extracted from 3 or more eggs of their corresponding target species. Then, the LAMP assays were applied on samples containing 3 to 35 taeniid eggs obtained from 61 field-collected canine feces in Qinghai, and the result was compared with a reported multiplex PCR and sequence analysis. The LAMP assays and the PCR detected single species DNA of E. granulosus, E. shiquicus, T. hydatigena and T. multiceps in 5, 2, 44 and 2 samples, respectively. In the rest 8 samples, DNA of both E. granulosus and T. hydatigena were detected by the PCR but the LAMP assays detected those DNAs in 2 samples and only T. hydatigena DNA in 6 samples. It was assumed that less than 3 E. granulosus eggs were mixed in the samples although the samples contained 21 to 27 eggs in total. In conclusion, the LAMP assays were less sensitive than the multiplex PCR, but would have adequate sensitivity for field use in Tibetan area.

Entities:  

Keywords:  China; canine; diagnosis; taeniid cestodes; zoonosis

Mesh:

Substances:

Year:  2017        PMID: 29057765      PMCID: PMC5745177          DOI: 10.1292/jvms.17-0430

Source DB:  PubMed          Journal:  J Vet Med Sci        ISSN: 0916-7250            Impact factor:   1.267


Several species of canine taeniid cestodes are sympatrically epidemic in Tibetan area, China. The area was reported as one of the most endemic areas of Echinococcus spp. in the world [6, 13, 14, 31, 36, 37]. The prevalence of cystic echinococcosis caused by E. granulosus and alveolar echinococcosis caused by E. multilocularis in herdsmen reached to even 5.5 and 8.5%, respectively, in some counties of Qinghai province [13]. Besides, E. shiquicus that is maintained by Tibetan foxes (Vulpes ferrilata) and pikas has been reported in this area [35], although the zoonotic status of this species is still unknown [3]. Taenia multiceps and T. hydatigena were also highly endemic in the area, where around 50% of sheep and 15% of yaks were infected with T. hydatigena and 5% of sheep with T. multiceps in some counties [34]. The former may cause a serious damage to the liver of lambs with heavy infection and the latter is the well-known causative pathogen of neurocoenurosis in sheep. Moreover, T. pisiformis and T. crassiceps have been found in red foxes (Vulpes vulpes) [17]. The eggs of those taeniid cestodes are excreted in the feces of canine animals, such as dogs, red foxes and Tibetan foxes, and contaminate the nomadic environment of herdsmen. Since funding and facilities are not adequate in Tibetan rural area, it is important to have an on-site diagnostic tool that does not require expensive equipment in order to evaluate the prevalence of the individual taeniid species in canine animals and conduct local control programs for the pathogenic taeniid species in this area. Microscopic examination of feces is a classical method for the detection of eggs excreted in feces of the definitive hosts, however, the eggs of taeniid species cannot be differentiated due to their morphological similarity [9]. Coproantigen detection methods based on sandwich ELISA have been also developed for taeniid species. However, the diagnostic reliability was impaired by cross-reactions among the taeniid species [7, 8, 10, 29]. Furthermore, polymerase chain reaction (PCR)-based techniques have been developed for the detection of taeniid cestodes [3,4,5, 20]. However, the requirement of sophisticated equipment and relatively long time for test completion is disadvantage in application [25]. While, loop-mediated isothermal amplification (LAMP) technique that can be conducted at constant temperature without using a thermal cycler would be a specific and sensitive diagnostic method for detecting target DNA [27], and amplification can be confirmed by the formation of white precipitate of a side product, magnesium pyrophosphate, in the reaction mixture [21, 22]. Because of the practical and economical advantages, LAMP assays have been widely used for the detection of different microorganisms, especially pathogens [15, 18, 21, 25, 33]. In this study, we developed a LAMP assay-based on-site species-diagnostic tool for canine animals infected with taeniid cestodes of E. multilocularis, E. shiquicus, T. hydatigena, T. multiceps, T. pisiformis and T. crassiceps that are prevalent in Tibetan area. Along with a reported LAMP assay for E. granulosus [25], the LAMP assay system composed of 7 LAMP assays was applied in field samples collected from Tibetan rural area and the reliability of the system was evaluated.

MATERIALS AND METHODS

Parasites materials

The parasite materials used for developing an assay system were listed in Table 1. A part of the materials were the same used in the previous work [1]. Besides, two metacestodes of T. multiceps were collected from two sheep at a slaughterhouse in Haiyan County, Qinghai province, China. Adult worms of T. hydatigena and E. shiquicus were provided from the Zoonosis Laboratory at Qinghai University. Species of the adult or larvae samples were identified either by their morphology or partial DNA sequence of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene [11]. Eggs of T. hydatigena, T. multiceps and E. granulosus were isolated from feces of farm dogs in Xinghai County, Qinghai province, China. Species of eggs were identified by a reported multiplex PCR assay that can detect E. granulosus, E. multilocularis and Taenia spp. from one egg DNA [32]. Species of Taenia was identified by sequencing and BLASTN analysis of the amplified product of Taenia-specific primers. Eggs of E. multilocularis were collected from an experimentally infected dog in Hokkaido Institute of Public Health, Japan.
Table 1.

Specimen used for developing LAMP assays

SpeciesCountryHostDevelopment stage
E. granulosusMauritaniaCamelLarva
E. granulosusUruguaySheepLarva
E. granulosusMauritaniaCamelLarva
E. granulosusArgentinaSheepLarva
E. granulosusChinaDogEgg
E. multilocularisJapanHumanLarva
E. multilocularisFranceHumanLarva
E. multilocularisJapanDogEgg
E. shiquicusChinaFoxAdult
E. shiquicusChinaFoxAdult
E. shiquicusChinaFoxAdult
T. crassicepsJapanGerbilLarva
T. crassicepsSwitzerlandGerbilLarva
T. pisiformisJapanDogAdult
T. hydatigenaChinaDogAdult
T. hydatigenaChinaDogAdult
T. hydatigenaChinaFoxAdult
T .hydatigenaChinaDogEgg
T. multicepsChinaSheepLarva
T. multicepsChinaSheepLarva
T. multicepsChinaDogEgg
T. taeniaeformisFranceWater voleLarva
T. taeniaeformisFranceWater voleLarva
Dipylidium caninumKoreaDogAdult
D. caninumUruguayDogAdult

All samples were collected from different individual host.

All samples were collected from different individual host.

DNA extraction

Genomic DNAs of the samples were extracted by QIAamp DNA mini kit (Qiagen, Hilden, Germany) following the manufacture’s instruction. The extracted DNA were eluted in 50 µl TE buffer and stored at −30°C until use. The DNA concentration of each sample was measured with QubitTM Fluorometer (Invitrogen, Carlsbad, CA, U.S.A.). The DNAs were used for determining the specificity and sensitivity of LAMP assays, and used as control in field evaluation.

Design of LAMP primers

The partial sequences of mitochondrial cox1 gene or NADH dehydrogenase subunit 1 (nad1) gene of the target species prevalent in Tibetan area were retrieved from GenBank. Then species-specific LAMP primer sets for the target parasite species were designed using the software PrimerExplorer V4 (http://primerexplorer.jp/elamp4.0.0/index.html). Finally, matching validity of each primer set was evaluated in silico with other sequences registered in GenBank (Table 2). Information of primer sets and their optimized amplification temperatures are also shown in Table 2. For E. granulosus, a reported primer set and temperature [25] were used in the following experiments.
Table 2.

Designed LAMP primer sets and amplification temperature of LAMP assays

SpeciesTarget geneSequencesa) used to design primersPrimerSequence (5′→3′)Temperature (°C)Sequencesa) used to evaluate primersNo. of mismatches
E. shiquicuscox1JF906137F3TGCTATGTTTTCTATAGTGTGTT62JF906138−1460
B3ACACTATAAAAGAAACAACCCA
FIPACAGAACTAAAAAAAACAGCCGTCTGAAGGAGAGTTTGAGGTCA
BIPAGGAGTTCCAACTGGTATAAAGGTGCCACAAAACAGGATCACTC

E. multiloculariscox1AB461417F3GCGTTTGGGTTTTATGGTT60AB461412−416, AB461418−420, AB477010−012, KC550007, KC550004, AB374425, AB3856100–1
B3ACCACAAAATAGGATCACTCTT
FIPCATCCAACCCAACAGTAAACATATGGTTTTCTATAGTGTGTTTAGGGA
BIPGTTACGATGATTATAGGTGTTCCGACTAGAATTAAGCAACATATACAACC

T. hydatigenacox1JN831296F3TTTTGTTGTTAGTTACTCTTCCT62JN831297−314, GQ2288190–3
B3TCAGGACTCATACTTATTCTCAA
FIPCTCCACCACCTAATGGATCAAAATTACAATGCTTTTGTTTGATCGT
BIPTTCAGCATATGTTTTGGTTCTTTGGGACTAATAATTCCAAATCCAGGA

T. multicepsnad1KC794809F3TTGTAGTTATAGTTTGGTGGATT64KC794810, KC794811, GQ2288180–3
B3AAAACCATTCCTAACCATGAA
FIPCAAACGGAGTACGATTAGTTTCACAGGTTGTCGTTTATGGTTTTTCC
BIPGGTGAGGCTGAAAGCGAGTTACTCACACGCAAACAAGCA

T. crassicepscox1EU544546F3GAATTGTGATTCTTTTGGTT60EU544547−550, KF751222, KF751223, NC0025470–1
B3CATATACAATCAAGTAAACACC
FIPTGATGACCCCAAACACTCCTAATGGATTGTTATTTGCTATGTTC
BIPACGGTTGGTTTAGATGTTAAGACTGTTTATACCTGTAGGTACTCC

T. pisiformiscox1JX677964F3CAGGGTTTGGTATAATTAGTCAT61JX677965−975, JN870125, JN870126, KC020690−698, KC020700, KC020701, KC020709, KC020710, NC013844, GU5690960–1
B3AGCATATAAAGTCATGTAAAGACC
FIPGACCTCATACACTTCTACCTAAACAAAAGTATGTGTTCAGATGCGT
BIPACTGTTGGATTAGATGTAAAGACCGATTCCAGTAGGTACTCCAATT

a) Accesion number in GenBank.

a) Accesion number in GenBank.

LAMP assay

LAMP reaction mixture was consisted of 12.5 µl of 2 × reaction buffer (40 mM Tris-HCl pH 8.8, 20 mM KCl, 16 mM MgSO4, 20 mM (NH4) SO4, 0.2% Tween-20, 1.6 M Betaine, 2.8 mM each of dNTP), 1.3 µl of primer sets (20 pmol of FIP and BIP primers and 2.5 pmol of F3 and B3 primers), 8 units of Bst DNA polymerase (large fragment) (New England Biolabs, Inc., Ipiwich, MA, U.S.A.), 1 µl of DNA extracted from cestodes adult or larva or 5 µl of DNA from taeniid eggs, and DDW to a final volume of 25 µl. The reaction mixture was incubated for 90 min at 60°C for E. multilocularis and T. crassiceps, 61°C for T. pisiformis, 62°C for E. shiquicus and T. hydatigena or 64°C for T. multiceps, followed by heating at 85°C for 10 min to inactivate the enzyme. The LAMP assays were performed using LA-500 LoopampTM real-time turbidimeter (Eiken Chemical Co., Ltd., Tokyo, Japan). The threshold time that is the required time for the turbidity to exceed the threshold value (0.1) was recorded for each sample by the device.

Specificity test of the LAMP assays

To verify the specific reaction of the designed species-specific LAMP assays, each assay was performed with genomic DNA (0.2 to 10 ng) of the cestodes listed in Table 1. The assays were performed in duplicate, and DW was used as template for checking the formation of primer dimmers.

Sensitivity test of the LAMP assays

Sensitivity of the assays was determined using DNA of the corresponding target parasites with 10-fold serial amount of 0.1 to 100 pg. The assays were performed in duplicate. In addition, in order to know how many eggs are required for the detection of egg DNA at minimum, the assays were performed with DNA extracted from 1, 2, 3 and 5 eggs of T. hydatigena, T. multiceps, E. granulosus and E. multilocularis. The assays were performed in duplicate. One, 2, 3 and 5 eggs were picked up from the cover slides under a stereo-microscope after processing the fecal samples by sucrose centrifugal flotation technique, and DNA was extracted using QIAamp DNA Mini Kit. For the samples of T. hydatigena, T. multiceps and E. granulosus whose eggs were isolated from field dogs, we performed a reported multiplex PCR assay [32] to confirm each sample contained only one species DNA. For the samples showing a specific band for Taenia spp., a chromatogram of direct sequence data of the amplified products was examined for wave overlapping due to the existence of different nucleotides.

Evaluation of LAMP assay system with field samples

From 2014 to 2016, 481 canine fecal samples were collected in Xinghai county. Feces were collected in the nomadic grassland and in the defecation area of tethered dogs. For the field-collected feces, their origin animals were identified following the protocol described by Nonaka et al. [26]. Briefly, fecal DNA was extracted from the surface washing of the frozen feces using QIAamp Stool Mini Kit (Qiagen). Then PCR was conducted on the DNA with the primers prL (5′-CACCATTAGCACCCAAAGCT-3′) and prH (5′-CCTGAAGTAGGAACCAGATG-3′) to amplify a part of the D-loop region present in all carnivores. Feces samples were stored at −80°C for at least 10 days to inactive the Echinococcus eggs. Then, one gram of feces was examined by the sucrose centrifugal flotation technique with specific gravity 1.27. A LAMP assay system for identifying 7 taeniid species prevalent in Tibetan area was designed by testing a sample simultaneously by a set of the 7 species-specific LAMP assays. For field evaluation, 3 to 35 taeniid eggs were recovered from the flotation solution and concentrated in 1.5 ml tubes. DNA was extracted from the eggs using QIAamp DNA mini kit and applied to the LAMP assay system and the multiplex PCR.

RESULTS

Validity of the LAMP primers in silico

When the matching validity of the developed primers was evaluated with various sequences registered at GenBank, the developed 4 primers for each species were completely matched with some of the sequences. However, 1 to 3 internal mismatches were also found with other sequences depending on the target species (Table 2).

Sensitivity and specificity of the LAMP assays

When the designed LAMP assays were performed with a serial dilution of DNA of their corresponding target species, the LAMP assays for E. granulosus, T. crassiceps, T. pisiforms, E. shiquicus and T. hydatigena could detect DNA up to 10 pg, and those for E. multilocularis and T. multiceps up to 1 pg (Table 3). Threshold time was apparently elongated as the amount of template DNA decreased.
Table 3.

Mean threshold time (min:sec) of the LAMP assays performed with different amount of template DNA of target species

LAMP assay forTemplate DNA amount (pg)

1001010.1
E. granulosus62:5470:22NDa)ND
E. multilocularis63:2170:3678:42ND
E. shiquicus46:2764:42NDND
T. hydatigena49:2160:15NDND
T. multiceps46:2157:4273:09ND
T. pisiformis56:0064:33NDND
T. crassiceps65:2469:43NDND

a) Amplification was not detected by the Turbidimeter.

a) Amplification was not detected by the Turbidimeter. While, no products were produced when the LAMP assays were performed with DNA of non-target cestodes. Primer dimers were not either formed.

Detecting taeniid eggs by LAMP assays

By the multiplex PCR and chromatogram analysis, it was confirmed that all samples of T. hydatigena, T. multiceps and E. granulosus contained only one species DNA. When LAMP assays for T. hydatigena, T. multiceps, E. granulosus and E. multilocularis were performed on DNA extracted from eggs of their target species, the assays could constantly detect DNA extracted from 2 eggs of T. multiceps and E. multilocularis, and 3 eggs of T. hydatigena and E. granulosus (Table 4).
Table 4.

Detection of DNA extracted from different numbers of taeniid eggs by LAMP assays

LAMP assay forNo. of eggs for DNA extraction

5321
E. granulosus4/4a)4/43/41/4
T. hydatigena4/44/43/42/4
T. multiceps4/44/44/43/4
E. multilocularis4/44/44/41/4

a) No. of positive samples / No. of examined samples.

a) No. of positive samples / No. of examined samples.

Identification of feces origin animals and fecal examination

In the survey, 123 feces were collected at the nomadic field and 358 feces were collected in the defecation area of the tethered dogs. DNA analysis of the 123 field-collected feces revealed that 3 were from dogs, 22 from Tibetan foxes, 25 from red foxes, and 1 from wolf (Canis lupus). Feces origin of the rest 72 feces could not be identified. Taeniid eggs were found in 81 feces of tethered dogs with the intensity from 1 to more than 1,000 eggs per gram of feces. Of the 51 origin-identified feces, taeniid eggs were found in feces of 1 dog, 5 Tibetan foxes and 1 red fox with the intensity from 1 to 63 eggs per gram of feces.

Species identification of taeniid eggs isolated from field samples

From feces of 58 tethered dogs and 3 Tibetan foxes, the following number of taeniid eggs were isolated and DNA was extracted: 3 to 9 eggs from 17 dogs and 3 foxes, 10 to 19 eggs from 18 dogs, and 20 to 35 eggs from 23 dogs. While less than 3 eggs were recovered from the other 27 samples, thus they were not used for the evaluation. When the DNA was amplified by the LAMP assay system and multiplex PCR, single species of DNA was detected by both methods in 53 samples in which DNA of E. granulosus, E. shiquicus, T. hydatigena and T. multiceps was detected in 5, 2, 44 and 2 samples, respectively. In the rest 8 samples, DNA of both E. granulosus and T. hydatigena were detected by the PCR, but the LAMP assay system detected those DNAs in 2 samples and only T. hydatigena DNA in 6 samples, although the 6 samples contained 21 to 27 eggs in total (Table 5).
Table 5.

Comparison of results of species identification by LAMP assay and multiplex PCR

Detection methodNo. examinedSpecies identified

E. granulosus & T. hydatigenaE. granulosusT. hydatigenaE. shiquicusT. multiceps
Multiplex PCR61854422
LAMP assays61255022

DISCUSSION

In the present study, each LAMP assay was constructed with 4 primers (F3, B3, FIP and BIP). For ideal LAMP assay, two extra primers calling loop primers that target the loop-formed regions would be necessary for securing the specificity and sensitivity of LAMP assays and for accelerating the LAMP reaction [23]. Actually, we first tried to design loop primers, however, we could not design functional primers that cleared the recommended conditions for melting temperature and GC content by the program. Accordingly, we used only 4 primers that are essential and minimal requirement for LAMP assay. When the matching validity of the developed primers was evaluated in silico, the primers did not match perfectly with some haplotypes registered in GenBank. However, all the mismatches were internal ones and the number of mismatches was within 1–3 bases. It was reported that the primers were effective for the haplotypes with two to three internal mismatches and ineffective when there were four to six mismatches in LAMP assay [28]. The validity of the developed primers was also confirmed in our study that the primers developed for 6 species could produce the LAMP products with all target specimens listed in Table 1. The developed LAMP assays showed specific amplification for their target species. The detection limit of the LAMP assays for the target species DNA (1–10 pg) was in agreement with the previous LAMP protocols performed without loop primers, in which the detection limit of the assays were 10 pg of E. granulosus genomic DNA [25]. The minimum number of eggs required for the developed assays for egg DNA (2–3 eggs) was also in agreement with the previous study in which the assay could detect DNA of five eggs of T. asiatica and T. saginata [24]. In surveys on definitive hosts of taeniid cestodes using field-collected feces, parasite DNA has been obtained either from eggs isolated from animal feces [26, 32] or directly from feces (copro-DNA) [3, 4]. In this study, the LAMP assays were applied to the DNA that was extracted from eggs isolated from fecal samples following the microscopic fecal examination. We have been using fecal egg examination technique as a primer diagnostic tool of field-collected feces for evaluating the parasite prevalence in Qinghai province [12, 17] and using a molecular technique to further differentiate the parasite species. This is because parasitological examination can provide the direct evidence of parasite infection and also screen the samples for the application of a molecular technique, thus we could reduce the cost for examination. While, a copro-DNA detection technique has an advantage of detecting prepatent infection and potentially patent period infection without egg excretion [16, 19], however, it requires higher cost for testing all samples by a molecular method and the consideration for removing PCR inhibitors in feces [3, 19] and the potential of detecting DNA from consumed diet [2] and of other organism in feces by cross reaction [19]. The developed LAMP assays required for a minimum of 2 to 3 taeniid eggs to produce the products. In this study, egg DNA was eluted in 50 µl of TE buffer, and then 5µl of eluted DNA was applied to the assay as template DNA. Since a taeniid egg was reported to contain 8 pg of DNA [4, 30], the amount of template DNA of the samples containing 2 to 3 eggs was calculated to be 1.6 or 2.4 pg. Therefore, this is consistent with our finding of the detection limit of the assays (1 to 10 pg). A multiplex PCR assay used in this study has been reported to amplify the DNA of E. multilocularis, E. granulosus and Taenia spp. with different product sizes [32]. However, they did not evaluate E. shiquicus DNA by the assay. In order to apply the assay in Qinghai, we evaluated E. shiquicus DNA by the assay and found that the amplification product of E. shiquicus was the same size as that of Taenia spp. (data not shown). Therefore, E. shiquicus could be differentiated by the sequence analysis of the amplification product with Taenia genus-specific primers. In the field evaluation, we evaluated the field reliability of the developed LAMP assays by comparing the results with those of the reported multiplex PCR [32]. Discrepancy in the results were detected in 6 samples in which both E. granulosus and T. hydatigena DNA were detected by the multiplex PCR, however, only T. hydatigena DNA were detected by the LAMP system. Because 3 eggs are required for the LAMP assays to detect E. granulosus egg DNA while only 1 egg for the multiplex PCR [32], the reason was supposed that less than 3 E. granulosus eggs were included in the 6 samples even though the samples contained 21 to 27 eggs in total. Although, we could not evaluate the minimum number of eggs required for the LAMP assays for E. shiquicus, T. crassiceps and T. pisiformis due to a lack of samples, those assays showed a similar detection limit of DNA with other assays (Table 3). Therefore, it could be expected that those assays require the similar number of eggs for producing the products. In conclusion, the LAMP assay system showed less sensitivity than the multiplex PCR. However, the sensitivity disadvantage could be overcome by examining more number of eggs. Considering the advantages of LAMP method, the developed system covering the 7 taeniid species prevalent in Qinghai province could be a useful on-site species-diagnostic tool for taeniid infection in Tibetan area.
  34 in total

1.  Loop-mediated isothermal amplification of DNA.

Authors:  T Notomi; H Okayama; H Masubuchi; T Yonekawa; K Watanabe; N Amino; T Hase
Journal:  Nucleic Acids Res       Date:  2000-06-15       Impact factor: 16.971

2.  Accelerated reaction by loop-mediated isothermal amplification using loop primers.

Authors:  K Nagamine; T Hase; T Notomi
Journal:  Mol Cell Probes       Date:  2002-06       Impact factor: 2.365

3.  Epidemiology and control of echinococcosis in central Asia, with particular reference to the People's Republic of China.

Authors:  Wenbao Zhang; Zhuangzhi Zhang; Weiping Wu; Baoxin Shi; Jun Li; Xiaonong Zhou; Hao Wen; Donald P McManus
Journal:  Acta Trop       Date:  2014-03-28       Impact factor: 3.112

4.  A loop-mediated isothermal amplification (LAMP) method for the identification of species within the Echinococcus granulosus complex.

Authors:  Marion Wassermann; Ute Mackenstedt; Thomas Romig
Journal:  Vet Parasitol       Date:  2013-12-22       Impact factor: 2.738

5.  Development of PCR/dot blot assay for specific detection and differentiation of taeniid cestode eggs in canids.

Authors:  Maria Teresa Armua-Fernandez; Nariaki Nonaka; Tatsuya Sakurai; Seita Nakamura; Bruno Gottstein; Peter Deplazes; Isaac G K Phiri; Ken Katakura; Yuzaburo Oku
Journal:  Parasitol Int       Date:  2010-11-25       Impact factor: 2.230

6.  Real-time fluorescence loop mediated isothermal amplification for the diagnosis of malaria.

Authors:  Naomi W Lucchi; Allison Demas; Jothikumar Narayanan; Deborah Sumari; Abdunoor Kabanywanyi; S Patrick Kachur; John W Barnwell; Venkatachalam Udhayakumar
Journal:  PLoS One       Date:  2010-10-29       Impact factor: 3.240

Review 7.  Biological, epidemiological, and clinical aspects of echinococcosis, a zoonosis of increasing concern.

Authors:  Johannes Eckert; Peter Deplazes
Journal:  Clin Microbiol Rev       Date:  2004-01       Impact factor: 26.132

8.  Loop-mediated isothermal amplification method for differentiation and rapid detection of Taenia species.

Authors:  Agathe Nkouawa; Yasuhito Sako; Minoru Nakao; Kazuhiro Nakaya; Akira Ito
Journal:  J Clin Microbiol       Date:  2008-11-12       Impact factor: 5.948

9.  Epidemiological study and control trial of taeniid cestode infection in farm dogs in Qinghai Province, China.

Authors:  Zhihong Guo; Wei Li; Mao Peng; Hong Duo; Xiuying Shen; Yong Fu; Takao Irie; Tiantian Gan; Yumi Kirino; Tetsuo Nasu; Yoichiro Horii; Nariaki Nonaka
Journal:  J Vet Med Sci       Date:  2013-11-21       Impact factor: 1.267

10.  A comparison of loop-mediated isothermal amplification (LAMP) with other surveillance tools for Echinococcus granulosus diagnosis in canine definitive hosts.

Authors:  Xing-Wei Ni; Donald P McManus; Zhong-Zi Lou; Ji-Fei Yang; Hong-Bin Yan; Li Li; Hong-Min Li; Quan-Yuan Liu; Chun-Hua Li; Wan-Gui Shi; Yan-Lei Fan; Xu Liu; Jin-Zhong Cai; Meng-Tong Lei; Bao-Quan Fu; Yu-Rong Yang; Wan-Zhong Jia
Journal:  PLoS One       Date:  2014-07-09       Impact factor: 3.240

View more
  2 in total

1.  Innovative tools for the diagnosis of Echinococcus granulosus in definitive hosts.

Authors:  Maria Paola Maurelli; Antonio Bosco; Paola Pepe; Davide Ianniello; Alessandra Amadesi; Giuseppe Cringoli; Laura Rinaldi
Journal:  Parasitol Res       Date:  2018-06-02       Impact factor: 2.289

Review 2.  Detection of helminths by loop-mediated isothermal amplification assay: a review of updated technology and future outlook.

Authors:  Miao-Han Deng; Lan-Yi Zhong; Okanurak Kamolnetr; Yanin Limpanont; Zhi-Yue Lv
Journal:  Infect Dis Poverty       Date:  2019-03-25       Impact factor: 4.520

  2 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.