Molecular detection of Leishmania infantum and Leishmania tropica in rodent species from endemic cutaneous leishmaniasis areas in Morocco.

BACKGROUND: Leishmaniasis remains a major public health problem in African nations, including Morocco, where little is known about the vertebrate reservoirs involved in the causal parasites' transmission cycles. The present study investigates the role of rodent species as potential reservoirs of Leishmania spp. in central Morocco, where both L. tropica and L. infantum have been reported.
METHODS: Rodents were caught from 22 sites in central Morocco, by using Sherman metal traps, and identified morphologically. For each specimen, genomic DNA was extracted from different tissues using the Speed Tools DNA extraction Kit. Then, samples were PCR-analyzed, targeting the SSU rRNA gene to detect Leishmania spp. DNA, followed by amplification of the internal transcribed spacer 1 (ITS1) and its sequencing to identify the species.
RESULTS: A total of 197 rodents belonging to ten species were captured and identified: Rattus rattus (40.61%), Mus musculus (25.38%), Apodemus sylvaticus (8.63%), Mus spretus (7.11%), Meriones shawi (5.58%), Rattus norvegicus (4.57%), Meriones libycus (3.05%), Mastomys erythroleucus (2.03%), Gerbillus campestris (2.03%) and Lemniscomys barbarus (1.01%). Molecular analysis revealed the presence of Leishmania species in 18 specimens: six R. rattus (out of 80 captured; 7.5%), 11 M. musculus (out of 50 captured; 22%), and one R. norvegicus (out of 9 captured; 11.11%).
CONCLUSIONS: To the best of our knowledge, L. infantum and L. tropica were identified in rodent species for the first time in Morocco. These findings suggest that rodent species may be involved in L. infantum and L. tropica transmission cycles in this country but that further studies are needed to confirm their role as reservoirs of Leishmania species in Morocco.

Background

Leishmaniasis is a vector-borne infectious disease caused by members of the genus Leishmania (Kinetoplastida: Trypanosomatidae) and transmitted by phlebotomine sand flies (Diptera: Psychodidae) [1]. In the Mediterranean basin, the primary reservoir hosts of Leishmania spp. are wild mammals, mainly rodents and canids [2-5].

Leishmaniasis remains one of the major public health problems in Morocco where three Leishmania species coexist [6]. Leishmania infantum causes mainly zoonotic visceral leishmaniasis; L. major causes zoonotic cutaneous leishmaniasis and L. tropica causes anthroponotic cutaneous leishmaniasis [6]. Certainly, natural Leishmania infections have been reported in many rodent species, such as Mus musculus, Rattus norvegicus, Rattus rattus and Apodemus sylvaticus [7-17]. However, in Morocco, the only proven rodent reservoir of Leishmania (L. major MON 25) is Meriones shawi (Rodentia: Gerbillidae) [18, 19], despite the country being rich in rodent species [20].

The detection of infection in wild and domestic animals is the first step in identifying the different host reservoirs of Leishmania spp. Host incrimination depends on the accumulation of evidence based on five criteria [21, 22]: (i) geographical and temporal overlapping of vectors and hosts distributions; (ii) survival of the reservoir host long enough to permit transmission; (iii) higher infection prevalence; (iv) presence and frequency of parasites in the skin or the blood to be infective for the vector; and (v) detection of the same Leishmania species in human cases and the reservoir host.

In the present work, molecular methods were used to detect Leishmania infection in wild-caught rodents from central Morocco, from where both cutaneous and visceral leishmaniasis has been reported in humans [17, 23].

Methods

Study area

This study was conducted in four regions of central Morocco: Al Haouz, Chichaoua, Essaouira and Marrakesh. A total of 22 sites (Fig. 1) with altitudes between 318 and 2579 m were sampled. Across the study area, the climate is arid to semi-arid on the plain (up to 450 m in Marrakesh) and humid in the Atlas Mountains (right up to 4167 m on Toubkal Mountain) and on the coast (up to 50 m in Essaouira).

Fig. 1

Local map showing the study area. Numbers (1–22) indicate sampling sites

Rodent collection

The presence of rodents was surmised from cut plant stems and fresh droppings. Animals were captured using metal Sherman baited traps placed at the entrances of active burrows. For catching many rodent species, different baits were used in the same trap: bread with olive oil, tomatoes, potatoes and dates. The traps were set in the afternoon and recovered early the next morning. Forty traps were placed twice monthly (every 15 days) at each site between June 2014 and May 2015.

Treatment of captured rodents and DNA extraction

In the laboratory, caught rodents were anaesthetized with ether for the purposes of species identification and collecting data on weight, length (body and tail) and skin lesions (according to European decree NOR: AGRG1238767A 2013). Species identifications were made according to morphological characteristics [24]. Samples of liver, spleen, bone marrow and skin (ear lobe and, when available, skin lesions) (Fig. 2) were then harvested for parasite detection.25–30 mg of each tissue was removed with the aid of single-use forceps, scissors and scalpel blades, placed in sterile tubes, and stored at -20 °C for DNA extraction.

Fig. 2

Skin lesions in rodent specimens

Genomic DNA was extracted using the Speed Tools DNA extraction Kit (Biotools, Madrid, Spain) following the manufacturer’s recommendations, and was eluted in a final volume of 200 μl of PCR-grade water. The extracts were stored at 4 °C until PCR analysis.

Detection of Leishmania spp. DNA

The extracted DNA was screened for Leishmania spp. by the LnPCR amplifying a fragment from the small subunit ribosomal ribonucleic acid gene SSU rRNA [25, 26]. The first amplification step (Table 1) was performed using R221 (specific for order Kinetoplastida) and R332 primers (specific for the genera Leishmania and Crithidia) [25]. The PCR product was then tested in a subsequent amplification step with R233 and R333 primers of the genus Leishmania, according to the protocol developed by Van Eys et al. [25] and adapted and modified by Cruz et al. [27].

Table 1

PCR methods and primers sequences and main conditions used in this study

Gene	Primer	Product size (bp)	Primer sequence (5′-3′)	Amplification conditions	H2O (μl)a	MgCl2 (μl)	dNTP (0.2 mM) (μl)	Primer (μl)	Units Taq DNA polymerase (μl)	DNA (μl)	Total volume (μl)
SSU	R221	603	GGTTCCTTTCCTGATTTACG	94 °C for 5 min, 94 °C for 30s, 60 °C for 30s, 72 °C for 30s, 72 °C for 5 min (30 cycles)	30.6	5.0	1.0	1.0 (15 pmol)	1.4 (1 U/μl)	10	50
	R332		GGCCGGTAAAGGCCGAATAG
	R223	358	TCCCATCGCAACCTCGGTT	94 °C for 5 min, 94 °C for 30s, 65 °C for 30s, 72 °C for 30s, 72 °C for 5 min (30 cycles)	10.6	2.5	0.5	0.5 (7.5 pmol)	0.7 (0.5 U/μl)	10a	25
	R333		AAAGCGGGCGCGGTGCTG
								0. 25 (3.75 pmol)
ITS1	LITSR	300–350	CTGGATCATTTTCCGATG	94 °C for 5 min, 94 °C for 30s, 53 °C for 30s, 72 °C for 30s, 72 °C for 5 min (30 cycles)	30.6	5.0	1.0	1.0 (15 pmol)	1.4 (1 U/μl)	10	50
	L5.8S		TGATACCACTTATCGCACTT
	SAC	280–330	CATTTTCCGATGATTACACC	94 °C for 5 min, 94 °C for 30s, 57 °C for 30s, 72 °C for 30s, 72 °C for 5 min (30 cycles)	10.6	2.5	0.5	0.5 (7.5 pmol)	0.7 (0.5 U/μl)	10b	25
	VAN2		CGTTCTTCAACGAAATAGG

aSterile distilled water

b10 μl of a 1/40 dilution of the first PCR amplicons

A reamplification reaction was then performed in a 25 μl final volume, involving 10 μl of a 1/40 dilution of the first PCR amplicons as a template was added to a PCR mixture (Table 1). The components, total reaction volume and programs for the implementation of the LnPCR are detailed in Table 1. The amplification products were resolved on a 1.5% agarose gel, stained with Gel Red Nucleic Acid stain (Biotium, Fremont, California, USA), and visualized under UV light. Samples yielding a PCR product of 603 bp (Additional file 1: Figure S1) and 358 bp (Additional file 1: Figure S2), respectively, by first and second amplification reaction were deemed positive for Leishmania spp. DNA.

Negative controls without DNA were employed in all assays. DNA from the reference Leishmania infantum strain MHOM/FR/78/LEM75 was used as a positive control (Additional file 1: Figures S1-S3).

Identification of Leishmania species

Samples shown to be positive by LnPCR were further analyzed to identify the Leishmania species by nested amplification of the ribosomal internal transcribed spacer 1 (ITS1-PCR).

The first PCR reaction was carried out using the primers LITSR/L5.8S as described by El Tai et al. [28] and Schönian et al. [29]. Amplification reactions were performed in volumes of 50 μl was added to a PCR mixture described in Table 1. For the second reaction, we used the primers SAC and VAN2 [30]. A reamplification reaction was then performed in a 25 μl final volume, involving 10 μl of a 1/40 dilution of the first PCR amplicons as a template was added to a PCR mixture described in Table 1.

Negative and positive controls were also included in this assay. All reactive were synthesized commercially (Biotools, B&M Labs, S.A., Madrid, Spain). All PCR products were visualized on 1.5% agarose gel as above (Additional file 1: Figure S3). Samples providing a 300–350 bp (Additional file 1: Figure S2) and 280–330 bp (Additional file 1: Figure S3), respectively, were deemed positive. The ITS1-PCR products were excised from the agarose gels and purified using the QIA quick extraction kit (Qiagen). They were then sequenced which allows to correctly identify all species of the genus Leishmania of the Old World [31], using the Big-Dye Terminator Cycle Sequencing Ready Reaction kit v3.1 and an automated ABI PRISM 377 DNA sequencer (Applied Biosystems, Foster City, CA, USA). These sequences were edited using BioEdit Sequence Alignment Editor Software v. 7.0.9.0 [32] and compared with others held in the GenBank database using BLAST software.

Results

A total of 197 animals belonging to 10 rodent species were captured (Table 2): 80 Rattus rattus (40.61%), 50 Mus musculus (25.38%), 17 Apodemus sylvaticus (8.63%), 14 Mus spretus (7.11%), 11 Meriones shawi (5.58%), 9 Rattus norvegicus (4.57%), 6 Meriones libycus (3.05%), 4 Mastomys erythroleucus (2.03%), 4 Gerbillus campestris (2.03%) and 2 Lemniscomys barbarus (1.01%).

Table 2

Rodent species captured in the study area

Species	Male	Female	Total	%
Rattus rattus	28	52	80	40.61
Mus musculus	14	36	50	25.38
Apodemus sylvaticus	6	11	17	8.63
Mus spretus	6	8	14	7.11
Meriones shawi	5	6	11	5.58
Rattus norvegicus	4	5	9	4.57
Meriones libycus	1	5	6	3.05
Mastomys erythroleucus	1	3	4	2.03
Gerbillus campestris	2	2	4	2.03
Lemniscomys barbarus	0	2	2	1.01
Total	67	130	197	100

Leishmania species was detected in 18 specimens (Table 3): 6 R. rattus (out of 80 captured; 7.5%), 11 M. musculus (out of 50 captured; 22%), and one R. norvegicus (out of 9 captured; 11.11%). Statistical analysis, using Chi-square test of independence, of infestation rate according to rodent species showed no significant correlation (χ 2 = 5.768, df = 2, P = 0.056).

Table 3

Molecular identification of Leishmania species from rodent species by tissue/organ

Rodent species and number of specimens	LnPCR				ITS1-PCR				Leishmania spp.	Identity (%)
	L	Sp	S	Sl	L	Sp	S	Sl
R. norvegicus (n = 1/9)	P	P	N	–	P	P	N	–	L. infantum	99
R. rattus (n = 6/80)	P	P	N	–	P	P	N	–	L. infantum	99
	P	P	N	–	P	P	N	–	L. infantum	99
	N	N	P	P	N	N	P	P	L. infantum	99
	N	N	P	P	N	N	P	P	L. infantum	99
	N	N	P	–	N	N	P	–	L. infantum	98
	N	N	P	–	N	N	P	–	L. infantum	99
M. musculus (n = 9/50)	N	N	P	–	N	N	P	–	L. infantum	98
	N	N	P	–	N	N	P	–	L. infantum	99
	N	N	P	–	N	N	P	–	L. infantum	98
	N	N	P	–	N	N	P	–	L. infantum	99
	N	N	P	–	N	N	P	–	L. infantum	99
	N	N	P	–	N	N	P	–	L. infantum	100
	N	N	P	P	N	N	P	P	L. infantum	99
	N	N	P	P	N	N	P	P	L. infantum	99
	N	N	P	P	N	N	P	P	L. infantum	99
M. musculus (n = 2/50)	N	N	P	–	N	N	P	–	L. tropica	96
	N	N	P	–	N	N	P	–	L. tropica	97

Abbreviations: L Liver, S Skin, Sl Skin lesion, Sp Spleen, N Negative, P Positive, –, absence of skin lesion

Leishmania infantum DNA was detected in the different organs of 16 (8.12%) specimens (Table 3): in the liver (18.75%) and the spleen (18.75%) of three specimens (n = 3), and in the skin (81.25%) of 13 specimens (n = 13). Leishmania tropica DNA was found only in the skin of 2 (1%) specimens (Additional file 1: Figures S1-S3).

According to the region, Leishmania spp. DNA was detected in 3 of the 4 investigated regions: Al Haouz, Chichaoua and Essaouira (Table 4); with a very significant difference (χ 2 = 20.116, df = 3, P < 0.0001). Leishmania infantum was detected in the Al Haouz region in 14.28% (3/21) of R. rattus, and in 46.15% (6/13) of M. musculus and L. tropica was identified in Chichaoua region in 14.28% (1/7) of M. musculus.

Table 4

Rodent species infected with Leishmania species by region

	El Haouz		Chichaoua		Essaouira		Marrakesh
	Neg	Pos	Neg	Pos	Neg	Pos	Neg	Pos
R. rattus	18	3 L. infantum (14.28%)	12	0	14	3 L. infantum (17.64%)	30	0
M. musculus	7	6 L. infantum (46.15%)	6	1 L. tropica (14.28%)	7	3 L. infantum (27.27%) + 1 L. tropica (9.10%)	19	0
R. norvegicus	0	0	0	0	2	1 L .infantum (33.33%)	6	0

Abbreviations: Neg Negative, Pos Positive

Both Leishmania species were detected in Essaouira region: L. infantum was identified in 17.64% (3/17) of R. rattus, in 33.33% (1/3) of R. norvegicus, and in 27.27% (3/11) of M. musculus; while, L. tropica was identified in 9.10% (1/11) of M. musculus. In Marrakesh region, no Leishmania spp. DNA was detected in any of the 55 animals captured (Table 4).

Ten animals showed ear lobe skin lesions (Fig. 2), of which 50% were confirmed positive for L. infantum. Three of these positive animals showed, in addition, splenomegaly and hepatomegaly (compatible with visceral leishmaniasis).

Discussion

The identification of the natural hosts of Leishmania species is essential to understand the epidemiology of the disease. To our knowledge, there have been no data published since 1982 on natural Leishmania infection in rodent species in Morocco [19].

In the present study, L. infantum DNA was detected in six R. rattus, nine M. musculus (both anthropophilic species) and one R. norvegicus, while L. tropica DNA was detected in two M. musculus. This is the first time that L. infantum and L. tropica infections have been detected in rodent species in Morocco. In the wider Mediterranean region, L. infantum (which causes visceral and cutaneous zoonotic leishmaniasis) has been identified in naturally infected wild rodents including R. rattus, R. norvegicus and M. musculus [8, 10, 12, 15, 16, 33–35]. In Morocco, dogs make up the main host reservoir for L. infantum [17, 36]. However, on the Island of Montecristo (Italy), where no dogs are present, up to 15.5% of R. rattus individuals have been reported infected with L. infantum [37], maintaining a sylvatic transmission cycle.

Leishmania tropica-induced cutaneous leishmaniasis is commonly considered an anthroponotic disease that does not involve an animal reservoir [38], but zoonotic transmission has been demonstrated in Jordan, Palestine and Israel [39, 40].

In north Africa, several rodent species have been implicated in the transmission of L. tropica [39-42]: Ctenodactylus gundi has been proposed as a reservoir host in Tunisia [42, 43], while in Algeria, human cutaneous leishmaniasis caused by Leishmania killicki (a variant of L. tropica) is considered a zoonotic form with P. sergenti as a vector and Massoutiera mzabi as a reservoir [39]. However, in Morocco L. tropicais generally considered an anthroponotic species, despite its identification in dogs on many occasions [44-46].

In the present study, the regions of Chichaoua, Al Haouz and Essaouira were known to be endemic foci of L. tropica-induced cutaneous leishmaniasis for humans [47-49], while, L. infantum is reported responsible for sporadic human cases of visceral leishmaniasis in these areas [50, 51]. In the same study area, Boussaa et al. [23] reported L. infantum-induced leishmaniasis in dogs, which returned very high seroprevalence results (81.8 and 87.8% as determined by ELISA and Western blotting, respectively).

In addition, the vector sand flies Phlebotomus perniciosus and P. sergenti have been found engorged with rodent blood in southern Portugal [52] but also in central Morocco [53] where the sand fly composition is well established [54]. Svobodovà et al. [55] reported the transmission of L. tropica to mice by the bite of Phlebotomus sergenti, a species widespread in our study area [54].

The richness of rodent species (n = 10) across the present study area is favoured by ecological factors. Prevalence and abundance of rodent species areknown to be associated with abundant vegetation [56]. In arid and semi-arid regions, such in the study area, many authors suggested trophic cascade including precipitations, vegetation and rodent density 1 year later [57, 58].

Conclusion

To the best of our knowledge, molecular detection of L. infantum DNA in M. musculus, R. norvegicus and R. rattusand of L. tropica DNA in M. musculus is reported here for the first time in Morocco. These results suggest the possible involvement of rodent species in L. tropica and L. infantum cycles. The present findings should be taken into consideration when developing programs to combat this disease in Morocco.