Longtao Wang1, Shouping Hu2, Qiang Liu2, Yiru Li1,2, Lu Xu2,3, Zhuo Zhang2, Xuehui Cai2, Xijun He2. 1. College of Animal Science and Technology, Jilin Agricultural University, Changchun 130118, China. 2. National Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150001, China. 3. Department of Animal Medicine, Agricultural College of Yanbian University, Yanji 133002, China.
Abstract
Macrophage polarization is a process by which macrophages acquire a distinct phenotypic and functional profile in response to microenvironmental signals. The classically and alternatively activated (M1 and M2, respectively) macrophage phenotypes are defined by the specific molecular characteristics induced in response to prototypic pro- and anti-inflammatory cues. In this study, we used LPS/IFN-γ and IL-4 to stimulate porcine alveolar macrophages (PAMs) in vitro and investigated the expression changes of several novel markers during macrophage polarization. Notably, we found that LPS/IFN-γ-stimulated PAMs express prototypical M1 molecules, whereas IL-4-stimulated PAMs express M2 molecules. We also demonstrated that replication of the highly pathogenic porcine reproductive and respiratory syndrome virus (PRRSV) strain HuN4 was effectively suppressed in LPS/IFN-γ-stimulated M1 PAMs (M1 type), but not IL-4 stimulated M2 PAMs. However, this was not observed with the classic, less pathogenic CH-1a strain. Moreover, we found that M2 marker expression gradually increased after PAM infection with PRRSV, whereas no significant changes were found with M1 marker expression, suggesting that PRRSV infection may skew macrophage polarization towards an M2 phenotype. Finally, we found that anti-viral cytokine expression was significantly higher in M1 macrophages than in M2 macrophages or nonpolarized controls. In summary, our results show that PRRSV replication was significantly impaired in M1 PAMs, which may serve as a foundation for further understanding of the dynamic phenotypic changes during macrophage polarization and their effects on viral infection.
Macrophage polarization is a process by which macrophages acquire a distinct phenotypic and functional profile in response to microenvironmental signals. The classically and alternatively activated (M1 and M2, respectively) macrophage phenotypes are defined by the specific molecular characteristics induced in response to prototypic pro- and anti-inflammatory cues. In this study, we used LPS/IFN-γ and IL-4 to stimulate porcine alveolar macrophages (PAMs) in vitro and investigated the expression changes of several novel markers during macrophage polarization. Notably, we found that LPS/IFN-γ-stimulated PAMs express prototypical M1 molecules, whereas IL-4-stimulated PAMs express M2 molecules. We also demonstrated that replication of the highly pathogenic porcine reproductive and respiratory syndrome virus (PRRSV) strain HuN4 was effectively suppressed in LPS/IFN-γ-stimulated M1 PAMs (M1 type), but not IL-4 stimulated M2 PAMs. However, this was not observed with the classic, less pathogenic CH-1a strain. Moreover, we found that M2 marker expression gradually increased after PAM infection with PRRSV, whereas no significant changes were found with M1 marker expression, suggesting that PRRSV infection may skew macrophage polarization towards an M2 phenotype. Finally, we found that anti-viral cytokine expression was significantly higher in M1 macrophages than in M2 macrophages or nonpolarized controls. In summary, our results show that PRRSV replication was significantly impaired in M1 PAMs, which may serve as a foundation for further understanding of the dynamic phenotypic changes during macrophage polarization and their effects on viral infection.
Porcine reproductive and respiratory syndrome virus (PRRSV) causes a complex systemic disease in pigs that primarily affects the respiratory and reproductive systems of infected hosts, resulting in significant economic losses in the
swine industry worldwide [4, 20, 32]. PRRSV infection is characterized by spontaneous abortion and poor reproductive
performance in pregnant sows, respiratory distress in young pigs and high mortality in piglets [22]. PRRSV has a very narrow cellular tropism, showing a preference for monocyte/macrophage lineage
cells. Specifically, the virus infects certain subsets of differentiated macrophages in the lung, lymphoid tissues and placenta and replicates in testicular germ cells and monocytic lineage cells, particularly porcine alveolar
macrophages [5, 6, 24, 30]. Thus, the lungs and lymphoid organs are obvious
locations of prolonged viral replication and persistence [16].Macrophages play an important role in the first line of defense against invading pathogens, where they act as immune effectors and antigen presenting cells [9]. Macrophages also play a
significant functional role in osteochondral repair [1, 8, 14]. Within fractures, macrophages are recruited during the
early inflammatory phase and persist throughout the repair process [1]. During this time, macrophages polarize towards distinct phenotypes in response to environmental cues to support the multiple
events occurring during wound repair [21]. In vitro exposure to interferon gamma (IFN-γ) and lipopolysaccharide (LPS) polarizes macrophages towards a classically activated M1
phenotype marked by the release of catabolic, pro-inflammatory cytokines, such as interleukin (IL)-1β, IL-6 and tumor necrosis factor-α (TNF-α) [18]. The M1 phenotype triggers proinflammatory
responses required to kill intracellular pathogens [10]. In contrast, macrophages are polarized to an alternatively activated M2 phenotype following IL-4, IL-10, or IL-13 stimulation. M2
macrophages release limited levels of pro-inflammatory factors; rather they secrete high levels of anti-inflammatory molecules including IL-1 receptor antagonist (IL-1RA) and IL-10 [18]. During
inflammation, M2 macrophages serve to protect against tissue damage [13]. Most monocytotropic viral infections, such as those caused by human immunodeficiency virus (HIV), respiratory syncytial
virus (RSV), severe acute respiratory syndrome virus (SARS-CoV) and influenza A virus (IAV), may affect macrophage polarization and thereby potentiate immunosuppression and/or immunopathology, which are generally associated with viral
persistence and co-infections by pathogens of other phyla [2, 19, 34]. The consequence of viral infection on
macrophage polarization has been directly demonstrated in HIV and RSV infections, and is associated with infections caused by human herpes viruses, IAV, SARS-CoV and other viruses [27].The purpose of the present study was to investigate the consequence of PRRSV replication on porcine alveolar macrophage (PAM) polarization. For this, we established a macrophage polarization model using primary PAMs stimulated with
LPS and IFN-γ or IL-4 to induce M1 or M2 polarization, respectively. M1 polarization was identified by the expression of IL-6, IL-12, TNF-α and other pro-inflammatory cytokines, whereas M2 polarization was characterized by IL-10 and
other anti-inflammatory molecules. Notably, we found that M1 polarization and pro-inflammatory cytokine expression significantly inhibited PRRSV replication, which was not observed in M2 cells. Moreover, PRRSV infection can
effectively inhibit the release of interferons in PAMs and preferentially skew polarization to the M2 phenotype.
MATERIALS AND METHODS
Virus and cells
MARC-145 cells at passage 5, the highly pathogenic PRRSV (HP-PRRSV) isolate HuN4 (GenBank Accession No. EF635006), and the classic PRRSV isolate CH-1a (GenBank Accession No. AY032626) were kindly provided by the PRRS (porcine
reproductive and respiratory syndrome) research group of the National Key Laboratory of Veterinary Biotechnology (Harbin Veterinary Research Institute, Harbin, China). The PRRSVCH-1a strain is the first PRRSV isolate reported in
China and belongs to the North American subtype, which displays relatively low pathogenicity in experimentally infected pigs. All viruses were used at a multiplicity of infection (MOI) that resulted in a 50% infection rate in PAM
or MARC-145 cells at 10 hr postinoculation.PAMs were isolated from 4–6-week-old conventional pigs from a farm serologically free of PRRSV, porcine circovirus 2 (PCV2), classical swine fever virus (CSFV), pseudorabies virus (PRV), Haemophilus parasuis and
Mycoplasma hyopneumoniae by using a lung lavage technique as previously described [33] with minor modifications. Briefly, piglet lungs were washed five times with PBS and
the fluid was centrifuged at 1,000 × g at 4°C for 10 min. The cell pellets were then resuspended, and mixed with 20 ml of RPMI-1640 medium (Gibco, Invitrogen Corp., Carlsbad, CA, U.S.A.) containing 10% fetal
bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin in a humidified 5% CO2 atmosphere at 37°C. PAMs were cultivated for 24 hr before infection and attachment
experiments. MARC-145 cells were maintained in minimal essential medium supplemented with 5% fetal bovine serum, 2 mM L-glutamine and antibiotics in a humidified 5% CO2 atmosphere at 37°C. Cells were grown to 90%
confluence in sterile cell culture flasks and gently detached using a scraper (Fisher Scientific, Pittsburgh, PA, U.S.A.).For polarization experiments, cells were plated in triplicate at a density of 1.5 × 106 cells/well in Costar 12-well plates (Corning Inc., Ithaca, NY, U.S.A.) and cultured for 1 hr to enable attachment. To generate M1
PAMs, cells were treated with LPS (R&D Systems, Minneapolis, MN, U.S.A.) and IFN-γ (R&D Systems) at various concentration combinations (10 ng/ml + 10
ng/ml, 100 ng/ml + 50 ng/ml or 1,000 ng/ml + 100 ng/ml,
respectively) for 6, 12, 24, 30, 36 and 48 hr. Alternatively, PAMs were treated with IL-4 (R&D Systems) at increasing concentrations (10, 50 or 100 ng/ml) for 12, 24, 36 and 48 hr to induce M2
polarization. Control cells were grown under identical conditions, but not exposed to LPS/IFN-γ or IL-4.
Macrophage PRRSV infection
Control, M1 and M2 PAMs were infected with HP-PRRSV or CH-1a at a multiplicity of infection (MOI) of 0.1. Multiple aliquots of culture supernatants were collected at 6, 12, 24, 36 and 48 hr post-infection (hpi) and stored at
−20°C to assess viral titers. At the end of each infection experiment, supernatants were thawed and analyzed for viral content by measuring the levels of virion-associated reverse transcriptase (RT) activity and PRRSV nucleocapsid
(N) protein expression. All experiments were performed in triplicate and repeated at least three times.
Indirect immunofluorescence assay (IFA)
PAMs were fixed with cold methanol-acetone (3:7) for 20 min at −20°C, washed three times with phosphate buffered saline (PBS) and then blocked with 5% BSA for 30 min at 37°C. The fixed cells were incubated with goat anti-human
polyclonal macrophage 387 (Mac387) antibody (1:100, Dako, Copenhagen, Denmark) or anti-PRRSV N protein mouse monoclonal antibody SDOW17 (1:100, RTI, LLC, Brookings, SD, U.S.A.) for 1 hr at 37°C. After washing three times, the
cells were stained with fluorescein isothiocyanate (FITC)-conjugated rabbit anti-goat IgG (1:100; Jackson ImmunoResearch, West Grove, PA, U.S.A.) or rabbit anti-mouse IgG (1:100; Jackson ImmunoResearch), respectively, for 1 hr at
37°C. Nuclei were then stained with 4’,6-diamidino-2-phenylindole (DAPI) for 15 min. Immunostaining was visualized by fluorescence microscopy.
Western blot
Polarized or control PAMs were infected with PRRSV at an MOI of 0.1. At selected time points, cells were collected and lysed in RIPA lysis buffer (Beyotime Co., Shanghai, China), supplemented with protease and phosphatase
inhibitors, and centrifuged at 12,000 ×g for 10 min. The protein concentration was then determined by using a bicinchoninic acid assay (BCA) kit (Thermo Scientific, Waltham, MA, U.S.A.). Equal amounts of each
sample were separated by SDS-PAGE and transferred to polyvinyl difluoride (PVDF) membranes (Millipore, Bedford, MA, U.S.A.). After blocking with 5% skim milk in PBS containing 0.1% Tween-20, the membranes were incubated with
anti-PRRSV N protein mouse monoclonal antibody SDOW17 (1:10,000, RTI) for 1 hr at 37°C. Subsequently, the membranes were incubated with FITC-conjugated goat-anti mouse secondary antibody (1:10,000, Imgenex Corp., San Diego, CA,
U.S.A.) at room temperature for 1 hr. After washing three times in TBST, membranes were visualized using the Odyssey Infrared Imaging System (LI-COR, Lincoln, NE, U.S.A.).
RNA extraction and real-time PCR
Total RNA was extracted from cells with TRIzol (Invitrogen, Grand Island, NY, U.S.A.) according to the manufacturer’s instructions. Reverse transcription was performed using M-MLV reverse transcriptase (Promega, Madison, WI,
U.S.A.) with the oligo (dT) 18 primer. Real-time PCR was performed using SYBR Premix Ex Taq (Takara, Dalian, China) and a ViiA 7 real-time PCR system (Applied Biosystems, Foster City, CA, U.S.A.). For quantitative analysis of
PRRSV in tissues, quantitative PCR (qPCR) was performed as previously described [29]. Relative gene expression was evaluated using the 2−ΔΔCt method [20]. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) served as an endogenous control. The specific primers used are listed in Table 1.
Table 1.
Quantitative RT-PCR primers
Gene
Direction
Sequence (5′–3′)
Il1b
Forward
TCTGCCCTGTACCCCAACTG
Reverse
CCCAGGAAGACGGGCTTT
Il6
Forward
TGGATAAGCTGCAGTCACAG
Reverse
ATTATCCGAATGGCCCTCAG
Tnf
Forward
CCCCCAGAAGGAAGAGTTTC
Reverse
CGGGCTTATCTGAGGTTTGA
Il12b
Forward
AGCAGAGGCTCCACTGACCCC
Reverse
GCAGGCACTGCCCTCCTGAC
Arg1
Forward
AATCCATCGGGATCATCGG
Reverse
AGTGTCATTAGGGACATCAG
Il10
Forward
GAACAGCTGCATCCACTTC
Reverse
TAACCCTTAAAGTCCTCCAGC
Pparg
Forward
TTCTCCAGCATTTCCACTCC
Reverse
AGTTGGAAGGCTCTTCGTGA
Chil3 (Ym-1)
Forward
TCAGGGCCATCTCATCTAAA
Reverse
TGATTTGACTGTGTTAGGGC
Ifna2
Forward
CTGCTGCCTGGAATGAGAGCC
Reverse
TGACACAGGCTTCCAGGTCCC
Hmox1 (iNos)
Forward
GGCTGAGAATGCCGAGTT
Reverse
ATGTAGCGGGTGTAGGCGTGGG
Gapdh
Forward
CCTTCCGTGTCCCTACTGCCAAC
Reverse
GACGCCTGCTTCACCACCTTCT
Flow cytometry analysis
Flow cytometry analysis was performed on an Accuri C6 flow cytometer (Becton-Dickinson, Mountain View, CA), and the data were analyzed using Expo 32 software (Becton-Dickinson). Flow cytometry antibodies included FITC-conjugated
mouse anti-pig macrophage monoclonal antibody (MAb) clone BA4D5 (AbD Serotec, Kidlington, U.K.), FITC-conjugated mouse anti-TLR4 (Abcam, Cambridge, U.K.) and APC-conjugated anti-arginase 1 (R&D Systems).
Nitrite determination by griess assay
The nitrite concentration in the culture medium was measured as an indicator of NO production using the Griess reaction. The supernatant from each well (50 µl) was transferred to a fresh 96-well plate, and 25
µl of 1% sulfanilamide with 25 µl of 0.1% naphthyl ethylenediamine in 5% HCl was added. When combined, these compounds (known as Griess reagent) form a violet color in the presence of nitrite.
After 10 min of incubation at room temperature, the absorbance of each well was measured at 540 nm. The nitrite concentration was calculated based on the standard reference curve of known concentrations of sodium nitrite ranging
from 0 to 100 mM.
Arginase assay
Arginase activity assays were performed as previously described [17]. Briefly, cells were lysed with 0.1% Triton X-100. Tris-HCl and MnCl2 were added to yield final concentrations
of 12.5 and 1 mM, respectively. Arginase was activated by heating for 10 min at 56°C, and the L-arginine substrate was added to a 250 mM final concentration. Reactions were incubated at 37°C for 30 min and stopped by addition of
H2SO4/H3PO4. After addition of α-isonitrosopropiophenone and heating for 30 min at 95°C, urea production was measured by the absorbance at 540 nm and normalized to total protein
content.
Viral titers
MARC-145 cells (10,000/well) were seeded into 96-well plates the day before infection. The HP-PRRSV strain was serially diluted 10-fold in medium, and 100 µl of each dilution was added into six wells. The CPE
(cytopathic effect) was monitored over 4 days using an inverted microscope. The number of infected cells was recorded, and the 50% tissue culture infective dose (TCID50) was determined by the Reed-Muench method.
Scanning electron microscopy
Scanning electron microscopy was used for high-magnification confirmation of macrophage morphology after stimulation with IFN-γ/LPS or IL-4. After 24 hr of stimulation at 37°C, cells were fixed with 2.5% electron microscopy-grade
glutaraldehyde and 1% OsO4, dehydrated in a graded ethanol series and embedded in isoamyl acetate. The samples were then dried to a critical point, mounted on aluminum stubs and shadowed with gold. A scanning electron
microscope (S-3400N, Hitachi, Tokyo, Japan) at 20 kV was used for visualization.
Confocal microscopy
Macrophage morphology was assessed by confocal microscopy after staining with calcein-AM (Sigma, St. Louis, MO, U.S.A.). After 24 hr of stimulation at 37°C, PAMs were labeled with calcein-AM (2.5 µM; Calbiochem)
for 60 min at 37°C, fixed with 80% methanol (5 min, 4°C) and spun down onto glass slides using a cytospin. PAM nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI) (Sigma) prior to imaging with a Leica TCS SP5 confocal
scanning-laser microscope.
Statistical analysis
All experiments were performed with at least three independent replicates. Data were analyzed with SPSS 16.0 and GraphPad Prism software (version 5.0) by Student’s t-test and one-way ANOVA.
P<0.05 was considered statistically significant.
RESULTS
Polarized cell morphology
Before investigating the effect of PAM polarization on PRRSV replication, the purity of our macrophage cultures was assessed by indirect immunofluorescence assay (IFA) and flow cytometry with anti-MAC387 antibody and anti-CD68
antibodies, respectively. As expected, green cytoplasmic staining was observed in a majority (>95%) of the cells. This finding was confirmed by flow cytometry, which showed that >90% of the cells were CD68-positive. This
result demonstrated that our culture consisted almost entirely of PAMs (data not shown).During our analyses, we noticed that cell morphology differed between the treated and control (M0) PAMs after 48 hr of stimulation. Interestingly, IFN-γ/LPS-treated M1 PAMs exhibited an elongated shape with a smaller nucleus in
comparison to control and M2 macrophages (Fig. 1A). Scanning electron microscopy showed IFN-γ/LPS- and IL-4-treated PAMs displayed numerous filopodia in comparison with M0 PAMs (Fig. 1B).
Fig. 1.
Analysis of macrophage morphology upon different activation methods. PAMs were incubated for 24 hr in RPMI medium in the presence of IFN-γ/LPS or IL-4. Cells were then fixed and labeled using calcein-AM (green). Nuclei were
detected with DAPI (blue). (A) The morphology of (M1) IFN-γ/LPS- and (M2) IL-4-treated PAMs was examined by confocal microscopy. (B) Scanning electron microscopy was used to visualize macrophage morphology at a higher
magnification. M0-type PAM is non-polarized control cells.
Analysis of macrophage morphology upon different activation methods. PAMs were incubated for 24 hr in RPMI medium in the presence of IFN-γ/LPS or IL-4. Cells were then fixed and labeled using calcein-AM (green). Nuclei were
detected with DAPI (blue). (A) The morphology of (M1) IFN-γ/LPS- and (M2) IL-4-treated PAMs was examined by confocal microscopy. (B) Scanning electron microscopy was used to visualize macrophage morphology at a higher
magnification. M0-type PAM is non-polarized control cells.
Optimization of the macrophage polarization procedure
To determine the optimal concentration and incubation time for LPS and IFN-γ co-treatment to induce M1 polarization, we used three combinations of LPS/IFN-γ at various concentrations (10 + 10, 100 + 50 and 1,000 + 100
ng/ml) and analyzed M1 marker expression at 6, 12, 24, 30, 36 and 48 hr post-stimulation. This experiment revealed that the mRNA expression of prototypical M1 markers including TNF-α
(Tnf), IL-1β (Il1b), IL-6 (Il6) and IL-12 (Il12b) started to increase significantly at 6 hr after stimulation. Individually, the TNF-α level peaked at 6 hr
followed by a rapid decline, whereas IL-1β and IL-6 peaked at 24 hr and then gradually decreased, and IL-12 peaked at 12 hr and remained upregulated throughout the analyzed time period (Fig.
2A). Based on the results shown in Fig. 2A, we decided to use a co-treatment consisting of 100 ng/ml LPS and 50
ng/ml IFN-γ for 24 hr to induce M1 polarization in PAMs. Similarly, to determine the optimal stimulation for M2 PAMs, we used test concentrations of 10, 50 or 100
ng/ml for IL-4 with incubation periods of 6, 12, 24, 36 or 48 hr (Fig. 2B) and found that IL-4 treatment at 50 ng/ml
for 24 hr caused the most robust M2 polarization.
Fig. 2.
qRT-PCR analysis to determine optimal stimulation procedure for macrophage polarization. mRNA levels of genes of M1- and M2-type AM were monitored by qRT-PCR analysis following treatment with various concentrations of
LPS/IFN-γ or IL-4, respectively. After 12, 24, 36 and 48 hr of incubation, (A) shows the expression of M1-type macrophage polarization markers, such as IL-1β, IL-12, IL-6. (B) shows the expression of M2-type macrophage
polarization markers, such as Arg1, IL-10, Pparg and Chil3. Data represent the mean ± standard error of the mean (SEM) of at least four independent experiments.
qRT-PCR analysis to determine optimal stimulation procedure for macrophage polarization. mRNA levels of genes of M1- and M2-type AM were monitored by qRT-PCR analysis following treatment with various concentrations of
LPS/IFN-γ or IL-4, respectively. After 12, 24, 36 and 48 hr of incubation, (A) shows the expression of M1-type macrophage polarization markers, such as IL-1β, IL-12, IL-6. (B) shows the expression of M2-type macrophage
polarization markers, such as Arg1, IL-10, Pparg and Chil3. Data represent the mean ± standard error of the mean (SEM) of at least four independent experiments.
Changes in the expression of M1 and M2 genes in stimulated PAMs
To confirm the efficacy of our selected treatments for inducing M1 and M2 polarization, we examined the expression of other important M1 and M2 biomarkers by semi-quantitative PCR. Notably, we observed that IL-1β, TNF-α, IL-6,
IL-12, IL-23, CCL2 and CXCL10 expression was significantly higher in LPS/IFN-γ-treated M1 macrophages than in control and IL4-stimulated counterparts (Fig. 3A), whereas Arg-1, TGF-β, IL-10, Ym-1, PPAR-γ and STAT6 expression was markedly higher in IL-4-simulated M2 PAMs (Fig. 3B).
Fig. 3.
M1 and M2 marker expression in PAMs after treatment with LPS/IFN-γ or IL-4 for 24 hr. (A, B) M1 (A) and M2 (B) marker mRNA expression in differently activated PAMs was analyzed by semi-quantitative PCR. (C) NO production
and arginase activity were measured in differently activated PAMs. (D) Western blot analysis of M2 marker protein expression following PAM polarization at 24 hr. (E) The ratio of cells expressing TLR4 (a marker of M1-type
macrophage) and Arg-1 (a marker of M2-type macrophage) was monitored by flow cytometry 24 hr post-stimulation. Samples were analyzed in triplicate. Data represent the mean ± SEM from three independent experiments.
**P<0.01 and ***P<0.001.
M1 and M2 marker expression in PAMs after treatment with LPS/IFN-γ or IL-4 for 24 hr. (A, B) M1 (A) and M2 (B) marker mRNA expression in differently activated PAMs was analyzed by semi-quantitative PCR. (C) NO production
and arginase activity were measured in differently activated PAMs. (D) Western blot analysis of M2 marker protein expression following PAM polarization at 24 hr. (E) The ratio of cells expressing TLR4 (a marker of M1-type
macrophage) and Arg-1 (a marker of M2-type macrophage) was monitored by flow cytometry 24 hr post-stimulation. Samples were analyzed in triplicate. Data represent the mean ± SEM from three independent experiments.
**P<0.01 and ***P<0.001.Inducible nitric oxide synthase (iNOS) is an important factor expressed in M1 mouse macrophages that catalyzes the production of nitric oxide (NO) from L-arginine substrate. Interestingly, no significant changes in NO
concentrations were measured in the culture supernatants of M1, M2 and control macrophages (Fig. 3C). These data demonstrate that, in contrast to mouse macrophages, iNOS is not a valuable
indicator of M1 polarization in porcine macrophages, consistent with a previous study [15]. Moreover, M2 macrophages generally express high levels of arginase, an enzyme that catalyzes
arginine into urea and ornithine. Accordingly, we found markedly higher urea concentrations in the supernatant of IL-4-stimulated PAMs when compared to control and M1 samples (Fig.
3C).Furthermore, we found a significant increase in the M2 genes IL-10 and Arg-1 in M2-polarized macrophages as compared to M0 and M1 PAMs (Fig. 3D). Additionally, expression of M1 TLR4 and
M2 Arg-1 was notably higher LPS/IFN-γ- and IL-4-stimulated PAM, respectively, when compared to control cells (Fig. 3E). Collectively, these results indicate that treatment with LPS/IFN-γ
or IL-4 potently induces M1 or M2 polarization in PAMs, respectively.
M1 polarization inhibits HP-PRRSV replication
To investigate the effects of PAM polarization on HP-PRRSV replication, PAM cultures were treated with LPS/IFN-γ or IL-4 for 24 hr to induce macrophage polarization prior to infection with the HuN4-F5 strain of HP-PRRSV, which
was derived from the wild, highly virulent strain HuN4 by 5 passages in MAC145 cells or left untreated (controls). IFA assays, anti-nucleocapsid protein (N protein) western blotting, qRT-PCR and viral titer analysis
(TCID50) showed that viral replication in control PAM progressively increased, peaked at 36 hr and then decreased until 48 hr post-infection (Fig. 4). In contrast, HP-PRRSV replication was strongly inhibited in M1-type, but not M2-type PAMs (Fig. 4). Based on western blot analysis, the relative viral suppression in M1-type PAMs
ranged from 73% at 12 hr to 36% at 36 hr post-infection (Fig. 4A and 4B). Moreover, qRT-PCR (Fig. 4C) and TCID50 assays (Fig. 4D) also revealed a significant decrease in viral protein expression and infection rate in M1 macrophages when compared to M2 and control counterparts at 12, 24 and 36 hr postinfection.
When M1-type cells were infected 48 hr after polarization, no inhibitory effects on PRRSV replication were observed, in comparison to M0-type and M2-type PAMs.
Fig. 4.
PRRSV replication is suppressed in M1 PAMs. PAMs were activated with IFN-γ/LPS (M1) or IL4 (M2) or left untreated (M0) for 24 hr, and further incubated with the HuN4-F5 strain of HP-PRRSV at the indicated time points. (A-C)
Viral replication levels were determined by IFA, immunoblotting and qRT-PCR. (A) Cells were fixed and labeled using anti-N protein antibody (green). Nuclei were detected with DAPI (blue). Scale bar, 200 µm.
(B) The total cell lysates were analyzed by immunoblotting for viral N protein and β actin. The protein band densities from three independent experiments are shown. (C) The total RNA was purified from the cells. After DNA
synthesis, the RNA levels of PRRSV ORF7 were quantified by qRT-PCR. (D) The PRRSV infection rate of supernatants from M0-, M1- and M2-type PAMs was determined using TCID50 in MAC145 cells. Samples were analyzed in
triplicate, and data represent the mean ± SEM of three independent experiments. *P<0.05, **P<0.01.
PRRSV replication is suppressed in M1 PAMs. PAMs were activated with IFN-γ/LPS (M1) or IL4 (M2) or left untreated (M0) for 24 hr, and further incubated with the HuN4-F5 strain of HP-PRRSV at the indicated time points. (A-C)
Viral replication levels were determined by IFA, immunoblotting and qRT-PCR. (A) Cells were fixed and labeled using anti-N protein antibody (green). Nuclei were detected with DAPI (blue). Scale bar, 200 µm.
(B) The total cell lysates were analyzed by immunoblotting for viral N protein and β actin. The protein band densities from three independent experiments are shown. (C) The total RNA was purified from the cells. After DNA
synthesis, the RNA levels of PRRSV ORF7 were quantified by qRT-PCR. (D) The PRRSV infection rate of supernatants from M0-, M1- and M2-type PAMs was determined using TCID50 in MAC145 cells. Samples were analyzed in
triplicate, and data represent the mean ± SEM of three independent experiments. *P<0.05, **P<0.01.
M1 polarization also inhibits PRRSV CH-1a strain replication
Using PAMs polarized in vitro, we also tested whether the replication of different PRRSV strains, including the HuN4-F2 strain of HP-PRRSV (derived from a wild, highly virulent strain HuN4 by 2 passages in MAC145
cells) and CH-1a strain of PRRSV (representative classic strain), was altered in cells with different activation status. PRRSV infection was monitored with IFA using a monoclonal antibody directed against the PRRSV N protein.
Compared with untreated PAMs (M0-type), PAMs with LPS/IFN-γ stimulation (M1-type) showed a decreased cell population that was permissive to infection of both PRRSV strains. PAMs with IL-4 stimulation showed no significant change
in the population of permissive cells (Fig. 5A and 5B). In addition, to assess the replication abilities of different PRRSV strains in cells with different activation status, the RNA genome copy numbers for these two strains of PRRSV were determined using
RT-PCR at 12, 24, 36 and 48 hr after infection. The replication level of HuN4-F2 strains in M1-type PAMs was significantly lower than that in M0-type and M2-type PAMs at 12, 24 and 36 hr, but not 48 hr (Fig. 5C); and the replication level of Ch-1a strains in M1-type PAMs was significantly lower than that in M0-type and M2-type PAMs at 12 and 24 hr, but not 36 and 48 hr (Fig. 5D). In summary, M1 polarization with LPS/IFN-γ also inhibits the replication of other PRRSV strains, such as the HuN4-F2 and CH-1a strains.
Fig. 5.
Kinetics of inhibition of other PRRSV strains in M1-type PAMs. A–D: PAMs were activated with IFN-γ/LPS (M1) or IL4 (M2) or left untreated (M0) for 24 hr, and further incubated with the PRRSV strain HuN4-F2 strain at the
indicated time points. Cells infected with the HuN4-F2 strain (A) of HP-PRRSV or CH-1a strain (B) of PRRSV were fixed and labeled using anti-N protein antibody (green). Nuclei were detected with DAPI (blue). Scale bar, 200
µm. Total RNA was isolated from cells infected with the HuN4-F2 strain (C) of HP-PRRSV and CH-1a strain (D) of PRRSV. After DNA synthesis, the RNA levels of PRRSV ORF7 were quantified by qRT-PCR. Samples
were analyzed in triplicate, and data represent the mean ± SEM of three independent experiments. **P<0.01.
Kinetics of inhibition of other PRRSV strains in M1-type PAMs. A–D: PAMs were activated with IFN-γ/LPS (M1) or IL4 (M2) or left untreated (M0) for 24 hr, and further incubated with the PRRSV strain HuN4-F2 strain at the
indicated time points. Cells infected with the HuN4-F2 strain (A) of HP-PRRSV or CH-1a strain (B) of PRRSV were fixed and labeled using anti-N protein antibody (green). Nuclei were detected with DAPI (blue). Scale bar, 200
µm. Total RNA was isolated from cells infected with the HuN4-F2 strain (C) of HP-PRRSV and CH-1a strain (D) of PRRSV. After DNA synthesis, the RNA levels of PRRSV ORF7 were quantified by qRT-PCR. Samples
were analyzed in triplicate, and data represent the mean ± SEM of three independent experiments. **P<0.01.
DISCUSSION
Macrophages display remarkable plasticity and can change their physiology in response to environmental signals [11]. Porcine alveolar macrophages (PAMs) are important lung tissue-resident
professional phagocytes and antigen-presenting cells (APC) that play a central role in inflammation and host defense [23]. Therefore, it is necessary to understand the morphology, marker
expression and cytokine secretion that clearly define PAM subsets. Our data show the PAM activation (LPS/IFN-γ or IL-4 stimulation) elicits a changed phenotype, altered expression pattern of certain markers and different antiviral
regulation. This study should not only provide certain markers for determining the activation status of PAMs in vivo, but also contribute to understand antiviral immunity according to the activation status of
PAMs.Activation protocols have significant effects on macrophage morphology. Here, PAMs showed an elongated shape with a smaller nucleus after activation with LPS/IFN-γ, whereas activation by IL-4 appeared to result in more circular
PAMs. This is in line with reports showing that the morphology of human macrophages changes with different maturation and activation methods in vitro [31]. A previous study
showed that LPS/IFN-γ stimulation causes macrophages to stretch through cytoskeletal arrangements and modulates macrophage elasticity, which is a major determinant of innate macrophage functions such as phagocytosis [25]. These results suggest that LPS/IFN-γ increase phagocytosis through effects on macrophage elasticity (morphology).Our results showed significantly higher IL-1β, TNF-α, IL-6, IL-12, IL-23, CCL2 and CXCL10 production by PAMs activated with LPS/IFN-γ stimulation. In contrast to M1-type macrophages, M2-type PAMs were characterized by the
production of Arg-1, TGF-β, IL-10, Ym-1, PPAR-γ and STAT6. Overall, the specific production of these cytokines is consistent with reports for corresponding polarized murine macrophages. These data support the notion that PAMs are
highly heterogeneous. Marker expression and cytokine production of PAMs are highly dependent on activation protocols. However, differences between species should be considered, e.g., there are no homologs of Ym1 and Fizz1 in humans
[26]. A transcriptional analysis of PAMs polarized using LPS/IFN-γ or IL-4 stimulation needs to be performed to answer this question.In the present study, we demonstrated that HP-PRRSV replication was significantly impaired in M1 PAMs. Several studies have confirmed that humanimmunodeficiency virus (HIV)-1 infection is restricted through down-regulation of CD4
at the cell surface and up-regulation of the secretion of CCR5-binding chemokines (CCL3, CCL4 and CCL5) in M1-type macrophage [3]. PAMs are the primary cellular target for receptor-mediated
PRRSV infection via sialoadhesin (SN), heparan sulfate (HS) and CD163 [7]. Thus, we theorized that the observed effect on PRRSV replication in M1 macrophages results from the decreased
expression of viral receptors on the PAM surface. Although no significant change in HS expression was found between the two polarized subtypes compared with the control, SN and CD163 expression was markedly increased with the
expression of SN in M1 and M2 macrophages, respectively (data not shown), thereby demonstrating that the diminished HP-PRRSV replication in M1 PAMs is not associated with viral receptor expression. In addition, the important feature
of M1-type macrophages is that they activate host defense programs against invading pathogens, such as HIV-1, through up-regulation of several host restriction factors, e.g. APOBEC-3G and sterile alpha motif and HD domain (SAMHD)-1.
It has been reported that SAMHD-1 inhibits HP-PRRSV replication by interfering with the synthesis viral genome cRNA in MARC-145 cells [33]. However, when M1-type cells were infected 48 hr after
polarization in the present study, no inhibitory effects on PRRSV replication were observed. To some extent, the phenotype of polarized M1-M2 macrophages can be reversed in vitro and in vivo [12, 28]. Indeed, our unpublished data demonstrated that M0-/M1-type PAMs were re-polarized to the M2 type as a result of HP-PRRSV infection. These findings
strongly suggest that HP-PRRSV infection can modulate macrophage polarization and might be the reason why M1-type PAMs did not restrict PRRSV at 48 hr after infection.In conclusion, we established a PAM polarization model in vitro and confirmed similarities in cytokine expression as previously observed in mouse and human macrophages. Notably, we show that PRRSV replication is
significantly impaired by M1-polarized PAMs, albeit through an unclear mechanism. Nevertheless, continued understanding of the anti-viral effects of macrophage polarization will likely facilitate the development of novel
therapeutics and treatment strategies for infectious diseases.
Authors: Kylie A Alexander; Ming K Chang; Erin R Maylin; Thomas Kohler; Ralph Müller; Andy C Wu; Nico Van Rooijen; Matthew J Sweet; David A Hume; Liza J Raggatt; Allison R Pettit Journal: J Bone Miner Res Date: 2011-07 Impact factor: 6.741
Authors: Alessandra Saccani; Tiziana Schioppa; Chiara Porta; Subhra K Biswas; Manuela Nebuloni; Luca Vago; Barbara Bottazzi; Mario P Colombo; Alberto Mantovani; Antonio Sica Journal: Cancer Res Date: 2006-12-01 Impact factor: 12.701
Authors: Daphne Y S Vogel; Judith E Glim; Andrea W D Stavenuiter; Marjolein Breur; Priscilla Heijnen; Sandra Amor; Christine D Dijkstra; Robert H J Beelen Journal: Immunobiology Date: 2014-05-28 Impact factor: 3.144
Authors: Naimish R Patel; Medhavi Bole; Cheng Chen; Charles C Hardin; Alvin T Kho; Justin Mih; Linhong Deng; James Butler; Daniel Tschumperlin; Jeffrey J Fredberg; Ramaswamy Krishnan; Henry Koziel Journal: PLoS One Date: 2012-09-18 Impact factor: 3.240
Authors: Gordon D Brown; Graeme Meintjes; Jay K Kolls; Clive Gray; William Horsnell; Beatrice Achan; Gottfried Alber; Maria Aloisi; Darius Armstrong-James; Mathew Beale; Tihana Bicanic; John Black; Paul Bohjanen; Angela Botes; David R Boulware; Gordon Brown; Rubina Bunjun; William Carr; Arturo Casadevall; Christina Chang; Ernest Chivero; Craig Corcoran; Anna Cross; Halima Dawood; Jeremy Day; Flavia De Bernardis; Veronique De Jager; Louis De Repentigny; David Denning; Maria Eschke; Malcolm Finkelman; Nelesh Govender; Neil Gow; Lisa Graham; Ronaldo Gryschek; Kenneth Hammond-Aryee; Tom Harrison; Neil Heard; Melanie Hill; J Claire Hoving; Edward Janoff; Joseph Jarvis; Sekeleghe Kayuni; Karin King; Jay Kolls; Bart-Jan Kullberg; David G Lalloo; Emilio Letang; Stuart Levitz; Andrew Limper; Nicky Longley; Tendai Rodney Machiridza; Yesholata Mahabeer; Neil Martinsons; Susan Meiring; David Meya; Robert Miller; Sile Molloy; Lynn Morris; Liliane Mukaremera; Abdu K Musubire; Conrad Muzoora; Amy Nair; Justine Nakiwala Kimbowa; Mihai Netea; Kirsten Nielsen; Jennifer O'hern; Samuel Okurut; Arifa Parker; Tom Patterson; Grace Pennap; John Perfect; Chrisna Prinsloo; Joshua Rhein; Melissa A Rolfes; Catherine Samuel; Charlotte Schutz; James Scriven; Olihile M Sebolai; Katlego Sojane; Charlotte Sriruttan; David Stead; Annica Steyn; Narjis K Thawer; Friedrich Thienemann; Maximilian Von Hohenberg; Jo-marie Vreulink; Jeannette Wessels; Kathryn Wood; Yun-liang Yang Journal: Trends Microbiol Date: 2014-03 Impact factor: 17.079
Authors: Vijaykumar S Meli; Ryan P Donahue; Jarrett M Link; Jerry C Hu; Kyriacos A Athanasiou; Wendy F Liu Journal: Biomater Sci Date: 2021-11-23 Impact factor: 6.843
Authors: Georgia M Cook; Katherine Brown; Pengcheng Shang; Yanhua Li; Lior Soday; Adam M Dinan; Charlotte Tumescheit; A P Adrian Mockett; Ying Fang; Andrew E Firth; Ian Brierley Journal: Elife Date: 2022-02-28 Impact factor: 8.713
Authors: Jose María Sánchez-Carvajal; Inés Ruedas-Torres; Irene Magdalena Rodríguez-Gómez; Jaime Gómez-Laguna; Librado Carrasco; Francisco José Pallarés; Enric Mateu Journal: Vet Res Date: 2021-01-22 Impact factor: 3.683