Relationship between Factor V Leiden Gene Variant and Risk of Ischemic Stroke: A Case-Control Study.

BACKGROUND: Factor V Leiden is the most common genetic variation among the blood coagulation pathway which leads to prothrombotic state, therefore, is considered an important gene for understating the stroke mechanism. AIM: The aim of the present study is to determine the relationship between single nucleotide polymorphism at G1691A position of Factor V gene and risk of ischemic stroke (IS) in North Indian population.
MATERIALS AND METHODS: In a retrospective case-control study, 250 patients with IS and 250 age- and gender-matched controls were enrolled in the period of October 2012 to September 2014 from in- and out-patient department of Neurology, All India Institute of Medical Sciences, New Delhi, India. Deoxyribonucleic acid for each case and control was isolated from peripheral blood using phenol-chloroform extraction method. Polymerase chain reaction-restriction fragment length polymorphism method was used to determine the polymorphism. Data were analyzed using STATA Software Version 13.
RESULTS: The mean age of IS patient was 52.8 ± 12.5 years and in control group was 50.97 ± 12.7 years. Genotypic frequency distributions were in accordance with Hardy-Weinberg equilibrium in both cases and controls. As expected hypertension, diabetes, dyslipidemia, smoking, heavy alcohol intake, family history of stroke, and poor economic status were significantly associated with the risk of IS. Multivariate analysis revealed 5.17 times higher odds for developing the risk of large vessel subtype of IS in patients carrying Factor V Leiden G1691A gene variation as compared to control subjects (OR, 5.17; 95% CI, 1.32-20.3, P = 0.01).
CONCLUSION: The present study suggests that Factor V Leiden G1691A polymorphism may be significantly associated with the risk of large vessel subtype of IS. Large sample size studies using prospective cohort designs are required to corroborate the present findings.

INTRODUCTION

Stroke is the second most leading cause of death and is one of the main reasons for the majority of adult disability.[1] It is a multi-factorial complex neurological disorder for which several epidemiological modifiable and nonmodifiable risk factors have been discovered, but these risk factors do not explain the mechanism of stroke.[2] Epidemiological evidence supports the genetic predisposition of stroke. A number of candidate genes have been examined as potential risk factors which are linked to ischemic stroke (IS). Factor V is the most common prothrombotic studied gene linked with IS. It is observed in 1.2% of African Americans, 5.2% of Caucasian Americans and is least common among the Australians and East Asian population.[3] Factor V Leiden is known to have a prevalence of 8.3% in the IS patients in Indian population.[4]

Factor V G1691A polymorphism leads to arg506-to-gln substitution,[5] which is linked with an elevated risk of IS and venous thrombosis.[3] Factor V is the most prevalent genetic variation which leads to prothrombotic state, therefore, is considered an important gene for understanding the stroke mechanism. Several studies have shown that Factor V Leiden G1691A gene variations are linked with the increased risk of stroke. A meta-analysis also observed that Factor V Leiden is linked with IS mainly in patients with young adults those are identified with the prothrombotic state.[6] Recent advances in the field of molecular biology and epidemiological studies have suggested that it is essential to recognize the genetic and modifiable risk factors to determine the pathophysiology of stroke. Ethnic variability in the genetic association exists, which suggests differences in the genetic association among different populations. From India, very limited evidence exists regarding the association of Factor V polymorphism with the increased risk of stroke.[4] Therefore, the objective of this hospital based case–control study was to determine the relationship of polymorphism at G1691A location of Factor V gene with the risk of IS in North Indian population.

MATERIALS AND METHODS

Study participants

This hospital based case–control study was completed in the tertiary care hospital, All India Institute of Medical Sciences, New Delhi, India. The study protocol of this study was published in BMC Neurology.[7] Two hundred fifty cases and 250 age- and gender-matched control patients were enrolled in the present study. Young stroke was defined as patients aged between 18-45 years.[8] The methodology adopted in the study was same as published in the article by Kumar et al.[9]

The primers used for the amplification of Factor V Leiden G1691A gene were Forward 5’ CATGAGAGAACATCGCCTCTG 3’ and Reverse 5’GACCTAACATGTTCTAGCCAGAAG3’ at annealing temperature of 62°C. The amplified polymerase chain reaction (PCR) product size of 147 base pairs was digested using MnlI restriction enzyme and incubating at temperature 37°C for overnight. Digested PCR products were separated and analyzed in 2.5% agarose gel electrophoresis. The polymorphic 1691 A allele lacks the restriction site; hence, the 147 bp PCR product was not cleaved, however, G allele had restriction site which gave fragments of 147 and 85 bp after the digestion [Figure 1].

Figure 1

RFLP image of Factor V Leiden polymorphism. Loading order: M: 100 bp, Ladder Lane 3: G/A genotype (heterozygous genotype), Lane 1, 2, 4, 5, 6, 7, 8, 9, 10, 11, 12: G/G genotype (wild type)

Statistical analysis

Categorical variables were represented in number and percentage. Continuous variables were represented by mean and standard deviation. Differences of genotypic and allelic frequencies between cases and controls were compared using Chi-square test. Odds ratio (OR) and 95% confidence interval (CI) were calculated to determine the strength of association between Factor V Leiden G1691A gene variant and the probability of developing IS. Multivariate conditional logistic regression was applied to test the independent role of polymorphism at G1691A location of Factor V Leiden gene and probability of developing the risk of stroke. Statistical tests were considered statistically significant at P < 0.05. Data were analyzed using the statistical analysis software (StataCorp. 2013. Stata Statistical Software: Release 13. College Station, TX: StataCorp LP).

RESULTS

A total of 450 stroke cases were screened of which 250 IS subjects met the inclusion criteria and were considered in the study. A total of 393 individuals were screened for the control group, and 250 age- and sex-matched controls were found eligible for the study. The average age and standard deviation of IS patients was 52.8 ± 12.5 years and in control group was 50.9 ± 12.7 years. The characteristics of IS patients is given in Table 1. There was no statistical difference between the age of cases and controls. The analysis of comparison of risk factors and demographic variables between IS patients and controls are shown in Table 2. As expected prevalence of hypertension, diabetes, smoking, and dyslipidemia was found higher in cases than controls.

Table 1

Characteristics of ischemic stroke patients

Table 2

Demographic and risk factor variables for ischemic stroke patients and control subjects

Tables 3 and 4 show the distribution of the Factor V Leiden G1691A allele and genotype frequency distribution among patients and control subjects. Genotypic frequency distributions were in accordance with the Hardy–Weinberg equilibrium in both cases and controls. We did not observe significant association under the recessive model of inheritance. Multivariate conditional logistic regression analysis demonstrated no significant relationship of polymorphism at G1691A position of Factor V Leiden gene with the higher odds for developing IS under a dominant model [Table 4]. We did not observe any statistically significant association between Factor V gene polymorphism and the probability of developing IS. In the present study, only 2% of subjects were found to have the heterozygous genotype, and none were positive for mutant genotype, thus not providing enough power for the multivariate analysis. Analysis as per subtypes of stroke according to the Trial of ORG 10172 in Acute Stroke Treatment classification discerned a borderline significant relationship in large vessel disease (LVD) subtype of IS in unadjusted (OR, 2.91; 95% CI 0.86–9.75) and significant relationship in adjusted analysis (OR, 5.17; 95% CI 1.32–20.3). We further analyzed the family history of stroke versus Factor V Leiden gene polymorphism and found no significant association between the two (OR, 1.91; 95% CI, 0.41–8.84; P = 0.40). No significant association was also found between stroke in young and Factor V Leiden gene polymorphism (OR, 0.2; 95% CI, 0.02–1.64, P = 0.13).

Table 3

Genotype and allelic frequencies of Factor V Leiden G1691A gene polymorphism in ischemic stroke patients and controls

Table 4

Association between Factor V Leiden G1691A gene polymorphism and risk of ischemic stroke

DISCUSSION

The present hospital-based case–control study examined the relationship between Factor V Leiden G1691A gene variation and probability of developing IS in patients in North India.

There is conflicting evidence in the relationship between Factor V Leiden G1691A gene polymorphism and probability of developing IS. A study reported from North Indian population suggested that Factor V Leiden G1691A polymorphism is a susceptible candidate for the risk of IS, especially in prothrombotic predisposition.[4] In this study, the prevalence of Factor V heterozygous condition was observed to be 8.3% in the stroke patients and 0.8% in the control subjects, however, in this study, prevalence was 3.6% in the overall IS cases and 2% in the control subjects. In the subgroup analysis, higher prevalence (5.6%) of the heterozygous state of Factor V was observed in the large vessel subtype of stroke. Inadequate sample size may explain the variation in the distribution of Factor V heterozygous state in both the studies. A review article published by Kaul and Munshi also suggested the potential effect of Factor V Leiden gene polymorphism in causing the risk of developing IS.[10] A study reported from Iran did not observe any significant association between Factor V 1691 G > A polymorphism and risk of stroke. In this study, the prevalence of Factor V heterozygous genotype was 2.6% in cases and 1.3% in the control subjects.[11] Another study reported from Greece also failed to observe the statistically significant association between Factor V Leiden gene polymorphism and risk of IS.[12] A study published by Hamedani in 2013, failed to observe the evidence of an association between Factor V Leiden and either overall IS or the different subtypes of IS.[13]

Previous meta-analysis published by Kim et al. did not find any significant association between Factor V gene polymorphism and risk of young stroke.[14] The strength of association in this study was close to significance (OR 1.37, 95% CI 0.94–1.97). Another meta-analysis reported by Hamedani et al. in 2010 demonstrated a significant association of Factor V gene polymorphism and the probability of developing stroke only in selected studies in which patients were increased likelihood of prothrombotic involvement (OR 2.73, 95% CI: 1.98–3.75) with significant heterogeneity.[6] However, borderline significance was observed in “unselected” IS studies (OR, 1.40, 95% CI: 0.99–1.95). The findings of the present hospital based case–control study are consistent with the meta-analysis[6] which also failed to observe a significant association between Factor V Leiden gene polymorphism and risk of overall IS. In the subgroup analysis of the present study, an independent but less precise association was observed with LVD subtype (OR 5.17; 95% 1.32–20.3) and cardio embolic stroke (OR, 11.04; 95% CI: 1.52–79.9). Arterial thrombosis can be a source of emboli. The role of Factor V Leiden in arterial thrombosis is not clearly reported. Mandegar et al.[15] reported a case of extensive arterial thrombosis with Factor V Leiden mutation without any other coagulation deformity. Another author Ng et al.[16] reported the role of heterozygote status of Factor V Leiden mutation with recurrent arterial thromboembolism. Factor V Leiden gene variation may also accelerate the process of other prothrombotic conditions, such as high homocysteine levels, protein C and S deficiency.[17] A meta-analysis conducted by Kim et al.[14] also found a modest association between Factor V Leiden mutation and arterial ischemic event (OR, 1.21; 95% CI, 0.99–1.49). The findings of the present study provide preliminary evidence of association of Factor V gene polymorphism and risk of large vessel subtype of stroke in patients with stroke in North Indian population.

The study has several limitations. Low frequency of Factor V Leiden G1691A variant resulted in an underpowered estimation of results in the multivariate analysis. Lack of estimation of clotting factors such as prothrombin level association which can validate the findings, was lacking in our study. We did not perform the gene-gene interaction analysis. We could observe only heterozygous variant, therefore, results might not be valid for the homozygous variants. Survival bias may be important as the study was conducted in the tertiary care hospital. We could not perform the stratified analysis due to less frequency distribution of heterozygous in both cases and controls.

CONCLUSION

The current study provides preliminary evidence that variation in G1691A position of Factor V Leiden gene polymorphism is linked with the risk of LVD subtype of IS in North Indian population. Further community based large prospective cohort studies with adequate power are required to validate these findings. Coagulation parameters also need to be measured along with genotyping for the precise estimation of results.

Financial support and sponsorship

We thank the Indian Council of Medical Research, Government of India for providing us the funding for conducting this study.

Conflicts of interest

There are no conflicts of interest.