Huiru Zhang1, Xueqin Wang1, Ruifang Li1, Xincheng Sun2, Siwen Sun2, Qiang Li1, Chunping Xu2. 1. College of Bioengineering, Henan University of Technology, Zhengzhou, Henan, P. R. China. 2. College of Food and Biological Engineering, Zhengzhou University of Light Industry, Zhengzhou, Henan, P. R. China.
Abstract
BACKGROUND: Many exopolysaccharides from the endophytes in medicinal plants possess various potential bioactivities. MATERIALS AND METHODS: The endophytic fungus JY25 was isolated from the leave of the Chinese medicinal plant Gynostemma pentaphylla and identified as Chaetomium sp. by its phylogenetic and physiological analysis. One exopolysaccharide (EPS) fraction was isolated from the fermentation broth by ethanol precipitation and purified by gel filtration chromatography on Sepharose CL-6B. The molecular characteristics were examined by GC-MS, FT-IR, and multiangle laser light scattering (MALLS). RESULTS: The monosaccharide composition analysis indicated that the purified EPS was mainly composed of glucose, mannose, arabinose, and galactose with the molecular ratio of 78.29: 8.99: 8.64: 4.08. FT-IR spectral analysis of the purified EPS revealed prominent characteristic groups, such as carbonyl bond, pyranose ring, and so on. The weight-average molar mass and the polydispersity ratio of the EPS were revealed to be 1.961×104 g/mol and 1.838, respectively. Furthermore, thermo gravimetric analysis (TGA) indicated that the degradation temperature of the purified EPS was 305° C. The purified EPS from the endophytic fungus Chaetomium sp. displayed antioxidant and antiproliferative activities. CONCLUSION: The results demonstrated that the EPS could be used as a healthful food and material source in pharmaceutical industries. SUMMARY: An exopolysaccharides (EPS) with antioxidant and antiproliferative activities from an endophytic fungus Chaetomium sp. was reported. Abbreviations used: ANOVA: Analysis of variance; DPPH: 2,2-diphenyl-1-picrylhydrazyl; EPS: Exopolysaccharide; FT-IR: Fourier transform infrared spectroscopy; GC-MS: Gas chromatography-mass spectrometry; Mw: Mass weight; MALLS: Multiangle laser light scattering; SEC: Size Exclusion Chomatography; SPSS: Statistical Package of the Social Science; TGA: Thermo gravimetric analysis; TFA: Trifluoroacetic acid.
BACKGROUND: Many exopolysaccharides from the endophytes in medicinal plants possess various potential bioactivities. MATERIALS AND METHODS: The endophytic fungus JY25 was isolated from the leave of the Chinese medicinal plant Gynostemma pentaphylla and identified as Chaetomium sp. by its phylogenetic and physiological analysis. One exopolysaccharide (EPS) fraction was isolated from the fermentation broth by ethanol precipitation and purified by gel filtration chromatography on Sepharose CL-6B. The molecular characteristics were examined by GC-MS, FT-IR, and multiangle laser light scattering (MALLS). RESULTS: The monosaccharide composition analysis indicated that the purified EPS was mainly composed of glucose, mannose, arabinose, and galactose with the molecular ratio of 78.29: 8.99: 8.64: 4.08. FT-IR spectral analysis of the purified EPS revealed prominent characteristic groups, such as carbonyl bond, pyranose ring, and so on. The weight-average molar mass and the polydispersity ratio of the EPS were revealed to be 1.961×104 g/mol and 1.838, respectively. Furthermore, thermo gravimetric analysis (TGA) indicated that the degradation temperature of the purified EPS was 305° C. The purified EPS from the endophytic fungus Chaetomium sp. displayed antioxidant and antiproliferative activities. CONCLUSION: The results demonstrated that the EPS could be used as a healthful food and material source in pharmaceutical industries. SUMMARY: An exopolysaccharides (EPS) with antioxidant and antiproliferative activities from an endophytic fungus Chaetomium sp. was reported. Abbreviations used: ANOVA: Analysis of variance; DPPH: 2,2-diphenyl-1-picrylhydrazyl; EPS: Exopolysaccharide; FT-IR: Fourier transform infrared spectroscopy; GC-MS: Gas chromatography-mass spectrometry; Mw: Mass weight; MALLS: Multiangle laser light scattering; SEC: Size Exclusion Chomatography; SPSS: Statistical Package of the Social Science; TGA: Thermo gravimetric analysis; TFA: Trifluoroacetic acid.
Endophytes in medicinal plants are the important potential sources of variable bioactive metabolites, such as antimicrobial, antiviral, anticancer, and antioxidant compounds.[1] Endophyte is well known that it is easier and more economical to produce a valuable natural product from a microbial source, due to its fast growth at high cell density cultivation and the possibility of scale-up on an industrial level.[2] Hence, many researchers have been in search of endophytes and the prospect of using them as new sources of bioactive compounds for medicine and healthy food.[34] Bioactive compounds produced by endophytes, including exopolysaccharide (EPS) and other natural products, have the potential-contribution to human health.[56] EPS, especially produced by fungus, has been focused due to the fact that they not only have good rheological properties, but also possess some biological activities such as antitumor, antioxidant, anti-inflammation, immunostimulating, antianemics, and so on, which make them have potential applications in the fields of heath products and drugs.[7]Gynostemma pentaphyllum Makino, known as Jiaogulan, is a perennial liana plant and has been traditionally used in food, tea, and folk medicines in many east and southeast Asian countries due to its possible health properties, such as lowering cholesterol and high blood pressure, hypoglycemic, anti-inflammatory, and anticancer activities.[8910]With the increasing demand for G. pentaphyllum, there is an urgent need to find an alternative way of using the endophytic fungus to produce host's active constituents. However, the literature survey indicates that few reports are available about the endophytic fungus of G. pentaphyllum and their medicinal value. Therefore, in this paper, an endophytic fungus JY25 characterized as Chaetomium sp. was isolated from the leave of G. pentaphyllum. The EPS produced by the endophytic fungus was extracted from the fermentation broth, and its structural characterization and bioactivity were investigated. The EPS was found to have strong antioxidant properties and good antiproliferative activity against A 549 cells in a dose-dependent manner, with the promise as a useful healthy food and medicinal product.
MATERIALS AND METHODS
Isolation and identification of the endophytic fungus
G. pentaphyllum leaves were obtained from the experimental field of Xinyang Academy of Agricultural Sciences, Henan, China. The samples were stored at 4°C for further separation/isolation. The surface sterilization was performed according to the procedures of Schulz et al.[2] with some modifications. Briefly, the G. pentaphyllum leaves were washed in the running tap water, and then sterilized successively with 75% ethanol for 1 min and 5% sodium hypochlorite for 5 min. After being rinsed in the sterile water for three times, the leaves were segmented (1 cm length) and incubated on the PDA medium at 28 ± 1°C until the mycelia appeared around the segments. The PDA medium was prepared from 200 g washed and sliced potatoes, boiled in 500 mL filter-purified (milli-Q; Millipore, USA) water and strained through gauze. Agar (20 g) was melted in the solution, mixed with 0.5 L water and 20 g glucose before the medium was autoclaved. The mycelia were purified, transferred to another PDA medium, and incubated in the same condition. The procedure repeated until a pure culture was obtained.Fungal identification was carried out on the basis of microscopic morphology and molecular taxonomy. Total DNA of the endophytic fungus isolate was extracted from fungal mycelia grown in PDA using DNeasy Plant Mini Kit (QIAGEN GmbH; Hilden, Germany). Primers ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) were used to amplify the ITS1-5.8S-ITS2 ribosomal RNA gene region from total cellular DNA.[11] The thermal cycle program was as follows: 3 min at 95°C followed by 30 cycles of 50 s at 95°C, 40 s at 45°C, and 40 s at 72°C, with a final extension period of 10 min at 72°C. The amplified DNA was purified and directly subjected to sequencing reactions using the ITS5 and ITS4 primers. The ITS sequences were compared to rDNA-ITS gene sequences in the database using the Blast N program.
Fermentation and purification of EPS from the endophytic fungus
The activated strain was inoculated in a 500 mL Erlenmeyer flask containing a 250 mL PDA medium on a rotary shaker at 160 rpm, 28°C for 3 days, to prepare the seed culture. The fermentation was inoculated with 4% (v/v) of the seed culture and then cultivated in a 5-L stirred-bank (Infors, Switzerland) containing 3-L of the PDA medium for 9 days (fermentation condition: 25°C, aeration rate 2 vvm, agitation speed 160 rpm, and initial pH 5.0). The culture broth from the bioreactor was centrifuged at 9000g for 15 min, and the resulting supernatant was filtered through a membrane filter (0.45 μm, Millipore, USA). The resulting culture filtrate was then precipited with four times volume of absolute ethanol, stirred vigorously, and kept overnight at 4°C. The precipitates were collected by centrifugation and deproteinized using the Sevag reagent (1:4 n-butanol/chloroform, v/v). Upon protein and Sevag reagent removal by centrifugation, the aqueous phase was dialyzed in deionized water and lyophilized to yield the crude polysaccharide.The polysaccharides were re-dissolved in a 0.2 M NaCl buffer to a concentration of 40 mg/mL and subsequently 1 mL EPS solution was loaded onto a Sepharose CL-6B column (2.4 cm × 100 cm, Sigma Chemical Co., St Louis, MO), with an elution rate of 0.6 mL/min. Fractions (5.0 mL/tube) were collected by a fraction collector. The protein content was determined according to the Bradford method using bovine serum albumin as standard.[12] The total carbohydrate content in the EPS was determined by the phenol/sulfuric acid method, using D-glucose as standard.[13] The EPS protein content was monitored by measuring the absorbance at 280 nm, whereas the carbohydrate content was monitored at 490 nm. The peaks with the highest polysaccharide content were collected, dialyzed, and then freeze-dried for further analysis.
Monosaccharide composition analysis
The purified EPS (5 mg) was hydrolyzed with 2 mL of 2 M trifluoroacetic acid (TFA) at 110°C for 2 h for the identification and quantification of monosaccharides. The hydrolysate was repeatedly co-concentrated with methanol, reduced with NaBH4 for 30 min at 20°C, and acetylated with acetic anhydride and pyridine at 100°C for 20 min. The internal standard sugars were prepared and subjected to GC-MS analysis separately in the same way. The alditol acetates of EPS fraction were analyzed by GC-MS (Varian Co., Model: Star 3600 CX, Lexington, MA) fitted with a fused silica capillary column (Na form, 300 mm × 0.25 mm, Supelco Inc., Bellefonte, PA) and a flame ionization detector.
FT-IR spectroscopy
FT-IR spectroscopy measurements were recorded in a Bruker Tensor 27 Mattson Instrument. The freeze-dried purified EPS (1 mg) were grinded with 300 mg KBr powder, subsequently pressed into a pellet and detected within the frequency range 550–4000 cm–1. The spectra were corrected for wave number-dependent signal-detection efficiency of the setup using the white light spectrum of a temperature-calibrated tungsten band lamp.
SEC/MALLS analysis
The molecular weights of EPS were estimated by SEC coupled with a MALLS D awn DSP detector (Wyatt Technology, Santa Barbara, CA) and a refractive index (RI) detector (Optilab rEX, Wyatt Technology, Santa Barbara, CA). EPS samples were dissolved in a 0.1M PBS buffer (pH = 6.8) containing 0.04 % diaminotetraacetic acid-disodium salt (Na2EDTA) and 0.01 % sodium azide and filtered through 0.25 μm filter membranes (Millex HV type, Millipore Co., Bedford, USA) prior to injection into the SEC/MALLS system. The chromatographic system consisted of a degasser (Degasys, DG-1200, uniflow, HPLC Technology, Macclesfield, UK), a SSI 222D pump (Scientific Systems, State College, PA), a single-piston isocratic, a pulse-dampened HPLC pump (Model 590 Programmable Solvent Delivery Module, Waters Co., Milford, MA), an injection valve (Rheodyne, Inc., Cotati, CA) fitted with a 500 μL loop, and two SEC columns (Shodex OH Pack SB-803 and 805 HQ, JM Science Inc., Buffalo, NY) connected in series. The flow rate was 0.75 mL/min, and the injection volume and concentration was 100 μL and 2 mg/mL, respectively. During the calculation of molecular weights of each EPS, the value of dn/dc (specific refractive index increment) was selected from literature data, in which the estimated dn/dc was 0.14 mL/g.[14] Calculations of molecular weight and root mean square (RMS) radius of gyration for each EPS were performed using the Astra 4.72 software (Wyatt Technology, USA). The RMS radii of each polysaccharide were determined from the slope by extrapolation of the first-order Debye plot.[15]
Antioxidant activity assays
The antioxidant activity of EPS produced by Chaetomium sp. was evaluated by two techniques including OH (hydroxyl) radical and DPPH (1,1-diphenyl-2-picrylhydrazyl) radical scavenging activity according to the methods of Eloff et al.[16] and Wang et al., respectively.[17]Briefly, regarding the hydroxyl radical scavenging activity assay, the varying concentrations of polysaccharides (2–10 mg/mL, 2 mL) were incubated with a solution containing phenanthroline (7.5 mM, 1 mL), phosphate buffer (50 mM, pH 7.4, 1 mL), FeSO4 (3.25 mM, 1 mL), and H2O2 (3 %, 0.5 mL) at 37°C for 1 h. The resulting sample was filtered through a Whatman filter paper No. 2 (Whatman International Ltd, Maidstone, UK). The absorbance was measured at 510 nm using a UV-2550 spectrophotometer (Shimadzu, Kyoto, Japan). The scavenging activity was calculated using the following equation:OH radical scavenging rate (%) = (Asample – Ablank)/(Acontrol – Ablank) × 100%,where Asample, Acontrol, and Ablank were defined as absorbances of the sample, control (without EPS), and blank (without H2O2 and EPS), respectively.Regarding the DPPH radical scavenging activity assay, 2 mL of 0.1 g/L DPPH in 50 % ethanol was added to 2 mL of the EPS solution. The absorbance was measured at 517 nm after 20 min of incubation at 25°C. In addition, instead of DPPH, 50% ethanol was used for the blank, whereas distilled water was used for the control instead of sample. The scavenging activity of DPPH radicals by the sample was calculated according to the following equation:DPPH radical scavenging activity (%) = 1 – (Asample – Ablankl)/(Acontrol)× 100%,where Asample, Acontrol, and Ablank were defined as absorbances of the sample, blank (without DPPH), and control (without EPS), respectively.In both assays, the EPS samples were predissolved in water and tested at various concentrations in parallel with vitamin C (Vc) as an antioxidant reference (positive control).
Antiproliferation activity
A 549A cell line is widely used as a pulmonary epithelial cell model for drug metabolism in vitro.[18] For the antiproliferation effect study, humanlung carcinoma A549 cells were obtained from American Type Culture Collection and cultured in the RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS) in a humidified 5% CO2 atmosphere at 37°C.[19] The proliferation of A549 cells was determined using the colorimetric MTT assay described by Mosmann (1983).[20] Briefly, cells were seeded at a density of 3 × 104 cells/well in a 100 μL volume of the medium in 96-well plates and allowed to attach. After 24 h, the additional medium containing the EPS was added to the wells to achieve the final concentration from 0.075 to 5.0 mg/mL. Ten μL MTT (0.4 %) was added after 48 h. After incubated at 37°C for another 4 h, the supernatant was aspirated and then 150 μL DMSO was added to each well. Absorbance was measured at 490 nm by a 96 well microplate reader (Tecan, GENios ELIASA Co., Austria). All results in vitro were expressed as the inhibition rate of tumor cell proliferation as follows:Inhibition rate (%) = (1 – Asample/ Acontrol) ×100%, (1)where Asample and Acontrol were defined as absorbances of the sample and control (without extract), respectively. And IC50 was determined by nonlinear regression analysis using the Graph Pad Prisme statistics software package (Ver. 2.0; San Diego, CA).
Thermogravimetric analysis of EPS
Thermogravimetric analysis (TGA) of the polysaccharide was conducted in a TA Q5000IR TGA apparatus using the 15 mg EPS fraction of the test material. The TGA curve plots the TGA signal (converted to the percent weight change on the Y-axis) against the reference material temperature (on the X-axis).
Statistical analysis
The results were expressed as the mean value ± standard deviation (SD) from triplicates. The results were analyzed for statistical significance by the one-way analysis of variance (ANOVA) test using the Statistical Package of the Social Science (SPSS) version 11.0 (SPSS Inc., Chicago, IL).Group means were considered to be significantly different at P < 0.05, as determined by the technique of protective least-significant difference (LSD).
RESULTS AND DISCUSSION
Identification of the endophytic fungus JY25
After growth on nutrient agar at 37°C for 3 d, the colonies of endophytic fungus JY25 were opaque and circular and about 4-6 cm in diameter with an irregular margin and cream-colored. However, after 5 d, the colonies changed to nacarat, even to yellowish-brown color [Figure 1A]. Furthermore, the mycelial and conidial morphologies were observed on a light microscopy. The mycelia are transparent, thick, and septate, and the ascospore could be observed from the spherical perithecium [Figure 1B]. The ITS rDNA gene sequence of endophytic fungus JY25 was identified by the polymerase chain reaction, sequenced and compared to all sequences in GenBank. The ITS fragments of 599 bp were amplified and sequenced, and the GenBank accession number was JN180937.1. The nucleotide sequence was blasted in Gen bank (Megablast) and revealed the closest match to that of Chaetomium sp. with a homology of 89% [Figure 2]. Therefore, based on the combined analysis of the fungal morphological characters, the strain JY25 could be identified as Chaetomium sp. The strain was the first endophyte to have been reported from G. pentaphyllum and was kept in the Henan Province Microbiological Culture Collection Center (HPMCC no. 255534)
Figure 1
Colony morphology (A) and morphology of mycelial and asexual spore formation (B) of endophytic Chaetomium sp. JY25: (A) representative images were taken after 6 days’ cultivation; (B) representative images were taken at the magnification of 400-fold.
Figure 2
The phylogenetic dendrogram for Chaetomium sp. JY25 and related strains based on the ITS rDNA sequence. Numbers in parentheses are accession numbers of published sequences. Bootstrap values were based on 1000 replicates.
Colony morphology (A) and morphology of mycelial and asexual spore formation (B) of endophyticChaetomium sp. JY25: (A) representative images were taken after 6 days’ cultivation; (B) representative images were taken at the magnification of 400-fold.The phylogenetic dendrogram for Chaetomium sp. JY25 and related strains based on the ITS rDNA sequence. Numbers in parentheses are accession numbers of published sequences. Bootstrap values were based on 1000 replicates.
Purification and characterization of the EPS
The EPS (1.45 g/L) were obtained from the fermentation broth by the method of ethanol precipitation. In gel filtration chromatography of the culture filtrate on Sepharose CL-6B, only 1 fraction of EPS was coeluted as shown in Figure 3. Figure 3 also showed the presence of protein peaks. However, electrophoresis analysis would need to be conducted in order to ascertain whether the proteins are bound to the polysaccharide (forming protein–polysaccharide complexes) or just have similar molecular weight as compared to EPS (they are eluted at the same time) according to the different charges between polysaccharides and proteins. The detailed monosaccharide compositions from the carbohydrate fraction in the purified EPS could be worked out from trifluoroacetic acid hydrolysis and GC-MS analysis as illustrated in Table 1. Results indicated that the purified EPS was mainly composed of glucose, mannose, arabinose, and galactose with the molecular ratio of 78.29:8.99:8.64:4.08. The result showed that glucose was the major monosaccharide.
Figure 3
Elution profiles of the EPS in Sepharose CL-6B chromatography. Eluate was analyzed by measuring the absorbance at 490 nm for carbohydrate (○) and the absorbance at 280 nm for protein (•).
Table 1
Carbohydrate composition in the purified EPS produced from submerged culture of endophytic Chaetomium sp. JY25 in a stirred-tank reactor
Elution profiles of the EPS in Sepharose CL-6B chromatography. Eluate was analyzed by measuring the absorbance at 490 nm for carbohydrate (○) and the absorbance at 280 nm for protein (•).Carbohydrate composition in the purified EPS produced from submerged culture of endophyticChaetomium sp. JY25 in a stirred-tank reactorFT-IR has been a potent and very useful tool for observing structural and functional groups in polysaccharides. The FT-IR spectra of the EPS were shown in Figure 4. The strong and wide stretching peak at 3263.6 cm−1 was O-H stretching vibrations. C-H stretching vibration and bending vibration were at 2931.9 and 1390.3 cm−1, respectively. The peak at 1582.7 cm−1 which was attributed to the stretching vibration of the carbonyl bond (C = O). Two stretching peaks at 1145.0 and 1020.3 cm−1 indicated the presence of C-O bonds. Furthermore, the peaks at 879.4 and 612.9 cm−1 were assigned to the skeletal mode of pyranose ring.[21] The results showed the characteristic absorbance of polysaccharides.[22]
Figure 4
The FT-IR spectra of the purified EPS produced by the submerged culture of endophytic Chaetomium sp. JY25.
The FT-IR spectra of the purified EPS produced by the submerged culture of endophyticChaetomium sp. JY25.The molecular properties of EPS were determined using SEC/MALLS are summarized in Table 2. The average molar mass weight (Mw) of EPS was determined to be 1.961×104 g/mol. Polydispersity values (Mw/Mn), as a measure of the width of molecular mass distribution, are important due to the relevance and significant influence of molecular weight distribution on the functional properties of polysaccharides. The medium value (1.838) of the polydispersity ratio for the EPS fraction means that the EPS molecule exists dispersed in the aqueous solution forming the aggregates.[23] The RMS radii ranged from 44.8 to 48.2 nm with no clear trends.
Table 2
Relevant molecular parameters of EPS produced by the submerged culture of endophytic Chaetomium sp. JY25 in MALLS analysis.
Relevant molecular parameters of EPS produced by the submerged culture of endophyticChaetomium sp. JY25 in MALLS analysis.The decomposition behavior of the polysaccharide is important to ascertain the thermochemical stability.[24] Experimental results for the TGA analysis of purified EPS have been included in Figure 5. According to the TGA curve of EPS, the degradation temperature of EPS was determined to be 143.7°C. This finding suggested that the stability of the EPS fractions is compromised at temperatures above the observed degradation temperature. Furthermore, a significant mass loss was recorded in each fraction at temperatures around 305°C and gradually decreased to leave a final residue of ca. 19.2% of the original EPS mass. In any case, TGA confirmed that the EPS generally possessed a high thermal stability.
Figure 5
TGA thermogram of the purified EPS from endophytic Chaetomium sp. JY25.
TGA thermogram of the purified EPS from endophyticChaetomium sp. JY25.
Antioxidant properties analysis
Antioxidants are the substances that can scavenge free radicals and provide protection against diseases and prolong the shelf life of food.[25] Among various antioxidants, polysaccharides in general have strong antioxidant activities and can be explored as novel potential antioxidants.[17] In vitro antioxidant capacities of EPS from submerged culture of Chaetomium sp. were evaluated using hydroxyl and DPPH radical scavenging assays.Hydroxyl radical is the most reactive radical, which can react with most bio-macromolecules functioning in living cells and induce severe damage to adjacent biomolecules.[26] The results of hydroxyl radical scavenging activities summarized in Figure 6A showed that hydroxyl radical scavenging activities were improved at increasing concentrations of EPS. At a concentration of 10 mg/mL, EPS exhibited the antioxidant activity of a 100%, which is the same as the scavenging activity of vitamin C. This result indicated that the EPS had a strong hydroxyl radical scavenging activity, which was obviously higher than that of polysaccharides from endophyticPaenibacillus polymyxa EJS-3.[27] DPPH radical methods can also evaluate the free radical scavenging ability of natural compounds. In this experiment, scavenging rates of EPS depicted in Figure 6B proved that radical scavenging activity was also concentration dependent and reached a maximum of 36.6% at 10 mg/mL, which was in good agreement with hydroxyl radical scavenging properties though it was lower than that of vitamin C [Figure 6A]. The data implied that the EPS had certain scavenging activity for DPPH radical scavenging effect, which was higher than that of the EPS from the submerged culture of Chaetomium sp.[28] Leung et al.(2009) suggested that antioxidant activity of polysaccharides might be attributed to their hydroxyl groups and other functional groups, such as C=O and -O-, which can donate electrons to reduce the radicals to a more stable form or react with the free radicals to terminate the radical chain reaction.[29]
Figure 6
sp. JY25. The results represent mean ± S.D. (n = 3). OH (A) and DPPH (B) radical scavenging activity of EPS from endophytic Chaetomium sp. JY25.
sp. JY25. The results represent mean ± S.D. (n = 3). OH (A) and DPPH (B) radical scavenging activity of EPS from endophyticChaetomium sp. JY25.
Antiproliferative properties analysis
In this work, to evaluate the inhibition on the cancer cell proliferation, various concentrations of EPS from endophytic fungus JY25 (0.0075 mg/mL-5.0 mg/mL) was added to a culture medium of A549 cells. It shows that all extracts have the inhibitary effect on the A549 cell proliferation [Figure 7]. The EPS possessed good inhibitary effects and the effects were significantly dose-dependent. At 5.0 mg/mL and 48 h after medicating, the inhibition rate of A549 cell was 89.8%. The 50% inhibitory concentration (IC50) was calculated to be 0.282 mg/mL. The similar results were observed by Chen et al.,[6] who found that the EPS from endophyte Bacillus amyloliquefaciens sp. isolated from Ophiopogon japonicas displayed concentration-dependent inhibitory effects against the MC-4 and SGC-7901 cells, with an IC50 of 19.7 and 26.8 mg/mL, respectively. Liu et al.[27] also found EPS from endophyticP. polymyxa EJS-3 had the similar antiproliferative activity with the 55.4% inhibition rates against humangastric carcinomaBGC-823 cells at the concentration of 0.4 mg/mL.
Figure 7
Effect of concentration of purified EPS produced from the submerged culture of endophytic Chaetomium sp. JY25 on tumor A549 cells.
Effect of concentration of purified EPS produced from the submerged culture of endophyticChaetomium sp. JY25 on tumorA549 cells.
CONCLUSIONS
It was the first time that endophytic fungus Chaetomium sp. was isolated for EPS production from medicinal plant G. pentaphylla. The EPS with a yield of 1.45 g/L was obtained from culture filtrates of this fungus. Preliminary molecular characterization of the EPS was analyzed. Antioxidant and MTT assays in this study suggest that EPS from the endophytic fungus Chaetomium sp. could be explored as a valuable candidate for the discovery of a new drug or healthy food. Further works on other bioactivities of the EPS are in progress using more sensitive experimental modes in our laboratory.
Financial support and sponsorship
This work was supported by the National Science Foundation of China (Grant no. B060806)