Literature DB >> 28831084

Resistance mechanisms and fitness of Salmonella Typhimurium and Salmonella Enteritidis mutants evolved under selection with ciprofloxacin in vitro.

Chuan-Zhen Zhang1,2, Si-Qi Ren1,2, Man-Xia Chang1,2, Pin-Xian Chen1,2, Huan-Zhong Ding1,2, Hong-Xia Jiang3,4.   

Abstract

The aim of this study was to investigate the difference in resistance mechanisms and fitness of Salmonella Typhimurium (ST) and Salmonella Enteritidis (SE) mutants selected during the evolution of resistance under exposure to increasing ciprofloxacin concentrations in vitro. Mutations in quinolone target genes were screened by PCR. Phenotypic characterization included susceptibility testing by the broth dilution method, investigation of efflux activity and growth rate, and determination of the invasion of human intestinal epithelium cells in vitro. The two Salmonella serotypes exhibited differences in target gene mutations and efflux pump gene expression during the development of resistance. In the parental strains, ST had a competitive advantage over SE. During the development of resistance, initially, the SE strain was more competitive. However, once ciprofloxacin resistance was acquired, ST once again became the more competitive strain. In the absence of bile salts or at 0.1% bile, the growth rate of SE was initially greater than that of ST, but once ciprofloxacin resistance was acquired, ST had higher growth rates. ST strains showed decreased invasion of epithelial cells in 0.1% bile. These data indicate that ciprofloxacin-resistant ST strains are more competitive than ciprofloxacin-resistant SE strains.

Entities:  

Mesh:

Substances:

Year:  2017        PMID: 28831084      PMCID: PMC5567280          DOI: 10.1038/s41598-017-09151-y

Source DB:  PubMed          Journal:  Sci Rep        ISSN: 2045-2322            Impact factor:   4.379


Introduction

Salmonella exhibit high morbidity and mortality, and are important pathogens worldwide. Host susceptibility and the serovar of the Salmonella strain determine how the infection is manifested[1]. According to the World Health Organization, Salmonella Typhimurium and Salmonella Enteritidis are the most frequently isolated Salmonella serotypes from countries involved in the Global Foodborne Infections Network[2]. Fluoroquinolones (FQs) are the main drugs used for the treatment of salmonellosis. However, the emergence of FQ resistance has been reported in the past decade[3, 4]. Furthermore, recent reports have shown high isolation rates of FQ-resistant Salmonella strains from poultry samples[5]. FQ-resistance in Gram-negative bacteria is primarily due to the acquisition of mutations located in chromosomal genes encoding quinolone targets and, to a lesser extent, the overexpression of efflux pumps such as AcrAB-TolC or changes in outer membrane proteins (e.g., OmpF and OmpC)[6, 7]. Two enzymes are the main targets for the antibacterial activity of quinolones: DNA Gyrase (GyrA and GyrB) and topoisomerase IV (ParC and ParE). Amino acid substitutions at positions 83 and 87 of GyrA are the most frequently reported mutations in FQ-resistant isolates[8, 9]. Chromosomally mediated FQ resistance mutations have been reported to be associated with decreased fitness[10]. There is not always a link between resistance and fitness costs and, additionally, bacteria may reverse fitness costs by acquiring compensatory mutations. Moreover, fitness is an important parameter for evaluating the epidemiological features of a given microorganism; resistance mechanisms can have varied effects on the organism[11, 12], which affect its ability to survive in the presence of other bacterial populations once antibiotic pressure is removed[13]. Upon colonization in the intestine, virulent Salmonella strains localize to the apical epithelium and induce invasion-associated virulence mechanisms[14]. During the pathogenic process, Salmonella encounters bile, an antimicrobial, in the gastrointestinal tract. Once exposed to subinhibitory concentrations of bile, the expression of numerous genes related to the invasion of intestinal cells and resistance to bile change[15]. In addition, the acrAB and tolC genes, which encode the major multidrug AcrAB-TolC efflux system, also required for the bile resistance of Salmonella, are transcriptionally activated by bile[16]. We found that a significant percentage of FQ-resistant isolates from Salmonella Typhimurium simultaneously presented resistance to cephalosporins and other commonly used antibiotics in food producing animals between 2010 and 2015[17, 18]. When developing resistance, certain Salmonella serovars showed fitness benefits, while others showed a fitness cost; thus, there was a persistent distribution of a serovar. Salmonella Enteritidis and Typhimurium are the most common serotypes in Europe from patients (European Centre for Disease Prevention and Control, 2013), although there are rising reports of Salmonella Indiana being the most prevalent serotype in food producing animals in China besides Salmonella Typhimurium, rather than Salmonella Enteritidis[5, 18]. Thus, we hypothesized that FQ-resistant Salmonella Typhimurium and Indiana have fitness benefits that contribute to the persistence of these serovars. The main objective of this study was to investigate and compare differential fitness between a collection of Salmonella Typhimurium and Salmonella Enteritidis mutants selected in vitro. Fitness assessments included FQ resistance mechanisms, bacterial growth, and growth competition. Additionally, we assessed bacterial growth and invasion abilities on exposure to different concentrations of bile salts.

Results

Characteristics of quinolone resistance-determining region (QRDR) mutations in the two serotypes during selection for resistance to quinolones

The two Salmonella serotypes exhibited different target gene mutations during the development of resistance. Considering ST, mutants ST-M1 and ST-M2 had a reduced susceptibility to ciprofloxacin. The mutation G81D in GyrA was detected in ST-M2. When the ciprofloxacin concentration increased to 2 mg/L, mutant ST-M3 acquired high-level resistance to ciprofloxacin; an additional mutation in ParC (G78D) was detected, but this was subsequently restored with further increases in ciprofloxacin concentration, leading to a fourfold decrease in the ciprofloxacin MIC in the subsequent mutants (ST-M4, ST-M5, ST-M6). To determine the role of mutation ParC G78D in ciprofloxacin resistance, we examined the effect of complementation with the parental strain parC gene by determining antibiotic susceptibilities (data not shown). These experiments showed that the G78D mutation in ParC was responsible for increased resistance to fluoroquinolones, rather than nalidixic acid, which is in accordance with the results of a previous study[19]. SE mutant SE-M1 had reduced susceptibility to ciprofloxacin (MIC = 0.125 mg/L) relative to the parental strain that accompanied a S464F mutation in GyrB. No additional mutations were detected in the subsequent mutants (SE-M2, SE-M3, SE-M4, and SE-M5) that became ciprofloxacin-resistant. A mutant with high-level resistance, SE-M6, displayed additional mutations in GyrA (D87A) and ParE (V461G) (Table 1).
Table 1

Antimicrobial susceptibility and mutations in target genes of parental strains and their respective mutants.

strainCIP pressure (mg/L)MIC(mg/L)Amino acid substitutions
CIPENRLEVOFLNORNALGyrAGyrBParCParE
ST 0.03 0.03 0.03 0.06 0.06 8
ST-M10.1250.1250.060.1250.1250.1258
ST-M20.250.25111132G81D
ST-M32168321283232G81DG78D
ST-M4448881664G81D
ST-M5164848864G81D
ST-M6324881632128G81D
SE 0.03 0.03 0.06 0.06 0.06 8
SE-M10.1250.1250.1250.250.50.532S464F
SE-M20.250.250.250.251164S464F
SE-M3222228256S464F
SE-M44444816512S464F
SE-M516444816128S464F
SE-M63232323232128>512D87AS464FV461G

ST: Salmonella Typhimurium; SE: Salmonella Enteritidis.

M1, M2, M3, M4: serial selected mutants; -: no mutation.

CIP: ciprofloxacin; ENR: enofloxacin; LEV: levofloxacin; OFL: ofloxacin; NOR: norfloxacin; NAL: nalidixic acid; TET: tetracycline.

Antimicrobial susceptibility and mutations in target genes of parental strains and their respective mutants. ST: Salmonella Typhimurium; SE: Salmonella Enteritidis. M1, M2, M3, M4: serial selected mutants; -: no mutation. CIP: ciprofloxacin; ENR: enofloxacin; LEV: levofloxacin; OFL: ofloxacin; NOR: norfloxacin; NAL: nalidixic acid; TET: tetracycline.

Growth curves of mutants derived from SE or ST

ST mutants had a much longer lag phase than the parental strain; however, once mutants reached the stationary phase (~12 h), there were negligible differences between the mutants and the parental strain (Fig. 1a). SE mutants (SE-M1, SE-M2), which presented reduced susceptibility to ciprofloxacin, exhibited the same growth as the parental strain; however, the mutants (SE-M4, SE-M5, and SE-M6) that acquired resistance had longer lag phases than the parental strain and did not reach the same cell density in the stationary phase (Fig. 1b). SE-M6, which contained additional two mutations (in GyrA and ParE), grew better than the other mutants. The growth of mutant SE-M3, which exhibited intermediate resistance to ciprofloxacin (MIC = 2 mg/L), was greatly impaired, even from the initial phase, with much lower CFU counts than the other mutants. There were no significant differences between the growth rate of the two different serotype parental strains (ST and SE); however, there were differences in the growth rates of the mutants. The growth rate of SE mutant obtained under initial antibiotic pressure was significantly greater than that of ST mutant; however, the growth rates of ST mutants obtained under increased and sustained antibiotic pressure was significantly greater than that of SE mutants (Fig. 1c).
Figure 1

Bacterial growth curves of: (a) ST and its mutants; (b) SE and its mutants, and; (c) ST, SE and their corresponding mutants in antibiotic-free LB broth. Results are the mean of three independent experiments.

Bacterial growth curves of: (a) ST and its mutants; (b) SE and its mutants, and; (c) ST, SE and their corresponding mutants in antibiotic-free LB broth. Results are the mean of three independent experiments.

Expression of efflux-related genes

Mutants exhibiting reduced antibiotic susceptibility (ST-M1 and SE-M1), resistance (ST-M4 and SE-M4, ST-M5 and SE-M5, and ST-M6), and high-level resistance (SE-M6) were selected for analysis of acrA, acrB, tolC, ramA, marA, soxS, and ompF gene expression (Table 2). ST mutants had higher expression levels of efflux pump genes compared with the parental strain. However, the efflux pump genes were not activated in SE mutants compared with the parental strain. The expression levels of the positive transcriptional regulator ramA in ST mutants were much higher than in the SE mutants; meanwhile, there was decreased expression of marA and soxS in ST mutants compared with the parental ST. The expression of ompF was decreased in ST-M4 and ST-M5 compared with the parental ST.
Table 2

Mean (SD) values of RT-PCR analysis obtained in six independent experiments.

StrainGene expression values
acrA acrB tolC ramA marA soxS ompF
SE1111111
SE-M11.3(0.7)1.5(0.9)1.9(1.7)1.4(0.5)1.6(0.7)2.1(1.4)1.7(1.6)
SE-M41.1(0.6)1.2(0.5)1.4(1.1)1.5(1.8)1.5(1.3)−1.1(1.2)−1.4(0.3)
SE-M51.1(0.6)1.3(0.6)1.8(1.2)−1.1(0.4)2.1(1.4)1.3(0.6)1.6(1.4)
SE-M61.1(0.5)1.2(0.6)1.4(0.9)1.2(0.9)2(2.1)1.6(1.8)1.6(1.3)
ST1111111
ST-M1−1.7(0.3)−1.4(0.1)−1.3(0.2)−1.3(0.6)1.2(0.5)−1.1(0.2)3.1(2.6)
ST-M41.3(0.5)2.8(1.3)1(0.5)14.2(3.6)−1.7(0.2)−3.3(0.07)−5(0.2)
ST-M52.4(1.2)3.3(1.5)1.8(0.7)8.3(3.2)−2(0.1)−2.5(0.03)−1.3(0.8)
ST-M61.8(0.7)3.3(1.3)2.6(1.1)29.3(15.2)1.5(0.8)−1.4(0.1)1(0.5)
Mean (SD) values of RT-PCR analysis obtained in six independent experiments.

Growth competition assays by pyrosequencing

We assessed the competitive advantages and disadvantages of the parental strains (ST and SE) as well as three mutants (M2, M3, and M6), which contained various QRDR mutations. The ability to differentiate strains by bacterial culture on selective media is limited; thus, we developed four pyrosequencing assays to distinguish between the two serotype strains at the same ciprofloxacin concentrations based on single nucleotide variations in gyrA. For the two parental strains, the competition coefficient between ST and SE was 1.9; this indicates that ST had a competitive advantage. During the development of resistance, initially, the SE mutant was more competitive (the competition coefficient between ST-M2 and SE-M2 was 0.6). However, once ciprofloxacin resistance was acquired, the ST strain once again became the more competitive strain (the competition coefficient between ST-M3 and SE-M3 was 4.6). When the resistance increased to high levels, the ST strain remained the more competitive strain (the competition coefficient between ST-M6 and SE-M6 was 2.7) (Fig. 2).
Figure 2

In vitro bacterial competition assays. Competition coefficient values obtained from each independent experiment are plotted; a competition coefficient of 1 is noted by a broken horizontal line, and means are noted by a short continuous horizontal line.

In vitro bacterial competition assays. Competition coefficient values obtained from each independent experiment are plotted; a competition coefficient of 1 is noted by a broken horizontal line, and means are noted by a short continuous horizontal line. This result indicated that ciprofloxacin-resistant ST strains have competitive growth advantages over ciprofloxacin-resistant SE strains.

Bile tolerance

We measured bile tolerance by examining bacterial growth at various bile concentrations (Fig. 3). In the absence of bile salts, the two parental strains exhibited similar growth characteristics. During the development of resistance, SE initially exhibited higher growth rate than ST; however, at higher resistance levels, the growth rate of ST was greater than that of SE (Fig. 3a). In the presence of bile salts, the growth rate of both ST and SE was reduced. During the development of resistance, when the strains showed reduced susceptibility to ciprofloxacin, SE had higher growth rate than ST; however, the growth rate of ST became greater than that of SE following the acquisition of resistance to ciprofloxacin at the low bile salt concentration (0.1%) (Fig. 3b). However, SE had higher growth rate than ST throughout the growth at the high bile salt concentration (1%) (Fig. 3c).
Figure 3

Bile tolerance. The strains were grown in the presence of: (a) no bile, (b) 0.1% bile, and (c) 1% bile.

Bile tolerance. The strains were grown in the presence of: (a) no bile, (b) 0.1% bile, and (c) 1% bile.

Invasion ability of Salmonella strains

In some Salmonella serovars, acquisition of quinolone resistance has been related to decreased ability to invade eukaryotic cells[20, 21]. Furthermore, bile has been shown to impact the invasion process[22]. To determine if there were any differences in the invasion ability of the two serotypes and their respective mutants, we examined the ability of above strains exposed to different bile concentrations (0%, 0.1%, 1%) to invade INT-407 cells in vitro. Results are expressed as the percentage of the inoculum that effectively invaded the INT-407 cells. In absence of bile salts, the ST parental strain and mutants adhered to INT-407 cells significantly less than the SE parental strain and mutants, with the exception of the high-level ciprofloxacin resistant mutants ST-M6 and SE-M6, which had similar adherence (Fig. 4a). At the low bile salt (0.1%) concentration (Fig. 4b), the two parental strains and their respective reduced susceptibility mutants (ST-M2 and SE-M2) had similar adherence; meanwhile, the resistant and high-level resistant ST mutants had significantly lower adherence than the SE mutants. At the highest bile salt concentration (1%) (Fig. 4c), the parental strain ST and its reduced susceptibility mutant had higher adherence than the parental strain SE and its reduced susceptibility mutant; meanwhile, the resistant and high-level resistant mutants of both ST and SE had decreased adherence.
Figure 4

Ability of Salmonella treated at different concentrations of bile salts to invade INT-407 epithelial cells: (a) no bile, (b) 0.1% bile, (c) 1% bile. Results are the mean of three independent experiments ± standard error. Differences between groups were assessed using the one-way ANOVA test. *P < 0.05.

Ability of Salmonella treated at different concentrations of bile salts to invade INT-407 epithelial cells: (a) no bile, (b) 0.1% bile, (c) 1% bile. Results are the mean of three independent experiments ± standard error. Differences between groups were assessed using the one-way ANOVA test. *P < 0.05.

Discussion

In this study we observed differences in the evolution of resistance between two Salmonella serotypes under stepwise selection with increasing ciprofloxacin concentrations. For ST, the first GyrA mutation (G81D) was associated with a reduced susceptibility to ciprofloxacin. Mutations in GyrA residue 81 [glycine (Gly) to either cysteine (Cys) or histidine (His)] in Salmonella spp. have been associated with resistance to fluoroquinolones; however, alteration from Gly to aspartic acid (Asp) has only been reported in E. coli, where it is responsible for the development of quinolone resistance[23]. Subsequently, another mutation (G78D in ParC) occurred that led to high-level ciprofloxacin resistance (MIC = 16 mg/L). However, this mutation was lost, and subsequently high-level resistance was not retained even under higher ciprofloxacin pressure. The loss of the mutation presumably occurred when the mutant was passaged in ciprofloxacin-free LB broth. For SE, occurrence of the first mutation in GyrB (S464F) was accompanied by reduced susceptibility to ciprofloxacin. No additional mutations occurred; however, the strain became ciprofloxacin-resistant under increasing drug pressure. Under persistent high drug pressure, the strain evolved high-level ciprofloxacin resistance that was accompanied by additional mutations in GyrA and ParE. Substitutions in GyrB and ParE have been reported to be much less prevalent and to only make a minor contribution to resistance[24]. Different mutation patterns in quinolone target genes occurring in different Salmonella serotypes during the evolution of resistance were also found in our previous study[25]. In that study, first and subsequent mutations were detected in GyrA (D87G) and GyrB (E466D), respectively, which played a major role during the whole resistance development of SE; however, in ST, the first mutation was detected in GyrA (D87N) and an additional mutation in GyrB was only found in mutants with high-level resistance[25]. Both of these independent studies (the present and previous study[25]) demonstrated that mutations in GyrA played an important role in the evolution of resistance in ST; however, mutations in GyrB contributed more during evolved resistance of SE. The minor differences in the mutations that occurred in these two studies probably arose from: (i) the culture medium (LB medium in the present study vs. MH medium in the previous study); (ii) the selected ciprofloxacin pressure (starting from ciprofloxacin concentration equal to the MIC in the present study vs. starting from half of the ciprofloxacin MIC in the previous study); and (iii) that mutants were incubated in LB broth without ciprofloxacin in the present study, whereas in the previous study they were incubated in MH broth containing the MIC of ciprofloxacin before the next round of selection. Based on these outcomes, we speculate that in the development of ciprofloxacin resistance, chromosomal mutations of the target gene gyrA are the main contributor for ST; meanwhile, mutation in gyrB along with mutation in gyrA are presumably the main contributors to resistance in SE. The expression of AcrAB-TolC is a compensatory mechanism in the evolution of resistance. Several studies have reported that, in Salmonella, the first and primary step towards a resistance phenotype is the acquisition of mutations that increase efflux, mainly due to the overexpression of AcrAB. Mutations in the QRDRs represent the second step, along with other mutations that contribute to increased efflux activity[20, 26]. In the present study, overexpression of the major efflux pump AcrAB-TolC was detected in ST mutants. There was a reduction in ompF expression in resistant mutants (ST-M4 and ST-M5), which is known to confer low-level quinolone resistance[27]. However, there was no overexpression of AcrAB-TolC in the SE mutants. These findings are in accordance with previous study showing that: (i) in SE, target gene mutations in GyrA and GyrB are important in the development of ciprofloxacin resistance; and (ii) in ST, the AcrAB-TolC efflux pump had a crucial impact on the whole resistance-development process[25]. The difference in resistance mechanisms between the two Salmonella serotypes corresponded to different growth rates; mutations in GyrA and ParC in ST in the initial proliferation phase impaired growth, but were ultimately beneficial in the plateau phase where the mutant grew better than the parental strain. Mutations in target genes are beneficial to bacterial growth during resistance evolution. Baker et al. showed that double mutants in GyrA (position 83 or 87) and ParC (position 80) in Salmonella Typhi exhibited higher fitness than expected as a result of synergistic epistasis, conferring a measurable fitness advantage over strains without these mutations[28]. However, in the present study, the fitness cost produced by GyrB mutation was only partially compensated by additional mutations in GyrA and ParE in SE. Similarly, double mutants in GyrA (position 81) and ParC (position 78) did not exhibit higher fitness than the single ST GyrA mutant. We hypothesize that strong synergistic epistasis is greatly dependent on hot gene mutations, e.g. GyrA and ParC rather than GyrB, as well as hot mutation sites, e.g. GyrA-83/87 rather than GyrA-81, and ParC-80 rather than ParC-78. Furthermore, the mutant strains used in this study were not isogenic; it should be taken into consideration that other genetic changes in the mutants might produce the observed phenotypic differences. From the results of mutations detected in target genes, growth competition, and the expression of acrAB, we can speculate about the evolutionary process of acquisition of resistance by ST and SE while exposed to ciprofloxacin and the fitness of these organisms. In the early stage of resistance development, a first mutation occurred in a target gene in both of the strains which led to reduced susceptibility to ciprofloxacin but a difference in fitness: the mutation in ST caused a fitness cost, while the mutation in SE enhanced the fitness. Thus, the SE mutant had a competitive advantage. Once it acquired resistance, particularly high-level resistance, the additional mutation in ParC (G78D) gave ST a competitive advantage over SE. Furthermore, multiple mutations in target genes produced a burden, impairing the growth of SE. This may explain the prevalence of ST among food produced on animal farms where fluoroquinolones are extensively used. However, limitations of our experiments are that they were performed in laboratory (non-restricted) conditions. We must perform experiments in natural environments (low temperature, low water activity, inhibitory substances) or in warm-blooded hosts (nutrient restriction, possible pH effects, etc.), because mutations compensating for fitness cost in vitro are different to those in vivo [29]. Salmonella causes gastrointestinal infections and normally enters the intestinal tract after being consumed in contaminated foods. As bile is released into the digestive tract to aid in digestion of lipids, Salmonella is exposed to these stressful compounds. The AcrAB-TolC efflux pump is required for growth of Salmonella in the presence of bile; however, overexpression of efflux pumps is usually associated with decreased fitness[16]. This may account for the fact that the ciprofloxacin-susceptible strains were more resistant to bile salts than the ciprofloxacin-resistant strains, as well as the fact that the resistant ST strains had worse growth rates due to overexpression of efflux activity than the resistant SE strains when exposed to high bile salt concentration (1%). Studies conducted with SE and ST showed an association between resistance and reduced virulence in quinolone-resistant mutants[30, 31]. Consistent with these findings, our results show that the resistant mutants have a reduced ability to invade epithelial cells. Bile mediates the activation of acrAB and induces high levels of AcrAB-TolC production, which can lead to impaired virulence[21]. This may account for the reduced invasion ability seen following exposure to bile salts. In addition, bile also represses virulence genes in Salmonella. Salmonella grown in the presence of bile demonstrated a drastic repression of invasion genes; as suspected, this corresponded to a decrease in the ability to invade epithelial cells. It has been speculated that the ability of enteric bacteria to survive in the presence of large quantities of bile salts is directly related to their ability to establish invasive infections in the intestine[32]. Nonetheless, our results do not support this hypothesis, since resistant ST strains had higher growth but decreased invasion of epithelial cells at 0.1% bile. In conclusion, the two most commonly reported Salmonella serovars, SE and ST, have different resistance mechanisms during the evolution of resistance under drug pressure. This led to differences in growth rates. Ciprofloxacin-resistant ST strains were more competitive than ciprofloxacin-resistant SE strains; this could explain why ST is the predominant multidrug-resistant serovar.

Materials and Methods

Bacterial strains and selection of resistant mutants

ST and SE were isolated from the rectal swabs of two individual chickens. The strains were susceptible to quinolones (i.e., no mutations within QRDRs of the four target genes as determined by PCR) and commonly used drugs. These were used as the two parental strains. Strains were grown at 37 °C on LB agar plates. Ciprofloxacin (Fluka) was only present during selection, which started at 0.03 mg/L (equal to the MIC for ST and SE) and increased twofold to a maximum concentration of 32 mg/L. The mutants presented here were selected at 0.125, 0.25, 2, 4, 16, and 32 mg/L ciprofloxacin, and were named M1, M2, M3, M4, M5, and M6, respectively. The mutants from each procedure were passaged five times in LB broth without ciprofloxacin. All ST and SE mutants were grouped according to MICs as follows: reduced susceptibility (MIC = 0.5–2 mg/L), resistance (MIC = 4–8 mg/L) and high-level resistance (MIC ≥ 16 mg/L), according to CLSI guidelines. No live vertebrates were included in this study and all strains were manipulated in a biohazard containment 2 facility. All waste cultures were inactivated to prevent infection or release into the surrounding environment.

Antimicrobial susceptibility

MICs were determined in triplicate for each bacterial strain using broth microdilutions according to the CLSI reference methods. The following antimicrobials were tested: ciprofloxacin (CIP), nalidixic acid (NAL), enrofloxacin (ENR), levofloxacin (LEV), ofloxacin (OFL), and norfloxacin (NOR). Escherichia coli ATCC 25922 was used as the control strain.

Detection of mutations within QRDRs

Mutations acquired in the QRDR genes GyrA, GyrB, ParC, and ParE were detected by PCR[33]. All PCR products were directly sequenced, and the results were compared with the genome of Salmonella Typhimurium LT2 (Ref Seq: NC_003197.1).

Bacterial growth

Strains were incubated overnight in Luria-Bertani (LB) broth at 37 °C with shaking, and then diluted to OD600 = 0.1. This was diluted 1:500 in fresh LB broth and incubated with shaking (200 rpm). At 2-h intervals, samples were serially diluted and plated onto LB agar plates to estimate growth. The plates were incubated at 37 °C for 24 h before counting colonies. Three independent assays were performed for each strain, and the standard deviation was within 10%.

RNA extraction and real-time PCR

RNA extraction from exponential cultures of the two parental strains (ST and SE) and three mutants (M1, M4, and M5) was performed according to Fàbrega et al.[30]. The expression of acrA, acrB, tolC, ramA, marA, and soxS genes was analyzed by RT-PCR[34]. The 16S rRNA gene was used as an internal control for normalization, and the parental strains were used as references for their derived mutants. The 2−ΔΔCT method was used for relative gene expression calculations. Five independent assays were performed, and each RNA sample was tested in triplicate. The primers used are listed in Table 3.
Table 3

Primers used for real-time PCR.

GenePrimers (5′ to 3′)
Efflux and permeability components
acrA acrA-F CCCGGATCACACCTTATTGC
acrA-R CTGGCTTGCGACGATTTG
acrB acrB-F TTGCAGGGCGCGGTCAGAATAC
acrB-R TGCGGTGCCCAGCTCAACGAT
tolC tolC-F GTGACCGCCCGCAACAAC
tolC-R ATTCAGCGTCGGCAGGTGAC
ompF ompF-F GGGCGCGACTTACTACTTCAAC
ompF-R TCGTTTTCGTCCAGCAGGTT
Regulatory genes
soxS soxS-F AAATCGGGCTACTCCAAGTG
soxS-R CTACAGGCGGTGACGGTAAT
marA marA-F ATCCGCAGCCGTAAAATGAC
marA-R TGGTTCAGCGGCAGCATATA
ramA ramA-F CACGATTGTCGAGTGGATTG
ramA-R AAAATGCGCGTAAAGGTTTG
Reference gene
16S rRNA 16S-F GCGGCAGGCCTAACACAT
16S-R GCAAGAGGCCCGAACGTC
Primers used for real-time PCR. We tested growth competition between the two parental strains (i.e., ST vs. SE), as well as three pairs of mutants (i.e., ST-M2 vs. SE-M2, ST-M3 vs. SE-M3, and ST-M6 vs. SE-M6) in antibiotic-free LB broth. Each test was run with five replicates. Growth competition was determined by pyrosequencing the single nucleotide variations in GyrA of the strains according to the method of Baker et al.[28]. Bacterial cells from the mixed culture (1:1 ratio) were thawed, and DNA was extracted using heat treatment and phenol-chloroform purification. Briefly, a 100 µL aliquot of the mixed culture was agitated and incubated at 100 °C for 10 min before being returned to ambient temperature. The solution was centrifuged, an equal volume of phenol-chloroform was added, the mixture was then vortexed and centrifuged at 10,000 × g for 20 min in a benchtop microfuge (Eppendorf, USA). The supernatant was removed, placed in a sterile microfuge tube, and immediately prepared for pyrosequencing[28]. The DNA from the competitive growth assays was PCR amplified in triplicate using biotinylated primer pairs targeting the region containing the single nucleotide polymorphism to distinguish the two organisms in the assay by mutations in GyrA. All PCR amplifications were visualized on 1% agarose gels prior to pyrosequencing. The purified PCR products were pyrosequenced at the BGI Company. Competition coefficients were defined as the ratio of the ST strain to the SE strain, and were calculated by measuring the percentage yield of the single nucleotide in gyrA. A competition coefficient >1 means that the ST strain was the more abundant strain; meanwhile, a competition coefficient <1 means that the ST strain was the less abundant strain. Independent overnight cultures were made for the parental strains and selected mutants. The bacteria were diluted 1:500 in LB medium containing 0%, 0.1%, or 1% bile (Fluka Bile Salts, Sigma)[35]. The growth of the bacteria was measured by counting viable colonies every 2 h for 24 h (40 h for 1% bile) at 37 °C. The experiment was repeated three times, and the results were averaged for each strain.

Cell invasion assays

A human intestinal epithelium cell line (INT-407) was cultured at 37 °C under 5% CO2 in Dulbecco’s Modified Eagle’s Medium (DMEM; HyClone Laboratories Inc., Logan, UT, USA) containing 10% fetal bovine serum (FBS) and 100 mg/L gentamicin. The cultured cells were seeded (106 cells/mL) into 24-well tissue culture plates (BD Falcon, Franklin Lakes, NJ, USA) to reach >90% confluence at 37 °C. The post-confluent cultures were rinsed twice with PBS and preincubated in prewarmed antibiotic-free DMEM for 2 h. After stabilization, the INT-407 cell monolayers were used to evaluate the invasive ability of ST and SE cells exposed to different bile conditions. ST and SE cells exposed to 0%, 0.1%, or 1% bile were suspended in antibiotic-free DMEM (approximately 8.0 × 105 CFU/mL) and infected into the INT-407 cell monolayers at 37 °C for 2 h. After infection, the INT-407 cell monolayers were incubated at 37 °C for 2 h in DMEM containing 100 mg/L gentamicin to inactivate extracellular ST and SE cells, rinsed with PBS to eliminate the gentamicin residue, and lysed with 1% Triton X-100 for 15 min at 37 °C. The lysates were serially diluted (1:10) with PBS. The proper dilutions were plated on LB-agar and incubated at 37 °C for 24–48 h, and intracellular ST and SE cells were counted[36]. Each invasion assay was performed at least three times (four wells per assay).

Statistics

Data were analyzed using IBM SPSS Statistics 20. The data from cell invasion assays were normally distributed; thus, multiple comparisons were performed using a one-way ANOVA test. P-values < 0.05 were considered to be significant.
  36 in total

1.  Is it time to change fluoroquinolone breakpoints for Salmonella spp.?

Authors:  Frank Møller Aarestrup; Camilla Wiuff; Kåre Mølbak; E John Threlfall
Journal:  Antimicrob Agents Chemother       Date:  2003-02       Impact factor: 5.191

2.  Prevalence and antimicrobial resistance patterns of Salmonella from different raw foods in Mexico.

Authors:  J M Miranda; A C Mondragón; B Martinez; M Guarddon; J A Rodriguez
Journal:  J Food Prot       Date:  2009-05       Impact factor: 2.077

3.  Increasing incidence of quinolone resistance in human non-typhoid Salmonella enterica isolates in Korea and mechanisms involved in quinolone resistance.

Authors:  Sang-Ho Choi; Jun Hee Woo; Jung Eun Lee; Su Jin Park; Eun Ju Choo; Yee Gyung Kwak; Mi-Na Kim; Myung-Sik Choi; Nam Yong Lee; Bok Kwon Lee; Nam Joong Kim; Jin-Yong Jeong; Jiso Ryu; Yang Soo Kim
Journal:  J Antimicrob Chemother       Date:  2005-10-21       Impact factor: 5.790

4.  Salmonella enterica serovar typhimurium invasion is repressed in the presence of bile.

Authors:  A M Prouty; J S Gunn
Journal:  Infect Immun       Date:  2000-12       Impact factor: 3.441

5.  Bile-salt-mediated induction of antimicrobial and bile resistance in Salmonella typhimurium.

Authors:  A M Prouty; I E Brodsky; S Falkow; J S Gunn
Journal:  Microbiology       Date:  2004-04       Impact factor: 2.777

6.  Multiple regulatory pathways associated with high-level ciprofloxacin and multidrug resistance in Salmonella enterica serovar enteritidis: involvement of RamA and other global regulators.

Authors:  Edel O'Regan; Teresa Quinn; Jean-Marie Pagès; Matthew McCusker; Laura Piddock; Séamus Fanning
Journal:  Antimicrob Agents Chemother       Date:  2008-12-22       Impact factor: 5.191

Review 7.  Plasmid-mediated quinolone resistance: a multifaceted threat.

Authors:  Jacob Strahilevitz; George A Jacoby; David C Hooper; Ari Robicsek
Journal:  Clin Microbiol Rev       Date:  2009-10       Impact factor: 26.132

8.  Co-spread of oqxAB and blaCTX-M-9G in non-Typhi Salmonella enterica isolates mediated by ST2-IncHI2 plasmids.

Authors:  Liang Li; Xiao-Ping Liao; Zhen-Zhen Liu; Ting Huang; Xue Li; Jian Sun; Bao-Tao Liu; Qijing Zhang; Ya-Hong Liu
Journal:  Int J Antimicrob Agents       Date:  2014-06-27       Impact factor: 5.283

9.  Fitness benefits in fluoroquinolone-resistant Salmonella Typhi in the absence of antimicrobial pressure.

Authors:  Stephen Baker; Pham Thanh Duy; Tran Vu Thieu Nga; Tran Thi Ngoc Dung; Voong Vinh Phat; Tran Thuy Chau; A Keith Turner; Jeremy Farrar; Maciej F Boni
Journal:  Elife       Date:  2013-12-10       Impact factor: 8.140

10.  CTX-M-27 Producing Salmonella enterica Serotypes Typhimurium and Indiana Are Prevalent among Food-Producing Animals in China.

Authors:  Wen-Hui Zhang; Xiang-Yan Lin; Liang Xu; Xi-Xi Gu; Ling Yang; Wan Li; Si-Qi Ren; Ya-Hong Liu; Zhen-Ling Zeng; Hong-Xia Jiang
Journal:  Front Microbiol       Date:  2016-03-31       Impact factor: 5.640

View more
  10 in total

Review 1.  The Great ESKAPE: Exploring the Crossroads of Bile and Antibiotic Resistance in Bacterial Pathogens.

Authors:  Kevin S Gipson; Kourtney P Nickerson; Eliana Drenkard; Alejandro Llanos-Chea; Snaha Krishna Dogiparthi; Bernard B Lanter; Rhianna M Hibbler; Lael M Yonker; Bryan P Hurley; Christina S Faherty
Journal:  Infect Immun       Date:  2020-09-18       Impact factor: 3.441

2.  Antibiotic Susceptibility Profiles and Frequency of Resistance Genes in Clinical Shiga Toxin-Producing Escherichia coli Isolates from Michigan over a 14-Year Period.

Authors:  Sanjana Mukherjee; Heather M Blankenship; Jose A Rodrigues; Rebekah E Mosci; James T Rudrik; Shannon D Manning
Journal:  Antimicrob Agents Chemother       Date:  2021-08-23       Impact factor: 5.191

3.  Increasing Frequencies of Antibiotic Resistant Non-typhoidal Salmonella Infections in Michigan and Risk Factors for Disease.

Authors:  Sanjana Mukherjee; Chase M Anderson; Rebekah E Mosci; Duane W Newton; Paul Lephart; Hossein Salimnia; Walid Khalife; James T Rudrik; Shannon D Manning
Journal:  Front Med (Lausanne)       Date:  2019-11-08

4.  Induction of Hypergammaglobulinemia and Autoantibodies by Salmonella Infection in MyD88-Deficient Mice.

Authors:  Jincy M Issac; Yassir A Mohamed; Ghada Hassan Bashir; Ashraf Al-Sbiei; Walter Conca; Taj A Khan; Asif Iqbal; Gabriela Riemekasten; Katja Bieber; Ralf J Ludwig; Otavio Cabral-Marques; Maria J Fernandez-Cabezudo; Basel K Al-Ramadi
Journal:  Front Immunol       Date:  2018-06-20       Impact factor: 7.561

Review 5.  Antimicrobial Resistance in Veterinary Medicine: An Overview.

Authors:  Ernesto Palma; Bruno Tilocca; Paola Roncada
Journal:  Int J Mol Sci       Date:  2020-03-11       Impact factor: 5.923

Review 6.  Antibiotic resistance modifying ability of phytoextracts in anthrax biological agent Bacillus anthracis and emerging superbugs: a review of synergistic mechanisms.

Authors:  Mackingsley Kushan Dassanayake; Teng-Jin Khoo; Jia An
Journal:  Ann Clin Microbiol Antimicrob       Date:  2021-12-02       Impact factor: 3.944

7.  The Evolution of Fluoroquinolone Resistance in Salmonella under Exposure to Sub-Inhibitory Concentration of Enrofloxacin.

Authors:  Yufeng Gu; Lulu Huang; Cuirong Wu; Junhong Huang; Haihong Hao; Zonghui Yuan; Guyue Cheng
Journal:  Int J Mol Sci       Date:  2021-11-11       Impact factor: 5.923

8.  Inhibitory Concentrations of Ciprofloxacin Induce an Adaptive Response Promoting the Intracellular Survival of Salmonella enterica Serovar Typhimurium.

Authors:  Sushmita Sridhar; Sally Forrest; Derek Pickard; Claire Cormie; Emily A Lees; Nicholas R Thomson; Gordon Dougan; Stephen Baker
Journal:  mBio       Date:  2021-06-22       Impact factor: 7.867

9.  Modeling and Cost Benefit Analysis to Guide Deployment of POC Diagnostics for Non-typhoidal Salmonella Infections with Antimicrobial Resistance.

Authors:  Carrie Manore; Todd Graham; Alexa Carr; Alicia Feryn; Shailja Jakhar; Harshini Mukundan; Hannah Callender Highlander
Journal:  Sci Rep       Date:  2019-08-02       Impact factor: 4.379

Review 10.  Transcriptional Regulation of the Multiple Resistance Mechanisms in Salmonella-A Review.

Authors:  Michał Wójcicki; Olga Świder; Kamila J Daniluk; Paulina Średnicka; Monika Akimowicz; Marek Ł Roszko; Barbara Sokołowska; Edyta Juszczuk-Kubiak
Journal:  Pathogens       Date:  2021-06-24
  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.