Salmonella enterica serovar Typhimurium has at least nine multidrug efflux pumps. Among these pumps, AcrAB is effective in generating drug resistance and has wide substrate specificity. Here we report that indole, bile, and an Escherichia coli conditioned medium induced the AcrAB pump in Salmonella through a specific regulator, RamA. The RamA-binding sites were located in the upstream regions of acrAB and tolC. RamA was required for indole induction of acrAB. Other regulators of acrAB such as MarA, SoxS, Rob, SdiA, and AcrR did not contribute to acrAB induction by indole in Salmonella. Indole activated ramA transcription, and overproduction of RamA caused increased acrAB expression. In contrast, induction of ramA was not required for induction of acrAB by bile. Cholic acid binds to RamA, and we suggest that bile acts by altering pre-existing RamA. This points to two different AcrAB regulatory modes through RamA. Our results suggest that RamA controls the Salmonella AcrAB-TolC multidrug efflux system through dual regulatory modes in response to environmental signals.
Salmonella enterica serovar Typhimurium has at least nine multidrug efflux pumps. Among these pumps, AcrAB is effective in generating drug resistance and has wide substrate specificity. Here we report that indole, bile, and an Escherichia coli conditioned medium induced the AcrAB pump in Salmonella through a specific regulator, RamA. The RamA-binding sites were located in the upstream regions of acrAB and tolC. RamA was required for indole induction of acrAB. Other regulators of acrAB such as MarA, SoxS, Rob, SdiA, and AcrR did not contribute to acrAB induction by indole in Salmonella. Indole activated ramA transcription, and overproduction of RamA caused increased acrAB expression. In contrast, induction of ramA was not required for induction of acrAB by bile. Cholic acid binds to RamA, and we suggest that bile acts by altering pre-existing RamA. This points to two different AcrAB regulatory modes through RamA. Our results suggest that RamA controls the SalmonellaAcrAB-TolC multidrug efflux system through dual regulatory modes in response to environmental signals.
Salmonella enterica is a bacterial pathogen that causes a variety
of diseases in humans, including gastroenteritis, bacteremia, and typhoid
fever (1). In the 1990s, the
prevalence of multidrug-resistant Salmonella increased in the United
Kingdom (2,
3), the United States
(4,
5), and Canada
(6). Many countries documented
outbreaks associated with drug-resistant Salmonella in poultry,
cattle, and swine (4,
7-10).
Emerging resistance to antibiotics in Salmonella has been found in
both humans and animals and is a potentially serious public health problem
(11,
12). High level
fluoroquinolone resistance in S. enterica serovar Typhimurium phage
type DT204 has been reported to result from multiple target gene mutations and
active efflux by the AcrAB-TolC multidrug efflux pump
(13,
14).Multidrug efflux pumps have important physiological functions, including
transport of drugs, bile salts, toxins, and environmental compounds
(15,
16). In bacteria, drug
resistance is often associated with multidrug efflux pumps that decrease
cellular drug accumulation
(17,
18). In bacteria, such pumps
have been classified into five families on the basis of sequence similarity as
follows: the major facilitator, resistance-nodulation-cell division, small
multidrug resistance, multidrug and toxic compound extrusion, and ATP-binding
cassette families
(19-21).
In Gram-negative bacteria, resistance-nodulation-cell division pumps are
especially effective in generating resistance
(17,
22-24).
Recent studies have shown that Gram-negative S. enterica serovar
Typhimurium has nine functional drug efflux pumps
(25). Many multidrug pumps
have overlapping substrate spectra, and it is intriguing that bacteria, with
their economically organized genomes, harbor large sets of multidrug efflux
genes (17).The key to understanding how bacteria utilize these pumps lies in the
regulation of their expression
(19,
26-28).
Currently available data indicate that multidrug efflux pumps are often
expressed under precise and elaborate transcriptional control. For example,
expression of acrAB, which encodes the AcrAB pump, may be subject to
multiple levels of regulation. In Escherichia coli, it is modulated
locally by the repressor AcrR
(29). At a more global level,
it is modulated by stress conditions and by regulators such as MarA, SoxS, and
Rob (30,
31). Olliver et al.
(32) reported that mutation in
acrR contributes to overexpression of acrAB in
Salmonella and increases resistance to multiple drugs. Eaves et
al. (33) reported that
acrB, acrF, and acrD are coordinately regulated and that
their expression influences expression of transcriptional activators
marA and soxS. Furthermore, integration of IS1 and IS10
elements into the upstream region of the acrEF operon has been
reported to cause increased expression of acrEF
(34). These examples
illustrate the complexity and diversity of the mechanisms regulating bacterial
multidrug efflux pumps. However, few data are available on signals that induce
multidrug efflux genes in Salmonella.Previously, it was reported that indole induces the acrD, acrE, cusB,
emrK, mdtA, mdtE, and mdtH multidrug efflux pump genes in E.
coli (35). They also
reported that indole induction of acrD and mdtA is mediated
by the BaeSR and CpxAR systems. However, the effect of indole on the
AcrAB-TolC multidrug efflux pump, which plays a major role in antibiotic
resistance, remains unknown. Very few signals inducing multidrug efflux pumps
in Salmonella have been identified so far. Here we report on
induction of acrAB in Salmonella via the specific regulator
RamA in response to indole, bile, and an E. coli conditioned medium.
This study describes the dual regulatory mode of acrAB via RamA in
response to environmental signals.
EXPERIMENTAL PROCEDURES
Bacterial Strains, Plasmids, and Growth Conditions—The
bacterial strains and plasmids used in this study are listed in
Table 1. The S.
enterica serovar Typhimurium strains were derived from the wild-type
(WT)4 strain
ATCC14028s (36). P22-mediated
transductions were performed as described by Davis et al.,
(37). Bacterial strains were
grown at 37 °C in LuriaBertani (LB) broth or plates. Antibiotics such as
ampicillin (100 μg/ml), kanamycin (25 μg/ml), or chloramphenicol (25
μg/ml) were added when required.
TABLE 1
S. enterica strains and plasmids used in this study
Single copy vector, CmR, NotI-HindIII cloning site upstream of
promoter-less lacZ
38
pNNramA
pNN387 (ramA gene promoter-lacZ)
This study
S. enterica strains and plasmids used in this studyPlasmid Construction—ramA was amplified by PCR from
the genomic DNA of strain ATCC14028s
(36) using LA-Taq polymerase
(Takara Bio Inc., Otsu, Japan) and the primers listed in
Table 2. This process
introduced the EcoRI and HindIII restriction sites. The PCR fragment was
cloned between the EcoRI and HindIII sites of the pMAL-c2X vector (New England
Biolabs Inc., Ipswich, MA). The ramA promoter was amplified by PCR,
and the PCR fragment was cloned between the NotI and HindIII sites of the
pNN387 vector (38). The
nucleotide sequences of the recombinant plasmids were determined using an ABI
PRISM 3100-Avant genetic analyzer (Applied Biosystems Foster City,
CA).
Primers used in this studyConstruction of Gene Deletion Mutants—Genes were disrupted
as described by Datsenko and Wanner
(39). The chloramphenicol
resistance cat gene, flanked by Flp recognition sites, was amplified
by PCR using the primers listed in Table
2. The resulting PCR products were used to transform the recipient
ATCC14028s strain harboring the pKD46 plasmid that expresses Red recombinase.
Chromosomal structure of the mutated loci was verified by PCR
(39). The deletions were
transferred to strains by P22 transduction. The cat gene was
eliminated using plasmid pCP20
(39).β-Galactosidase Assays—Single colonies of each
bacterial strain to be assayed were inoculated into 2 ml of LB containing the
appropriate selected antibiotics. After overnight growth at 37 °C, the
cultures were diluted to 1:50 into E. coli conditioned medium or LB
media. The cells were then grown at 37 °C until the optical density of 0.8
at 600 nm. To test the effect of indole or bile on gene expression, 2
mm indole, 0.25 mm bile salts, 0.25 mm cholic
acid, or 0.25 mm deoxycholic acid were added to secondary cultures.
β-Galactosidase activities were determined as described by Miller
(40). All assays were
performed in triplicate.Survival Assay—Salmonella WT strain was grown at 37
°C in LB medium, with or without indole, for 7 h. Benzalkonium was added
to create a concentration of 150 mg/ml in LB. After incubation for 10 min, the
number of colony-forming units was determined by serial dilutions in
phosphate-buffered saline on LBagar. The percentage of cells surviving under
benzalkonium was the number of colony-forming units per ml remaining after the
benzalkonium treatment divided by the initial number of colony-forming units
per ml. Survival levels of the indole-treated cells were standardized to 100%,
and untreated cell values were displayed relative to those of the
indole-treated cells. All assays were performed in triplicate.Indole induction of multidrug efflux genes and drug tolerance of
The data correspond to
mean values from three independent experiments. Bars correspond to
the standard deviation. Asterisks indicate statistically significant
differences (*, p < 0.01) in the paired Student's
t test. A, differences in β-galactosidase activity in
tolC-lac (EG15109), acrAB-lac (NKS505),
acrEF-lac (EG15114), acrD-lac (EG15120), mdtABC-lac
(EG15124), mdsABC-lac (NKS517), emrAB-lac (NKS522),
mdfA-lac (NKS524), mdtK-lac (EG15132), and
macAB-lac (NKS530) strains grown in LB medium with (solid
bars) or without (open bars) 2 mm indole. B,
drug tolerance of S. enterica serovar Typhimurium induced by indole.
WT strain (ATCC14028s) was incubated with or without 2 mm indole.
Cells were then challenged to benzalkonium (500 mg/ml) for 10 min. The
survival levels of the indole-treated cells were normalized to 100%, and
untreated cells are displayed relative to those of the indole-treated cells.
The actual survival of indole-treated cells was 0.025%.Preparation of Conditioned Medium—Conditioned medium was
prepared by inoculating 30 ml of LB broth with 300 μl of a 10-3
dilution of an overnight culture of E. coli MG1655, followed by
shaking (170 rpm) at 37 °C for 24 h (A600 of 5.0)
(41). The cells were pelleted
by centrifugation, and the resulting supernatants supplemented with 20×
LB broth to create a final concentration of 0.5× and adjusted to a pH of
7.5. The conditioned medium was then filter-sterilized through a 0.2-μm
pore filter.Purification of Histidine-tagged RamA and Truncated RamA
Protein—Full-length ramA gene or truncated ramA
gene (69 bases at 5-terminal was deleted) were amplified from genomic DNA of
ATCC14028s by PCR with the primers listed in
Table 2. The DNA fragments were
cloned into pMALc2x vector (New England Biolabs). Constructed plasmids were
transformed into BL21(DE3) to produce histidine-tagged RamA or N-terminal
truncated (23 amino acids) His-RamA. For purification of RamA protein, E.
coli was grown at 37 °C to an A600 of 0.5. RamA
production was induced by addition of 0.3 mm isopropyl
1-thio-β-d-galactoside. Cultures were incubated for 3 h, and
bacterial cells were then disrupted by French press (SLM Instruments, Inc.,
Urbana, IL). The protein was purified using TALON metal affinity resin
(Clontech).DNA Mobility Shift Assay—Upstream regions of acrA
and tolC were amplified by PCR. The PCR products were purified for a
DNA mobility shift assay. Ten microliters of reaction mixture for the DNA
mobility shift assay contained 0.15 pmol of DNA and RamA protein. The reaction
buffer contained 10 mm Tris-HCl (pH 7.5), 50 mm KCl, and
1 mm dithiothreitol. Reaction mixtures were incubated for 30 min at
room temperature and separated on a 5% native polyacrylamide gel at 4 °C.
The gel was soaked in 10,000× diluted SYBR Green I nucleic acid stain
(Cambrex Corp., East Rutherford, NJ). DNA was visualized under blue incident
light at 460 nm (Luminescent Image Analyzer LAS-3000, Fujifilm Life Science,
Stamford, CT).Intrinsic Fluorescence Spectrum of RamA in the Presence of Cholic
Acid—Fluorescence spectra of RamA and truncated RamA were measured
as described by Rosenberg et al.
(31). The fluorescence
emission spectra were recorded using a LS 55 fluorescence spectrometer, 120 V
(PerkinElmer Life Sciences).
RESULTS
Indole Induces Four Multidrug Efflux Pumps and Drug Tolerance of
Salmonella—In E. coli, indole is produced from tryptophan
by tryptophanase and is excreted from the cell
(42). However,
Salmonella does not produce indole because it lacks the tnaA
gene encoding tryptophanase
(43). Indole has also been
reported to auto-regulate multidrug efflux genes in E. coli
(35). We postulated that
Salmonella multidrug efflux genes may respond to indole. To
investigate the effect of indole on the expression of multidrug efflux pumps,
Salmonella strains, in which the efflux genes were replaced with a
reporter gene (lacZ), were inoculated into cultures, with or without
indole. Expression levels of drug efflux pumps were measured by a
β-galactosidase reporter assay. Indole significantly induced expression
of the acrAB, emrAB, acrD, and mdtABC efflux genes in
Salmonella (Fig.
1). A survival assay using benzalkonium showed that
indole enhanced drug tolerance of Salmonella
(Fig. 1).
FIGURE 1.
Indole induction of multidrug efflux genes and drug tolerance of
The data correspond to
mean values from three independent experiments. Bars correspond to
the standard deviation. Asterisks indicate statistically significant
differences (*, p < 0.01) in the paired Student's
t test. A, differences in β-galactosidase activity in
tolC-lac (EG15109), acrAB-lac (NKS505),
acrEF-lac (EG15114), acrD-lac (EG15120), mdtABC-lac
(EG15124), mdsABC-lac (NKS517), emrAB-lac (NKS522),
mdfA-lac (NKS524), mdtK-lac (EG15132), and
macAB-lac (NKS530) strains grown in LB medium with (solid
bars) or without (open bars) 2 mm indole. B,
drug tolerance of S. enterica serovar Typhimurium induced by indole.
WT strain (ATCC14028s) was incubated with or without 2 mm indole.
Cells were then challenged to benzalkonium (500 mg/ml) for 10 min. The
survival levels of the indole-treated cells were normalized to 100%, and
untreated cells are displayed relative to those of the indole-treated cells.
The actual survival of indole-treated cells was 0.025%.
Indole Induces acrAB Expression via the RamA Regulator—Among
the multidrug efflux pumps, AcrAB plays a major role in the intrinsic
resistance of Salmonella
(25). Also, Hirakawa et
al. (35) reported that
the baeSR and cpxAR signal transduction system genes are
required for indole induction of multidrug efflux pumps in E. coli.
To identify the regulatory elements that induce acrAB in response to
indole in Salmonella, we constructed a mutant that lacked
baeSR and cpxAR. In the ΔbaeSR cpxAR mutant,
the expression of acrAB was not significantly different from that in
the wild-type (WT) strain; however, indole induction of acrD was
significantly lower in the mutant compared with the WT strain
(Fig. 2). The result
indicates that the BaeSR and CpxAR signal transduction systems are not
involved in indole induction of acrAB, whereas they are required for
acrD induction. Other regulators, marA, soxS, rob, sdiA, and
acrR, have been previously reported to control acrAB
expression in E. coli
(27). With the exception of
ramA, none significantly altered the indole induction of
acrAB in Salmonella (Fig.
2). The stimulatory effect of indole on acrAB
expression was completely eliminated in the ΔramA mutant
(Fig. 2). The results
indicate that the RamA regulator is required for indole induction of
acrAB in Salmonella.
FIGURE 2.
Indole activation of The data correspond to mean values from three independent
experiments. Bars correspond to the standard deviation.
Asterisks indicate statistically significant differences
(*, p < 0.01) in the paired Student's t test.
A, β-galactosidase levels in WT or ΔbaeSR cpxAR
strains, carrying acrAB-lac and acrD-lac transcriptional
fusions, grown in LB medium with (solid bars) or without (open
bars) 2 mm indole. B, β-galactosidase levels
were assayed in strains carrying the acrAB-lac transcriptional fusion
in the WT (NKS505), ΔmarA (NES20), Δrob (NES29),
ΔsoxS (NES28), ΔsdiA (NES35),
ΔacrR (NES48), ΔmarA rob soxS sdiA acrR (NES55),
and ΔramA (NES58) strains. Strains were grown in LB medium with
(solid bars) or without (open bars) 2 mm
indole.
Indole activation of The data correspond to mean values from three independent
experiments. Bars correspond to the standard deviation.
Asterisks indicate statistically significant differences
(*, p < 0.01) in the paired Student's t test.
A, β-galactosidase levels in WT or ΔbaeSR cpxAR
strains, carrying acrAB-lac and acrD-lac transcriptional
fusions, grown in LB medium with (solid bars) or without (open
bars) 2 mm indole. B, β-galactosidase levels
were assayed in strains carrying the acrAB-lac transcriptional fusion
in the WT (NKS505), ΔmarA (NES20), Δrob (NES29),
ΔsoxS (NES28), ΔsdiA (NES35),
ΔacrR (NES48), ΔmarA rob soxS sdiA acrR (NES55),
and ΔramA (NES58) strains. Strains were grown in LB medium with
(solid bars) or without (open bars) 2 mm
indole.Requirement of RamA for induction of
β-Galactosidase levels were assayed in WT (NKS505) or
ΔramA (NES58) strains carrying the acrAB-lac
transcriptional fusion. Cells were grown in LB medium (control) or LB medium
supplemented with 0.25 mm cholic acid, 0.25 mm
deoxycholic acid, or 0.25 mm bile salts. The data correspond to
mean values from three independent experiments. Bars correspond to
the standard deviation. Student's t test; *, p
< 0.01 versus WT.Multidrug efflux genes in The
tolC-lac (EG15109), acrAB-lac (NKS505),
acrEF-lac (EG15114), acrD-lac (EG15120), mdtABC-lac
(EG15124), mdsABC-lac (NKS517), emrAB-lac (NKS522),
mdfA-lac (NKS524), mdtK-lac (EG15132), and
macAB-lac (NKS530) strains were grown in conditioned medium prepared
from E. coli culture. Expression levels of multidrug efflux genes
were determined by β-galactosidase assay. The data correspond to mean
values of three independent experiments. Error bars correspond to the
standard deviation. Asterisks indicate statistically significant
differences (*, p < 0.01) in the paired Student's
t test.acrAB Activation by Bile Is Dependent on the RamA
Regulator—The AcrAB pump is reported to export bile salts and play
a role in bile resistance in E. coli and Salmonella
(44-46).
Also, acrAB is reportedly induced by bile in a Robdependent manner in
E. coli (31).
Although acrAB is also induced by bile in Salmonella, the
induction mediating regulator is unknown
(47). Prouty et al.
(47) further reported that
acrAB activation by bile is independent of MarA, Rob, PhoP/PhoQ, and
RpoS. We investigated the possibility that RamA controls acrAB
expression in response to bile. In agreement with Prouty et al.
(47), bile salts, cholic acid,
and deoxycholic acid significantly induced acrAB expression in
Salmonella (Fig. 3).
When ramA was deleted, acrAB induction was eliminated
(Fig. 3). These findings
indicate a novel RamA-dependent pathway for bile-mediated regulation of the
AcrAB efflux pump in Salmonella, different from that observed in
E. coli.
FIGURE 3.
Requirement of RamA for induction of
β-Galactosidase levels were assayed in WT (NKS505) or
ΔramA (NES58) strains carrying the acrAB-lac
transcriptional fusion. Cells were grown in LB medium (control) or LB medium
supplemented with 0.25 mm cholic acid, 0.25 mm
deoxycholic acid, or 0.25 mm bile salts. The data correspond to
mean values from three independent experiments. Bars correspond to
the standard deviation. Student's t test; *, p
< 0.01 versus WT.
Conditioned Medium from E. coli Induces SalmonellaacrAB and tolC Genes
via the RamA Regulator—Indole accumulates and MdtEF is induced in
stationary phase cultures of E. coli, but experiments with a
tnaAB mutant showed that indole partially contributes to this
induction (48). These results
indicate that E. coli produces indole as well as other efflux pump
inducers. Therefore, we investigated whether an E. coli conditioned
medium would induce multidrug efflux pumps in Salmonella. Conditioned
medium, prepared from E. coli MG1655, significantly induced eight
Salmonella multidrug efflux pumps, including acrAB and the
outer membrane protein gene tolC
(Fig. 4). Inductions of
acrAB and tolC were significantly decreased in
ΔramA (Fig. 5, ), indicating that the E. coli conditioned
medium induced acrAB and tolC via the RamA regulator.
FIGURE 4.
Multidrug efflux genes in The
tolC-lac (EG15109), acrAB-lac (NKS505),
acrEF-lac (EG15114), acrD-lac (EG15120), mdtABC-lac
(EG15124), mdsABC-lac (NKS517), emrAB-lac (NKS522),
mdfA-lac (NKS524), mdtK-lac (EG15132), and
macAB-lac (NKS530) strains were grown in conditioned medium prepared
from E. coli culture. Expression levels of multidrug efflux genes
were determined by β-galactosidase assay. The data correspond to mean
values of three independent experiments. Error bars correspond to the
standard deviation. Asterisks indicate statistically significant
differences (*, p < 0.01) in the paired Student's
t test.
FIGURE 5.
RamA induction of . The expression of acrAB (A) and
tolC (B) determined by β-galactosidase assay using
strains acrAB-lac (NKS505), ΔramA/acrAB-lac
(NES58), tolC-lac (EG15109), or
ΔramA/tolC-lac (NES65) grown in LB medium or
conditioned medium from E. coli MG1655. The data correspond to mean
values from three independent experiments. Bars correspond to the
standard deviation. Asterisks indicate statistically significant
differences (*, p < 0.01) in the paired Student's
t test.
RamA induction of . The expression of acrAB (A) and
tolC (B) determined by β-galactosidase assay using
strains acrAB-lac (NKS505), ΔramA/acrAB-lac
(NES58), tolC-lac (EG15109), or
ΔramA/tolC-lac (NES65) grown in LB medium or
conditioned medium from E. coli MG1655. The data correspond to mean
values from three independent experiments. Bars correspond to the
standard deviation. Asterisks indicate statistically significant
differences (*, p < 0.01) in the paired Student's
t test.RamA Binds to the Upstream Regions of acrA and tolC—The
aforementioned results indicate that RamA plays a major role in inducing
acrAB in response to environmental signals such as indole and bile.
To understand the regulation of acrAB by RamA, electrophoretic
mobility shift assays (EMSA) with the RamA protein were performed. Plasmids
encoding the histidine-tagged RamA or the N terminus truncated RamA proteins
were constructed (Table 2).
Because it was reported that RamA overproduction was related to increased
AcrAB expression in clinical Klebsiella pneumoniae isolates
(49), we investigated the
effect of histidine-tagged RamA on acrAB expression. Overproduction
of histidine-tagged RamA significantly induced the expression of
acrAB (Fig.
6); however, the truncated RamA did not induce
acrAB (Fig.
6) and was used as a negative control in subsequent
EMSA. Upstream regions of acrA were amplified by PCR, and the
fragments were incubated with RamA or truncated RamA protein. RamA bound to
pAcrA1, whereas truncated RamA did not
(Fig. 6). However,
RamA did not bind to pAcrA2, indicating that the RamA-binding site is located
between -795 and -142 upstream of acrA
(Fig. 6). RamA did
bind to the upstream region of tolC, whereas the truncated RamA did
not (Fig. 6). These
results indicate that RamA directly controls the expression of acrAB
and tolC.
FIGURE 6.
RamA binds to the upstream region of . A, β-galactosidase activity measured with
acrAB-lac (NKS505) harboring a plasmid expressing
ramA, truncated ramA, or the vector control (pMALc2X). The
data correspond to mean values from three independent experiments. Error
bars correspond to the standard deviation. Student's t test;
*, p < 0.01 versus control. B and
C, EMSA images for RamA binding to the upstream regions of
acrA (B) and tolC (C). Upstream regions of
acrA (pAcrA1, -795 to +16 region relative to the start codon
of acrA; pAcrA2, -141 to +16) (A) and tolC
(-250 to -1 region relative to the start codon of tolC)(C)
were incubated with various concentrations of RamA or N-terminal truncated
RamA. Protein concentrations are as follows: -, without protein; +, 1.0
μm; ++, 1.5 μm; +++, 2.0 μm.
RamA binds to the upstream region of . A, β-galactosidase activity measured with
acrAB-lac (NKS505) harboring a plasmid expressing
ramA, truncated ramA, or the vector control (pMALc2X). The
data correspond to mean values from three independent experiments. Error
bars correspond to the standard deviation. Student's t test;
*, p < 0.01 versus control. B and
C, EMSA images for RamA binding to the upstream regions of
acrA (B) and tolC (C). Upstream regions of
acrA (pAcrA1, -795 to +16 region relative to the start codon
of acrA; pAcrA2, -141 to +16) (A) and tolC
(-250 to -1 region relative to the start codon of tolC)(C)
were incubated with various concentrations of RamA or N-terminal truncated
RamA. Protein concentrations are as follows: -, without protein; +, 1.0
μm; ++, 1.5 μm; +++, 2.0 μm.Determination of RamA-binding Sites for acrA and tolC—To
determine the RamA-binding site for acrA, we prepared different
lengths of DNA fragments for EMSA. The fragments used were as follows: pAcrA3
(-241 to +16, the numbering is relative to the start codon of acrA),
pAcrA4 (-341 to +16), pAcrA5 (-441 to +16), pAcrA6 (-541 to +16), and pAcrA7
(-641 to +16). RamA bound to pAcrA3-7, but it did not bind to pAcr2
(Fig. 7). These
results indicate that the RamA-binding site was between -241 and -142. We then
examined fragment pAcrA8 (-191 to +16); RamA bound to this fragment,
indicating a binding site between -191 and -142
(Fig. 7). Further
examination with pAcrA9 (-151 to +16), pAcrA10 (-161 to +16), pAcrA11 (-171 to
+16), and pAcrA12 (-181 to +16) revealed that RamA bound to pAcrA10-12 but not
to pAcrA9 (Fig. 7).
These results indicate that the -161 to -152-bp region is required for RamA
binding. It was previously reported that RamA bound to a 20-bp asymmetric
sequence with a degenerate consensus soxbox of
AYNGCAC-NNWNNRYYAAAYN (N = any base;
R = A/G; W = A/T; Y = C/T)
(50,
51). A DNA sequence resembling
this consensus soxbox sequence, ATGGCACGAAAAACCAAACA, was located at -161 to
-142 (Fig. 7).
FIGURE 7.
A-C, determination of RamA-binding site for acrA. EMSA of
RamA binding to the upstream regions of acrA is shown. DNA fragments,
including upstream regions of acrA, were incubated without (-) or
with (+) purified RamA (1.0 μm). DNA fragments are as follows:
pAcr2 (-141 to +16, the numbering is relative to the start codon of
acrA), pAcrA3 (-241 to +16), pAcrA4 (-341 to +16), pAcrA5 (-441 to
+16), pAcrA6 (-541 to +16), pAcrA7 (-641 to +16) (A), pAcrA8 (-191 to
+16) (B), pAcrA9 (-151 to +16), pAcrA10 (-161 to +16), pAcrA11 (-171
to +16), and pAcrA12 (-181 to +16) (C). D, nucleotide
sequence in the upstream region of acrA. Boxed sequence corresponds
to the RamA-binding site. The numbers indicate the positions from the
start codon of acrA.
We also determined a RamA-binding site located upstream of tolC.
In a tolC promoter, we found a soxbox sequence between -99 and -80
(the numbering is relative to the start codon of tolC). Therefore, we
prepared fragments of pTolC1 (-79 to -1) and pTolC2 (-99 to -1) to determine
binding location. RamA bound to pTolC2 but did not bind to pTolC1
(Fig. 8) indicating
that RamA binds between -99 to -80 and contains the ATGGCACGTAACGCCAACTT
consensus sequence (Fig.
8).
FIGURE 8.
RamA-binding site for . A, DNA fragments,
including tolC promoter regions pTolC1 (-80 to -1; the numbering is
relative to the start codon of tolC) and pTolC2 (-100 to +1), were
incubated without (-) or with (+) purified RamA (1.0 μm).
B, nucleotide sequence upstream region of tolC. Boxed
sequence corresponds to the RamA-binding site. The numbers indicate
the positions from the start codon of tolC.
Indole Induces ramA Expression but Bile Does Not—The effects
of indole and bile on ramA expression levels were investigated
because increased ramA expression has been reported to cause
increased production of the AcrAB-TolC efflux system
(49). Using a reporter plasmid
of ramA, a β-galactosidase assay showed that indole enhanced the
promoter activity of ramA (Fig.
9). This suggests that indole induces acrAB through
increased expression of ramA. Bile salts, cholic acid, and
deoxycholic acid did not affect the expression level of ramA despite
its requirement for induction of acrAB. This indicates an
acrAB regulatory mode other than through increased production of
RamA.
FIGURE 9.
Effect of indole and bile on
β-Galactosidase levels were assayed in the WT strain carrying the
ramA reporter plasmid (pNNramA) (NES84). Cells were grown in
LB medium supplemented with 2 mm indole, 0.25 mm cholic
acid, 0.25 mm deoxycholic acid, or 0.25 mm bile salts.
The data correspond to mean values from three independent experiments.
Bars correspond to the standard deviation. Student's t test;
*, p < 0.01 versus control.
Binding of Bile to RamA Protein—The failure of bile to
affect the expression level of ramA suggests that RamA may detect the
presence of a bile acid component such as cholic acid. This was explored using
the intrinsic (tryptophan) spectrum of RamA, as described by Rosenberg et
al. (31). When 50
μm cholic acid was added to 75 nm RamA, there was a
strong blue shift in the emission spectrum
(Fig. 10). The blue
shift was also slightly seen with 10 μm cholic acid and 75
nm RamA (Fig.
10). In contrast, a blue shift was not observed when 50
μm cholic acid was added to 75 nm truncated RamA
(Fig. 10). These
results indicate that bile binds to RamA to induce acrAB expression
in Salmonella.
FIGURE 10.
Binding of bile to the RamA protein. A, cholic acid (50
μm) produces a blue shift in the intrinsic spectrum of RamA.
Intrinsic fluorescence of RamA (75 nm) was measured in the absence
or presence of cholic acid. B, cholic acid (10 μm) also
produces a blue shift in the intrinsic spectrum of RamA. C, blue
shift in the intrinsic spectrum of truncated RamA was not produced by 50
μm cholic acid.
A-C, determination of RamA-binding site for acrA. EMSA of
RamA binding to the upstream regions of acrA is shown. DNA fragments,
including upstream regions of acrA, were incubated without (-) or
with (+) purified RamA (1.0 μm). DNA fragments are as follows:
pAcr2 (-141 to +16, the numbering is relative to the start codon of
acrA), pAcrA3 (-241 to +16), pAcrA4 (-341 to +16), pAcrA5 (-441 to
+16), pAcrA6 (-541 to +16), pAcrA7 (-641 to +16) (A), pAcrA8 (-191 to
+16) (B), pAcrA9 (-151 to +16), pAcrA10 (-161 to +16), pAcrA11 (-171
to +16), and pAcrA12 (-181 to +16) (C). D, nucleotide
sequence in the upstream region of acrA. Boxed sequence corresponds
to the RamA-binding site. The numbers indicate the positions from the
start codon of acrA.RamA-binding site for . A, DNA fragments,
including tolC promoter regions pTolC1 (-80 to -1; the numbering is
relative to the start codon of tolC) and pTolC2 (-100 to +1), were
incubated without (-) or with (+) purified RamA (1.0 μm).
B, nucleotide sequence upstream region of tolC. Boxed
sequence corresponds to the RamA-binding site. The numbers indicate
the positions from the start codon of tolC.Effect of indole and bile on
β-Galactosidase levels were assayed in the WT strain carrying the
ramA reporter plasmid (pNNramA) (NES84). Cells were grown in
LB medium supplemented with 2 mm indole, 0.25 mm cholic
acid, 0.25 mm deoxycholic acid, or 0.25 mm bile salts.
The data correspond to mean values from three independent experiments.
Bars correspond to the standard deviation. Student's t test;
*, p < 0.01 versus control.
DISCUSSION
Very few signals inducing multidrug efflux pumps in Salmonella
have been identified so far
(47,
52). In this study, we found
that indole, bile, and an E. coli conditioned medium induced several
multidrug efflux genes in Salmonella. We found that acrAB
induction by these three signal sources is completely dependent on the
Salmonella-specific regulator RamA, indicating that RamA plays a
major role in inducing acrAB. RamA belongs to the AraC
transcriptional activator family, and activation of RamA is reported to confer
drug resistance on Salmonella
(53). In Salmonella,
RamA is also involved in resistance to superoxide
(54) and in paraquat induction
of the flavohemoglobin gene
(50).The ramA gene appears to be specific for Salmonella
serovars and is absent in many other Gram-negative microorganisms; notable
exceptions are K. pneumoniae and Enterobacter spp.
(54-56).
The results of genomic comparison indicate that the gene organization
surrounding ramA gene and the corresponding region in E.
coli are similar, with two exceptions as follows: the absence of
ramA and the presence of Yi81-2 in E. coli
(57). We suggest that the
AcrAB induction pathway in Salmonella is different from that in
E. coli. Bile induces AcrAB in both Salmonella and E.
coli. In E. coli, the transcriptional factor Rob plays a major
role in inducing acrAB expression in response to bile
(31). However, our data
indicate that bile induction of acrAB in Salmonella is
completely dependent on RamA, not Rob. Other regulators, including MarA, SoxS,
SdiA, and AcrR, are not involved in AcrAB induction by indole and bile. These
results suggest that RamA is a master regulator of SalmonellaacrAB
and may mask the contributions of any other acrAB regulators. In
E. coli, it was reported that multiple regulators, including MarA,
Rob, SoxS, and SdiA, work coordinately in controlling acrAB
expression in response to acrAB inducers. This may be related to the
lack of RamA in E. coli. Indeed, overproduction of RamA has induced
the drug resistance level of E. coli
(53,
57). A recent report suggests
that RamA and RamR, not SoxS and MarA, are involved in AcrAB-mediated
multidrug resistance in Salmonella
(58). Based on our results and
these other studies, RamA appears to be the master regulator of acrAB
in Salmonella.Binding of bile to the RamA protein. A, cholic acid (50
μm) produces a blue shift in the intrinsic spectrum of RamA.
Intrinsic fluorescence of RamA (75 nm) was measured in the absence
or presence of cholic acid. B, cholic acid (10 μm) also
produces a blue shift in the intrinsic spectrum of RamA. C, blue
shift in the intrinsic spectrum of truncated RamA was not produced by 50
μm cholic acid.Proposed model for the expression of In one pathway, bile may bind to the RamA
protein, which is then converted from a low to a high activity state. In the
other path, indole may activate ramA transcription to directly induce
acrA and acrB.We also suggest the existence of a different induction mechanism for
acrAB via the RamA regulator
(Fig. 11). Indole was shown to
induce ramA expression (Fig.
9), and such an increased expression of ramA can induce
acrAB (Fig.
6). On the other hand, bile did not affect expression of
ramA (Fig. 9), but it
did bind to RamA (Fig. 11).
This is reminiscent of the binding of bile to the Rob protein involved in
regulation of acrAB in E. coli
(31). We also suggest that the
N-terminal domain of RamA may be required for binding of bile because cholic
acid did not bind to the truncated RamA
(Fig. 10). Our results suggest
a mechanism in which RamA can change between an “activated state”
and an “overexpressed state” in response to environmental signals,
thereby inducing the AcrAB-TolC system
(Fig. 11). Thus, RamA can be
converted from a low activity state to a high activity state in response to
bile. We also suggest that Salmonella may have an additional sensor
for indole that controls ramA expression
(Fig. 11).
FIGURE 11.
Proposed model for the expression of In one pathway, bile may bind to the RamA
protein, which is then converted from a low to a high activity state. In the
other path, indole may activate ramA transcription to directly induce
acrA and acrB.
Indole and bile are found in various internal human environments,
especially in the intestine
(59,
60). Indole is produced by
many enteric bacterial species
(60), and bile is often
present at high concentration in the intestinal tract
(59). Therefore, RamA may be
required for Salmonella to detect environmental signals and for
subsequent induction of the AcrAB-TolC system, resulting in excretion of toxic
compounds by Salmonella into surrounding environments, such as the
intestine.
Authors: M McClelland; K E Sanderson; J Spieth; S W Clifton; P Latreille; L Courtney; S Porwollik; J Ali; M Dante; F Du; S Hou; D Layman; S Leonard; C Nguyen; K Scott; A Holmes; N Grewal; E Mulvaney; E Ryan; H Sun; L Florea; W Miller; T Stoneking; M Nhan; R Waterston; R K Wilson Journal: Nature Date: 2001-10-25 Impact factor: 49.962
Authors: Ashok K Batta; Gerald Salen; Priti Batta; G Stephen Tint; David S Alberts; David L Earnest Journal: J Chromatogr B Analyt Technol Biomed Life Sci Date: 2002-08-05 Impact factor: 3.205
Authors: Andrew M Bailey; Al Ivens; Rob Kingsley; Jennifer L Cottell; John Wain; Laura J V Piddock Journal: J Bacteriol Date: 2010-01-15 Impact factor: 3.490
Authors: Jeticia R Sistrunk; Kourtney P Nickerson; Rachael B Chanin; David A Rasko; Christina S Faherty Journal: Clin Microbiol Rev Date: 2016-10 Impact factor: 26.132
FIGURE 1.
FIGURE 2.
FIGURE 3.
FIGURE 4.
FIGURE 5.
FIGURE 6.
FIGURE 7.
FIGURE 8.
FIGURE 9.
FIGURE 10.
FIGURE 11.