Meng Amy Li1,2, Paulo P Amaral3, Priscilla Cheung2, Jan H Bergmann4, Masaki Kinoshita1, Tüzer Kalkan1, Meryem Ralser1, Sam Robson3, Ferdinand von Meyenn5, Maike Paramor1, Fengtang Yang6, Caifu Chen7, Jennifer Nichols1, David L Spector4, Tony Kouzarides3, Lin He2, Austin Smith1,8. 1. Wellcome Trust - Medical Research Council Stem Cell Institute, University of Cambridge, Cambridge, United Kingdom. 2. Division of Cellular and Developmental Biology, Department of Molecular and Cellular Biology, University of California Berkeley, Berkeley, United States. 3. The Gurdon Institute, University of Cambridge, Cambridge, United Kingdom. 4. Cold Spring Harbor Laboratory, Cold Spring Harbor, United States. 5. Babraham Institute, Cambridge, United Kingdom. 6. Wellcome Trust Sanger Institute, Hinxton, United Kingdom. 7. Integrated DNA Technologies, Redwood, United States. 8. Department of Biochemistry, University of Cambridge, Cambridge, United Kingdom.
Abstract
Execution of pluripotency requires progression from the naïve status represented by mouse embryonic stem cells (ESCs) to a state capacitated for lineage specification. This transition is coordinated at multiple levels. Non-coding RNAs may contribute to this regulatory orchestra. We identified a rodent-specific long non-coding RNA (lncRNA) linc1281, hereafter Ephemeron (Eprn), that modulates the dynamics of exit from naïve pluripotency. Eprn deletion delays the extinction of ESC identity, an effect associated with perduring Nanog expression. In the absence of Eprn, Lin28a expression is reduced which results in persistence of let-7 microRNAs, and the up-regulation of de novo methyltransferases Dnmt3a/b is delayed. Dnmt3a/b deletion retards ES cell transition, correlating with delayed Nanog promoter methylation and phenocopying loss of Eprn or Lin28a. The connection from lncRNA to miRNA and DNA methylation facilitates the acute extinction of naïve pluripotency, a pre-requisite for rapid progression from preimplantation epiblast to gastrulation in rodents. Eprn illustrates how lncRNAs may introduce species-specific network modulations.
Execution of pluripotency requires progression from the naïve status represented by mouse embryonic stem cells (ESCs) to a state capacitated for lineage specification. This transition is coordinated at multiple levels. Non-coding RNAs may contribute to this regulatory orchestra. We identified a rodent-specific long non-coding RNA (lncRNA) linc1281, hereafter Ephemeron (Eprn), that modulates the dynamics of exit from naïve pluripotency. Eprn deletion delays the extinction of ESC identity, an effect associated with perduring Nanog expression. In the absence of Eprn, Lin28a expression is reduced which results in persistence of let-7 microRNAs, and the up-regulation of de novo methyltransferases Dnmt3a/b is delayed. Dnmt3a/b deletion retards ES cell transition, correlating with delayed Nanog promoter methylation and phenocopying loss of Eprn or Lin28a. The connection from lncRNA to miRNA and DNA methylation facilitates the acute extinction of naïve pluripotency, a pre-requisite for rapid progression from preimplantation epiblast to gastrulation in rodents. Eprn illustrates how lncRNAs may introduce species-specific network modulations.
Entities:
Keywords:
Lin28a/Mirlet7; de novo DNA methylation; developmental biology; long non-coding RNA; mouse; pluripotency; stem cell transition; stem cells
Mouse embryonic stem cells (ESCs), in vitro counterparts of the pre-implantation epiblast, exhibit dual properties of self-renewal and differentiation (Boroviak et al., 2015; Bradley et al., 1984; Evans and Kaufman, 1981; Martin, 1981). These properties make them an attractive system for investigating cell fate decision making. In the embryo, spatially and temporally coordinated signals direct the rapid and continuous transition of the epiblast towards lineage specification (Acampora et al., 2016; Smith, 2017). In contrast, ESCs can be suspended in a ground state of pluripotency, where self-renewal is decoupled from lineage specification, using two inhibitors (2i) of glycogen synthase kinase 3 (GSK3) and mitogen-activated protein kinase kinase (MEK1/2), along with the cytokine leukaemia inhibitory factor (LIF) (Ying et al., 2008). Therefore, ESCs provides a unique experimental system to explore the principles and molecular players underlying the developmental progression of pluripotency (Kalkan and Smith, 2014).While it is increasingly clear that the ESC state is maintained by a core network of transcription factors (Chen et al., 2008; Dunn et al., 2014; Ivanova et al., 2006), less is known about how cells progress from this state to lineage specification (Buecker et al., 2014; Kalkan and Smith, 2014; Smith, 2017). Loss-of-function screens have highlighted a multi-layered machinery that dismantles the naïve state transcription factor network (Betschinger et al., 2013; Leeb et al., 2014). The latency period for transition depends on the clearance kinetics of network components (Dunn et al., 2014). The orchestration of multiple regulators thus ensures rapid and complete dissolution of this core network and consequent timely extinction of ESC identity upon 2i withdrawal (Kalkan and Smith, 2014).In addition to protein coding genes, accumulating evidence suggests that non-coding RNAs can contribute to the regulation of cell fate transitions. Within this class, long non-coding RNAs (lncRNAs) comprise a large fraction of the transcriptome in diverse cell types and exhibit specific spatio-temporal expression (Carninci et al., 2005; Guttman et al., 2009; Necsulea et al., 2014). The genomic distribution of lncRNAs is non-random (Luo et al., 2016). A subclass of lncRNAs are divergently transcribed from neighbouring genes and thought to regulate proximal gene expression in cis, either due to the process of transcription (Ebisuya et al., 2008; Engreitz et al., 2016; Martens et al., 2004) or through local lncRNA-protein interactions that recruit regulatory complexes (Lai et al., 2013; Lee, 2012; Luo et al., 2016; Nagano et al., 2008). However, the functions and mode of action of the vast majority of lncRNAs remain unknown and require case-by-case experimental determination. In mouse ESCs, knockdowns of a number of lncRNAs have been reported to exert effects on the transcriptome (Bergmann et al., 2015; Dinger et al., 2008; Guttman et al., 2011; Lin et al., 2014; Sheik Mohamed et al., 2010) and in some cases impair self-renewal (Lin et al., 2014; Luo et al., 2016; Savić et al., 2014).We investigated the potential involvement of lncRNAs in transition from the naïve ESC state and identified a dynamically regulated lncRNA (linc1281) that we named Ephemeron (Eprn). We present functional evaluation of Eprn and delineation of a downstream genetic interaction network, which is an additional component of the regulatory machinery driving the irreversible and rapid progression from naïve pluripotency in rodent.
Results
Identification of lncRNAs associated with transition from naïve pluripotency
Post-implantation epiblast derived stem cells (EpiSCs) represent a primed state of pluripotency developmentally downstream of naïve state ESCs (Brons et al., 2007; Nichols and Smith, 2009; Tesar et al., 2007). To identify lncRNA candidates with a possible role in ESC transition, we analysed in silico the effect of genetic perturbation on expression of ESC and EpiSC states based on published data. We first selected genes that are over ten-fold differentially enriched in ESCs (182 genes) and EpiSCs (131 genes) relative to each other as molecular signatures to represent these two states (Tesar et al., 2007). Using published data, we investigated the impact on these two signature sets when individual lncRNAs (147 in total) and known protein coding regulators (40 in total) were knocked down in ESCs grown in LIF/serum (Guttman et al., 2011) (Figure 1A, Figure 1—source data 1). Serum culture supports a heterogeneous mixture of naïve, primed and intermediate cells (Chambers et al., 2007; Kolodziejczyk et al., 2015; Marks et al., 2012). Therefore, analysis in this condition could potentially reveal regulators of the ESC and EpiSC states. The effect of each gene knockdown was plotted based on the percentage of genes significantly altered within ESC and EpiSC signature sets (FDR < 0.05 and fold change >2 or<0.5 over negative control defined by the original study). We validated the approach by analysing the knockdown effects of known ESC self-renewal regulators. As predicted, depletion of factors that maintain the ESC state, such as Stat3, Esrrb, Sox2 and Klf4, led to a decrease in ESC and increase in EpiSC signature (Figure 1A), while knockdown of Oct4 gave rise to a decrease in both ESC and EpiSC signatures, consistent with its requirement in both states (Niwa et al., 2000; Osorno et al., 2012). With this system, we identified lncRNAs that increased ESC and decreased EpiSC signatures when knocked down, suggestive of a possible role in transition from the ESC state (Figure 1A bottom right quadrant).
Figure 1.
Dynamic expression of lncRNA Ephemeron during exit from naïve pluripotency.
(A) Bioinformatic analysis of potential lncRNA candidates in naïve state regulation based on published transcriptome data for lncRNA and pluripotency related gene knockdowns. Each dot represents the effect on ESC (x-axis) and EpiSC (y-axis) gene signatures when a given gene is knocked down. (B) RT-qPCR detection of Eprn expression relative to β-actin upon 2i/LIF withdrawal. Mean ±SD, n = 3. (C) Northern blotting of Eprn, Nanog and β-actin in ESCs in 2i/LIF or withdrawn from 2i/LIF for 24 hr, EpiSCs and MEF. * indicates a cross-hybridising RNA species since part of the probe region overlaps with LINE1-L1 and ERVK TEs. (D) RNA-FISH for Eprn upon 2i/LIF withdrawal with quantification of average hybridisation signals per cell. Mean value of total hybridisation signals for all cells ± SD, n = 2. (E) Eprn expression relative to β-actin upon 2i/LIF component withdrawal quantified by RT-qPCR. Cells cultured in 2i/LIF and were transferred to N2B27 containing indicated single or dual factors for 24 hr. Mean ±SD, n = 3. F, Eprn expression relative to β-actin upon PD/LIF withdrawal quantified by RT-qPCR. Mean ± SD, n = 3.
DOI:
http://dx.doi.org/10.7554/eLife.23468.002
DOI:
http://dx.doi.org/10.7554/eLife.23468.003
The genomic coordinates are based on mouse GRCm38/mm10 assembly.
DOI:
http://dx.doi.org/10.7554/eLife.23468.004
(A) Eprn locus structure, TE content and mammalian conservation. The positions of Northern blotting, RNA-FISH and ChIRP probes were indicated. Note that Northern blotting probe region overlaps with a LINE element. Eprn expression was detectable by FANTOM5 CAGE expression. (B) Eprn expression upon 2i withdrawal in cells fractionated based on Rex1-GFP expression. 25hH and 25hL: Rex1-GFP high and low cells respectively sorted at 25 hr post 2i withdrawal. (C) Sequence alignment of Exon3 of Eprn and a rat EST transcribed from the syntenic region. Eprn EST, mouse AK131952; rat EST, CA504619. (D) Northern blot of wild type and Eprn KO cells in 2i/LIF and 24 hr post 2i/LIF withdrawal. * non-specific hybridisation. 28S and 18S gel electrophoresis served as loading control. (E) 5’RACE sequence confirming the 5’ start of Eprn RNA. (F) 3’RACE sequence confirming the 3’ end of Eprn RNA. (G) Eprn expression relative to β-actin measured by RT-qPCR upon 2i/LIF component addition to LIF/serum (LS) culture. PD or/and CH were added to cells maintained in LIF/serum for indicated time. Mean ±SD, n = 3.
DOI:
http://dx.doi.org/10.7554/eLife.23468.005
(A) Eprn expression in early embryo development based on data from Boroviak et al. (2015). Mean ± S.E. n = 3. (B) Eprn expression in later stages of embryo development and a panel of adult tissues relative to Hprt. Mean ± SD, n = 3. (C) Eprn expression during EpiSC resetting. Mean ± SD, n = 3. (D) Eprn expression in established iPS clones. Mean ±SD, n = 3. (E) Percentage of CpG methylation at Eprn promoter, average of all promoters, and genome average upon 2i withdrawal and during early embryo development. Data are from Kalkan et al. (2017), Seisenberger et al. (2012), and Wang et al. (2014).
DOI:
http://dx.doi.org/10.7554/eLife.23468.006
Dynamic expression of lncRNA Ephemeron during exit from naïve pluripotency.
(A) Bioinformatic analysis of potential lncRNA candidates in naïve state regulation based on published transcriptome data for lncRNA and pluripotency related gene knockdowns. Each dot represents the effect on ESC (x-axis) and EpiSC (y-axis) gene signatures when a given gene is knocked down. (B) RT-qPCR detection of Eprn expression relative to β-actin upon 2i/LIF withdrawal. Mean ±SD, n = 3. (C) Northern blotting of Eprn, Nanog and β-actin in ESCs in 2i/LIF or withdrawn from 2i/LIF for 24 hr, EpiSCs and MEF. * indicates a cross-hybridising RNA species since part of the probe region overlaps with LINE1-L1 and ERVK TEs. (D) RNA-FISH for Eprn upon 2i/LIF withdrawal with quantification of average hybridisation signals per cell. Mean value of total hybridisation signals for all cells ± SD, n = 2. (E) Eprn expression relative to β-actin upon 2i/LIF component withdrawal quantified by RT-qPCR. Cells cultured in 2i/LIF and were transferred to N2B27 containing indicated single or dual factors for 24 hr. Mean ±SD, n = 3. F, Eprn expression relative to β-actin upon PD/LIF withdrawal quantified by RT-qPCR. Mean ± SD, n = 3.DOI:
http://dx.doi.org/10.7554/eLife.23468.002
Bioinformatics analysis of all lncRNAs and protein coding genes plotted in Figure 1A.
DOI:
http://dx.doi.org/10.7554/eLife.23468.003
Expression of potential lncRNA candidates in facilitating naïve state exit.
The genomic coordinates are based on mouse GRCm38/mm10 assembly.DOI:
http://dx.doi.org/10.7554/eLife.23468.004
Molecular characterisation of Ephemeron.
(A) Eprn locus structure, TE content and mammalian conservation. The positions of Northern blotting, RNA-FISH and ChIRP probes were indicated. Note that Northern blotting probe region overlaps with a LINE element. Eprn expression was detectable by FANTOM5 CAGE expression. (B) Eprn expression upon 2i withdrawal in cells fractionated based on Rex1-GFP expression. 25hH and 25hL: Rex1-GFP high and low cells respectively sorted at 25 hr post 2i withdrawal. (C) Sequence alignment of Exon3 of Eprn and a rat EST transcribed from the syntenic region. Eprn EST, mouse AK131952; rat EST, CA504619. (D) Northern blot of wild type and Eprn KO cells in 2i/LIF and 24 hr post 2i/LIF withdrawal. * non-specific hybridisation. 28S and 18S gel electrophoresis served as loading control. (E) 5’RACE sequence confirming the 5’ start of Eprn RNA. (F) 3’RACE sequence confirming the 3’ end of Eprn RNA. (G) Eprn expression relative to β-actin measured by RT-qPCR upon 2i/LIF component addition to LIF/serum (LS) culture. PD or/and CH were added to cells maintained in LIF/serum for indicated time. Mean ±SD, n = 3.DOI:
http://dx.doi.org/10.7554/eLife.23468.005
Eprn expression and promoter methylation.
(A) Eprn expression in early embryo development based on data from Boroviak et al. (2015). Mean ± S.E. n = 3. (B) Eprn expression in later stages of embryo development and a panel of adult tissues relative to Hprt. Mean ± SD, n = 3. (C) Eprn expression during EpiSC resetting. Mean ± SD, n = 3. (D) Eprn expression in established iPS clones. Mean ±SD, n = 3. (E) Percentage of CpG methylation at Eprn promoter, average of all promoters, and genome average upon 2i withdrawal and during early embryo development. Data are from Kalkan et al. (2017), Seisenberger et al. (2012), and Wang et al. (2014).DOI:
http://dx.doi.org/10.7554/eLife.23468.006We examined expression profiles of these candidate lncRNAs during exit from self-renewal in defined conditions, exploiting the Rex1::GFP (RGd2) reporter ESC cell line (Kalkan et al., 2017; Wray et al., 2011) (Figure 1—source data 2). Upon 24 hr of 2i withdrawal, Rex1 expression status can discriminate subpopulations of cells with distinct functional properties, with Rex1-GFP high cells corresponding to undifferentiated ESCs and loss of GFP marking extinction of ESC identity (Kalkan et al., 2017). Amongst the 16 candidates analysed, linc1281 (Refseq entry D630045M09Rik) (Figure 1—figure supplement 1A) was the third highest expressed lncRNA across all time points. Notably this lncRNA showed a distinctive profile during the first 24 hr, with differential expression observed between Rex1-GFP high and low cells (Figure 1B, Figure 1—figure supplement 1B). Due to its dynamic and transient expression profile, we designated linc1281 as Ephemeron (Eprn). Ribosomal profiling analysis indicated that Eprn is indeed a non-coding RNA, with the longest predicted open reading frame (80 amino acids) possessing a ribosome release score typical of a non-coding sequence (Guttman et al., 2013). Eprn is located in a region of high transposable element (TE) content, with its exons comprised of 76.4% annotated TE sequences (including ERV-K, LINE L1, and SINE B2 elements, Figure 1—figure supplement 1A). This genomic region exhibits minimal sequence conservation in mammals (Figure 1—figure supplement 1A) and we failed to identify any human homologue either within the syntenic region or elsewhere in the human genome. However, a positionally conserved spliced transcript (CA504619) that shares 79% sequence identity to exon 3 of mouse Eprn is present within the rat syntenic region (Figure 1—figure supplement 1C). Therefore, it is likely that Eprn is conserved in rodents over 30 million years since the mouse-rat lineage divergence.
Figure 1—figure supplement 1.
Molecular characterisation of Ephemeron.
(A) Eprn locus structure, TE content and mammalian conservation. The positions of Northern blotting, RNA-FISH and ChIRP probes were indicated. Note that Northern blotting probe region overlaps with a LINE element. Eprn expression was detectable by FANTOM5 CAGE expression. (B) Eprn expression upon 2i withdrawal in cells fractionated based on Rex1-GFP expression. 25hH and 25hL: Rex1-GFP high and low cells respectively sorted at 25 hr post 2i withdrawal. (C) Sequence alignment of Exon3 of Eprn and a rat EST transcribed from the syntenic region. Eprn EST, mouse AK131952; rat EST, CA504619. (D) Northern blot of wild type and Eprn KO cells in 2i/LIF and 24 hr post 2i/LIF withdrawal. * non-specific hybridisation. 28S and 18S gel electrophoresis served as loading control. (E) 5’RACE sequence confirming the 5’ start of Eprn RNA. (F) 3’RACE sequence confirming the 3’ end of Eprn RNA. (G) Eprn expression relative to β-actin measured by RT-qPCR upon 2i/LIF component addition to LIF/serum (LS) culture. PD or/and CH were added to cells maintained in LIF/serum for indicated time. Mean ±SD, n = 3.
DOI:
http://dx.doi.org/10.7554/eLife.23468.005
We conducted RT-qPCR, Northern blotting and RNA-FISH to evaluate expression, transcription variants and subcellular localisation of Eprn in ESCs. Eprn showed strong induction within 12 hr of 2i/LIF withdrawal, but decreased subsequently (Figure 1B–D). In EpiSCs or mouse embryonic fibroblasts (MEFs), Eprn expression was below the detection limit (Figure 1C). Consistent with the UCSC gene annotation, Northern blotting of total ESC RNA confirmed the expression of a single Eprn transcript over 1 kb in length (Figure 1C, Figure 1—figure supplement 1D). Transcription start and end sites of Eprn mapped by 5’ and 3’ RACE were in agreement with the annotation (Figure 1—figure supplement 1E,F). After 24 hr of 2i/LIF withdrawal, Eprn RNA-FISH hybridisation signals displayed predominantly cytoplasmic localisation, but from 48 hr onwards the remaining signals were mostly in the nucleus (Figure 1D).To explore the regulation of Eprn, two inhibitors and LIF were withdrawn singly or dually for 24 hr. In conditions lacking Gsk3 inhibitor CHIRON99021 (CH), Eprn was upregulated (Figure 1E). When transferred to non-supplemented N2B27 medium from PD/LIF, Eprn expression was maintained for 24 hr before declining (Figure 1F). The addition of CH to LIF/serum culture reduced Eprn expression within 24 hr irrespective of the presence of MEK inhibitor PD0325901 (PD) (Figure 1—figure supplement 1G,H). Therefore, Eprn is suppressed by CH in self-renewing ESCs.Through analysis of published data, we found that during early mouse development, Eprn expression peaked at E4.5 and was present in both epiblast and primitive endoderm of the mature blastocyst, but absent or low in E5.5 post-implantation epiblast (Figure 1—figure supplement 2A) and later stages between E7 and E17 (Figure 1—figure supplement 2B). Amongst adult tissues analysed, Eprn was only detected in kidney, and at a much lower level than in ESCs. We also observed that Eprn expression is restored upon naïve state resetting from EpiSCs (Guo et al., 2009; Yang et al., 2010) (Figure 1—figure supplement 2C,D). We conclude that Eprn expression is highly specific to ESCs and the early mouse embryo.
Figure 1—figure supplement 2.
Eprn expression and promoter methylation.
(A) Eprn expression in early embryo development based on data from Boroviak et al. (2015). Mean ± S.E. n = 3. (B) Eprn expression in later stages of embryo development and a panel of adult tissues relative to Hprt. Mean ± SD, n = 3. (C) Eprn expression during EpiSC resetting. Mean ± SD, n = 3. (D) Eprn expression in established iPS clones. Mean ±SD, n = 3. (E) Percentage of CpG methylation at Eprn promoter, average of all promoters, and genome average upon 2i withdrawal and during early embryo development. Data are from Kalkan et al. (2017), Seisenberger et al. (2012), and Wang et al. (2014).
DOI:
http://dx.doi.org/10.7554/eLife.23468.006
LINE and ERVL-MaLR elements are present within the Eprn proximal promoter region (2 kb upstream of TSS) (Figure 1—figure supplement 1A). Such repetitive elements gain DNA CpG methylation dramatically during pre- to post-implantation transition (Smith et al., 2014). By examining published data from embryos (Seisenberger et al., 2012; Wang et al., 2014) and ESC progression in vitro (Kalkan et al., 2017), we found that CpG methylation gain at the Eprn promoter was more extensive in the primed E6.5 epiblast (3% to 80%) than the average changes across all promoters (9% to 35%) or the genome (24% to 70%) (Figure 1—figure supplement 2E). In contrast, no major CpG methylation gain at Eprn promoter was present 24 hr post 2i withdrawal. These data suggest that promoter methylation does not initiate Eprn repression, but could contribute to maintain silencing in later epiblast.
Loss of Ephemeron delays exit from naïve pluripotency
Initiation of ESC differentiation in defined media upon withdrawal of self-renewal factors recapitulates features of peri-implantation epiblast development (Kalkan et al., 2017). The latency of naïve state exit varies, however, according to the starting self-renewal condition (Dunn et al., 2014; Wray et al., 2011). Higher activity of the core network in PD/LIF compared with 2i results in slower network dissolution, reflected in later onset of RGd2 downregulation (Dunn et al., 2014). These two conditions feature different levels of Eprn due to CH mediated suppression in 2i (Figure 1E). We generated Eprn knockout (KO) ESCs via sequential gene targeting (Figure 2—figure supplement 1) and examined the phenotype in each condition. In steady state self-renewal, Eprn loss did not affect the Rex1-GFP profile in either case (Figure 2A,B). Upon transfer to N2B27, Eprn KO cells displayed delayed downregulation of GFP compared to parental cells, measured at 24 hr from 2i culture and 40 hr from PD/LIF culture (Figure 2B). By 72 hr, however, GFP expression was fully extinguished from either starting condition (Figure 2—figure supplement 2A). A transient delay in GFP downregulation in both culture conditions was also evident upon Eprn knockdown using siRNAs (Figure 2—figure supplement 2B). To assess the effect of Eprn depletion functionally, we conducted colony forming assays. Cells maintained in PD/LIF were subjected to 40 hr culture in N2B27 and then replated at clonal density in 2i/LIF to assay the persistence of ES self-renewal potential (Betschinger et al., 2013). Eprn KO and knockdown cells both gave rise to substantially more undifferentiated colonies than wild type controls (Figure 2C,D, Figure 2—figure supplement 2C). Considered together, these results indicate that Eprn deficiency impairs timely exit from naïve pluripotency.
Figure 2—figure supplement 1.
Generation of Eprn KO ESCs.
(A) Targeting vector, gene targeting and Southern blotting validation strategies. (B) Southern blotting confirming knockout of the first allele using an external probe. (C) Triple primer PCR confirming ESC clones with both alleles targeted. Wild type (wt) and single allele targeted (Het) ESCs were used as PCR controls. M, molecular marker. Primer sequences are shown in the Supplementary file 1C.
DOI:
http://dx.doi.org/10.7554/eLife.23468.008
Figure 2.
Absence of Ephemeron delays exit from naïve pluripotency.
(A) Experimental scheme for analysing naïve state exit using Rex1GFPd2 reporter cells. (B) Rex1-GFP flow cytometry profiles of wild type and Eprn KO cells in 2i and PD/LIF and during transition from these starting conditions. Two independent clones for wild type and Eprn KO cells were analysed. Percentage of GFP high cells were quantified. (C) Experimental scheme for colony formation assay. (D) Colony formation assay for wild type and Eprn KO cells in 2i/LIF 40 hr post PD/LIF withdrawal. Colonies were stained with alkaline phosphatase (AP), with representative images shown. Percentage clonogenicity was calculated by the number of AP positive colonies divided by the total number of cells plated. Mean ± SD, n = 3. (E) Lin28a and Nanog expression relative to β-actin in three independent wild type and Eprn KO cell lines measured by RT-qPCR. Mean ± SE, n = 3. *p<0.05, **p<0.01, student’s t-test. (F) Nanog and Lin28a expression kinetics upon PD/LIF withdrawal in wild type and Eprn KO cells. Mean ± SD, n = 3. (G) Rex1-GFP flow cytometry profile for wild type, Eprn KO and Eprn rescue cells 40 hr post PD/LIF withdrawal. Percentage of GFP high cells were quantified.
DOI:
http://dx.doi.org/10.7554/eLife.23468.007
(A) Targeting vector, gene targeting and Southern blotting validation strategies. (B) Southern blotting confirming knockout of the first allele using an external probe. (C) Triple primer PCR confirming ESC clones with both alleles targeted. Wild type (wt) and single allele targeted (Het) ESCs were used as PCR controls. M, molecular marker. Primer sequences are shown in the Supplementary file 1C.
DOI:
http://dx.doi.org/10.7554/eLife.23468.008
(A) Rex1-GFP flow cytometry profile over 2i and PD/LIF withdrawal time course for wild type and Eprn KO cells. (B) Rex1-GFP flow cytometry profile of Eprn knockdown in 2i and PD/LIF and after 24 hr and 40 hr in N2B27 respectively. (C) Colony formation capacity of Eprn knockdown cells 40 hr post PD/LIF withdrawal. Mean ± SD, n = 3. Representative AP staining images are shown. (D) Volcano plots of differentially expressed genes in Eprn KO compared to wild type ESC in PD/LIF and 8 hr after PD/LIF withdrawal. Red dots, statistically significant genes (Benjamini-Hochberg adjusted p<0.05) based on three independent wild type and KO lines. (E) Significantly differential expressed genes common in both PD/LIF and 8 hr N2B27 conditions with fold change >1.5 or <0.7. (F) Expression relative to β-actin of core naïve pluripotency factor network and peri-implantation epiblast genes in wild type and Eprn KO ESCs upon PD/LIF withdrawal. Mean ± SD, n = 3. *p<0.05, student t-test; n.s. not statistically significant.
DOI:
http://dx.doi.org/10.7554/eLife.23468.009
(A) Generation of Eprn KO rescue cells by knock-in of the human EF1a promoter driving the genomic region containing all Eprn exons. The EF1a promoter TSS site was cloned to be directly upstream of the first base of Eprn exon 1. (B) Long-range PCR genotyping of targeted clone. 5’ long range PCR product, 6 kb; 3’ long range PCR product, 6.2 kb. (C) Expression of Eprn, Lin28a and Nanog relative to β-actin in PD/LIF measured by RT-qPCR. Mean ± SD, n = 3.
DOI:
http://dx.doi.org/10.7554/eLife.23468.010
(A,B) naïve associated (A) and early peri-implantation epiblast associated (B) gene expression relative to β-actin in wild type and Eprn KO ESC derived EpiSCs. Mean ± SD, n = 3. (C) Neuronal differentiation protocol and gene expression of wild type and Eprn KO ESCs relative to β-actin. Mean ± SD, n = 3. (D) Definitive endoderm differentiation protocol and gene expression of wild type and Eprn KO ESCs relative to β-actin. Mean ± SD, n = 3. (E) Mesendoderm differentiation protocol and gene expression of wild type and Eprn KO ESCs relative to β-actin. Mean ± SD, n = 3.
DOI:
http://dx.doi.org/10.7554/eLife.23468.011
Figure 2—figure supplement 2.
Phenotypic and molecular characterisation of Eprn KO during naïve state exit.
(A) Rex1-GFP flow cytometry profile over 2i and PD/LIF withdrawal time course for wild type and Eprn KO cells. (B) Rex1-GFP flow cytometry profile of Eprn knockdown in 2i and PD/LIF and after 24 hr and 40 hr in N2B27 respectively. (C) Colony formation capacity of Eprn knockdown cells 40 hr post PD/LIF withdrawal. Mean ± SD, n = 3. Representative AP staining images are shown. (D) Volcano plots of differentially expressed genes in Eprn KO compared to wild type ESC in PD/LIF and 8 hr after PD/LIF withdrawal. Red dots, statistically significant genes (Benjamini-Hochberg adjusted p<0.05) based on three independent wild type and KO lines. (E) Significantly differential expressed genes common in both PD/LIF and 8 hr N2B27 conditions with fold change >1.5 or <0.7. (F) Expression relative to β-actin of core naïve pluripotency factor network and peri-implantation epiblast genes in wild type and Eprn KO ESCs upon PD/LIF withdrawal. Mean ± SD, n = 3. *p<0.05, student t-test; n.s. not statistically significant.
DOI:
http://dx.doi.org/10.7554/eLife.23468.009
Absence of Ephemeron delays exit from naïve pluripotency.
(A) Experimental scheme for analysing naïve state exit using Rex1GFPd2 reporter cells. (B) Rex1-GFP flow cytometry profiles of wild type and Eprn KO cells in 2i and PD/LIF and during transition from these starting conditions. Two independent clones for wild type and Eprn KO cells were analysed. Percentage of GFP high cells were quantified. (C) Experimental scheme for colony formation assay. (D) Colony formation assay for wild type and Eprn KO cells in 2i/LIF 40 hr post PD/LIF withdrawal. Colonies were stained with alkaline phosphatase (AP), with representative images shown. Percentage clonogenicity was calculated by the number of AP positive colonies divided by the total number of cells plated. Mean ± SD, n = 3. (E) Lin28a and Nanog expression relative to β-actin in three independent wild type and Eprn KO cell lines measured by RT-qPCR. Mean ± SE, n = 3. *p<0.05, **p<0.01, student’s t-test. (F) Nanog and Lin28a expression kinetics upon PD/LIF withdrawal in wild type and Eprn KO cells. Mean ± SD, n = 3. (G) Rex1-GFP flow cytometry profile for wild type, Eprn KO and Eprn rescue cells 40 hr post PD/LIF withdrawal. Percentage of GFP high cells were quantified.DOI:
http://dx.doi.org/10.7554/eLife.23468.007
Generation of Eprn KO ESCs.
(A) Targeting vector, gene targeting and Southern blotting validation strategies. (B) Southern blotting confirming knockout of the first allele using an external probe. (C) Triple primer PCR confirming ESC clones with both alleles targeted. Wild type (wt) and single allele targeted (Het) ESCs were used as PCR controls. M, molecular marker. Primer sequences are shown in the Supplementary file 1C.DOI:
http://dx.doi.org/10.7554/eLife.23468.008
Phenotypic and molecular characterisation of Eprn KO during naïve state exit.
(A) Rex1-GFP flow cytometry profile over 2i and PD/LIF withdrawal time course for wild type and Eprn KO cells. (B) Rex1-GFP flow cytometry profile of Eprn knockdown in 2i and PD/LIF and after 24 hr and 40 hr in N2B27 respectively. (C) Colony formation capacity of Eprn knockdown cells 40 hr post PD/LIF withdrawal. Mean ± SD, n = 3. Representative AP staining images are shown. (D) Volcano plots of differentially expressed genes in Eprn KO compared to wild type ESC in PD/LIF and 8 hr after PD/LIF withdrawal. Red dots, statistically significant genes (Benjamini-Hochberg adjusted p<0.05) based on three independent wild type and KO lines. (E) Significantly differential expressed genes common in both PD/LIF and 8 hr N2B27 conditions with fold change >1.5 or <0.7. (F) Expression relative to β-actin of core naïve pluripotency factor network and peri-implantation epiblast genes in wild type and Eprn KO ESCs upon PD/LIF withdrawal. Mean ± SD, n = 3. *p<0.05, student t-test; n.s. not statistically significant.DOI:
http://dx.doi.org/10.7554/eLife.23468.009
Generation of Ephemeron KO rescue ESCs.
(A) Generation of Eprn KO rescue cells by knock-in of the human EF1a promoter driving the genomic region containing all Eprn exons. The EF1a promoter TSS site was cloned to be directly upstream of the first base of Eprn exon 1. (B) Long-range PCR genotyping of targeted clone. 5’ long range PCR product, 6 kb; 3’ long range PCR product, 6.2 kb. (C) Expression of Eprn, Lin28a and Nanog relative to β-actin in PD/LIF measured by RT-qPCR. Mean ± SD, n = 3.DOI:
http://dx.doi.org/10.7554/eLife.23468.010
Differentiation capacity of Eprn KO ESCs.
(A,B) naïve associated (A) and early peri-implantation epiblast associated (B) gene expression relative to β-actin in wild type and Eprn KO ESC derived EpiSCs. Mean ± SD, n = 3. (C) Neuronal differentiation protocol and gene expression of wild type and Eprn KO ESCs relative to β-actin. Mean ± SD, n = 3. (D) Definitive endoderm differentiation protocol and gene expression of wild type and Eprn KO ESCs relative to β-actin. Mean ± SD, n = 3. (E) Mesendoderm differentiation protocol and gene expression of wild type and Eprn KO ESCs relative to β-actin. Mean ± SD, n = 3.DOI:
http://dx.doi.org/10.7554/eLife.23468.011
Molecular consequences of Ephemeron loss
We performed RNA-sequencing and compared the transcriptome of wild type and Eprn KO ESCs using three independently targeted KO ESC lines and three subclones of the parental wild type ESCs. Sixteen genes were differentially expressed between wild type and Eprn KO cells both in PD/LIF and after 8 hr withdrawal (Benjamini-Hochberg adjusted p<0.05, fold change >1.5 or<0.7) (Figure 2—figure supplement 2D) (Figure 2—figure supplement 2E). These include Tcf15, which has been associated with transition from the naïve state and has an inverse expression pattern compared to naïve pluripotency factors (Davies et al., 2013). Lin28a was the most differentially expressed gene in the group, with Eprn KO cells displaying a twofold reduction in mean expression level (Figure 2E). Although Lin28a is commonly considered as a core pluripotency factor, its expression is actually increased when cells transition out of the naïve state in vivo and in vitro (Boroviak et al., 2015; Kalkan et al., 2017; Kumar et al., 2014; Marks et al., 2012). Attenuated downregulation of members of the naïve transcription factor network is one explanation for delayed exit from the ESC state (Kalkan and Smith, 2014). We hypothesised that Lin28a could be a negative regulator of the network. We examined expression of naïve pluripotency transcription factors in Eprn KO cells and found a higher level of Nanog mRNA (Figure 2E, Figure 2—figure supplement 2F). To characterise the profile of naïve pluripotency dissolution further in Eprn KO cells, a PD/LIF withdrawal time course was monitored over 24 hr. The two-fold reduction in Lin28a mRNA in Eprn KO cells was constant throughout this time course (Figure 2F). Conversely, Nanog transcript and protein levels remained higher at 16 hr and 24 hr respectively (Figure 2F, see also 3E,F for protein). Mean Klf2 transcript levels appeared higher in Eprn KO cells, but below statistical significance. Other members of the naïve network showed similar expression profiles in wild type and Eprn KO cells (Figure 2—figure supplement 2F). Among peri-implantation epiblast markers, upregulation kinetics for Fgf5 were unchanged in Eprn KO cells, but transcripts for Dnmt3a, Dnmt3b and Oct6 remained lower from 16 to 24 hr (Figure 2—figure supplement 2F). Although not statistically significant, Otx2 transcripts appeared modestly reduced throughout the time course, which could be related to the elevated expression of Nanog (Acampora et al., 2016).We restored Eprn expression in KO cells by inserting the Eprn genomic region under control of the human EF1α promoter into the deleted locus (Figure 2—figure supplement 3A,B). The rescue cells displayed a wild type exit profile as measured by GFP profile 40 hr post PD/LIF withdrawal (Figure 2G). Lin28a and Nanog expression levels were similar to wild type cells (Figure 2—figure supplement 3C).
Figure 2—figure supplement 3.
Generation of Ephemeron KO rescue ESCs.
(A) Generation of Eprn KO rescue cells by knock-in of the human EF1a promoter driving the genomic region containing all Eprn exons. The EF1a promoter TSS site was cloned to be directly upstream of the first base of Eprn exon 1. (B) Long-range PCR genotyping of targeted clone. 5’ long range PCR product, 6 kb; 3’ long range PCR product, 6.2 kb. (C) Expression of Eprn, Lin28a and Nanog relative to β-actin in PD/LIF measured by RT-qPCR. Mean ± SD, n = 3.
DOI:
http://dx.doi.org/10.7554/eLife.23468.010
To explore the differentiation capacity of Eprn KO cells, we conducted in vitro differentiation assays directing ESCs towards EpiSCs and somatic lineages (Figure 2—figure supplement 4). Both wild type and Eprn KO ESCs could be differentiated into EpiSCs using N2B27 supplemented with ActivinA/Fgf2/XAV939 (Sumi et al., 2013) on fibronectin. Such in vitro differentiated EpiSCs could be stably propagated over multiple passages, and displayed typical morphology and gene expression irrespective of genotype (Figure 2—figure supplement 4A,B). We also applied neuronal, mesendoderm and definitive endoderm differentiation protocols to Eprn KO ESCs and found that lineage markers were induced, with a slight delay for mesendoderm (Figure 2—figure supplement 4C–E). Thus retarded naïve state exit does not notably impair subsequent lineage commitment capacity.
Figure 2—figure supplement 4.
Differentiation capacity of Eprn KO ESCs.
(A,B) naïve associated (A) and early peri-implantation epiblast associated (B) gene expression relative to β-actin in wild type and Eprn KO ESC derived EpiSCs. Mean ± SD, n = 3. (C) Neuronal differentiation protocol and gene expression of wild type and Eprn KO ESCs relative to β-actin. Mean ± SD, n = 3. (D) Definitive endoderm differentiation protocol and gene expression of wild type and Eprn KO ESCs relative to β-actin. Mean ± SD, n = 3. (E) Mesendoderm differentiation protocol and gene expression of wild type and Eprn KO ESCs relative to β-actin. Mean ± SD, n = 3.
DOI:
http://dx.doi.org/10.7554/eLife.23468.011
The Ephemeron genetic network includes Lin28a and Nanog
Based on the preceding data, we hypothesised that Lin28a could be a downstream effector of Eprn, acting to reduce expression of Nanog. To characterise further the relationship between Eprn, Lin28a and the naïve transcription factor network, we carried out a series of genetic perturbation experiments and measured both Rex1-GFP reporter dynamics and colony formation upon withdrawal from PD/LIF. In Eprn KO cells, Nanog knockdown partially restored downregulation of Rex1-GFP 40 hr after PD/LIF withdrawal, and colony formation was reduced to the low level observed in wild type cells subjected to Nanog siRNA (Figure 3A). Knockdown of Klf4 had no effect on exit kinetics from PD/LIF in either wild type or Eprn KO cells. Knockdowns of other naïve transcription factors, Esrrb, Tfcp2l1 and Klf2, accelerated exit in wild type cells but in contrast to Nanog depletion this phenotype was attenuated in Eprn KO cells (Figure 3—figure supplement 1B). Resistance of Eprn KO cells to accelerated transition upon Esrrb, Tfcp2l1 and Klf2 knockdown could be attributed to elevated Nanog. We therefore conducted dual knockdown experiments (Figure 3—figure supplement 1C). Simultaneous depletion of Esrrb, Tfcp2l1 or Klf2 together with Nanog largely abolished the effect of Eprn KO on GFP downregulation (Figure 3—figure supplement 1C,D). These data are consistent with Eprn acting, at least in part, via modulation of Nanog expression.
Figure 3.
Lin28a is downstream of Ephemeron and regulates Nanog expression.
(A) Rex1-GFP flow cytometry profiles (Left) and colony formation capacity (Right) 40 hr post PD/LIF withdrawal for wild type and Eprn KO cells transfected with indicated siRNAs. (B) Rex1-GFP flow cytometry profiles and colony formation capacity 40 hr post PD/LIF withdrawal for wild type and Eprn KO cells transfected with Lin28a expression vector. (C) Rex1-GFP flow cytometry profile and colony formation capacity 40 hr post PD/LIF withdrawal with Nanog and Lin28a single or dual knockdowns in wild type cells. Quantification of percentage of GFP high cells were shown in (A-C). Percentage clonogenicity in (A-C) is measured by the number of AP positive colonies divided by the total number of cells plated, with representative AP staining images shown. Mean ± SD, n = 3. (D) Lin28a and Nanog expression relative to β-actin upon PD/LIF withdrawal in Lin28a knockdown and control cells. Mean ± SD, n = 3. *p<0.05, Student’s t-test. (E) Correlation of Nanog and Lin28a protein expression immunostaining in wild type and Eprn KO cells 24 hr post PD/LIF withdrawal. (F) Representative images of cells co-immunostained with Nanog and Lin28a and quantified in E.
DOI:
http://dx.doi.org/10.7554/eLife.23468.012
(A) Rex1-GFP profiles of indicated genetic manipulations of wild type and Eprn KO cells in PD/LIF and 40 hr post PD/LIF withdrawal, related to Figure 3A–C. (B) Knockdown effects of several core pluripotency network factors on Rex1-GFP profile in wild type and Eprn KO cells in PD/LIF and upon 40 hr withdrawal. (C) Rex1-GFP profiles upon knockdown of core pluripotency factors singly or together with Nanog in wild type and Eprn KO cells at 40 hr post PD/LIF withdrawal. (D) Quantification of Rex1-GFP high population as gated in C in wild type and Eprn KO cells. (E) Representative immunostaining images of wild type and Eprn KO cells cultured in PD/LIF. (F) Correlation analysis of Nanog and Lin28a protein expression based on quantification of fluorescent intensity of individual cells in wild type and Eprn KO cells 24 hr post PD/LIF withdrawal. (G) Correlation analysis of Eprn, Lin28a and Nanog expression at single cell levels during pre-implantation embryo development based on published dataset (Ohnishi et al., 2014).
DOI:
http://dx.doi.org/10.7554/eLife.23468.013
(A) ChIRP using probe sets recognising Eprn specifically enriched Eprn RNA quantified by RT-qPCR. Mean ± SD, n = 3. (B) Lin28a promoter region and H3K4me3 modification status base on published dataset (Marks et al., 2012). SL, serum/LIF. (C) ChIRP using Eprn probe set did not enrich Lin28a promoter chromatin quantified by qPCR. Mean ± SD, n = 3. The regions analysed are show in B. (D) Eprn ChIRP profile at Nanog locus. (E) Genome-wide Eprn ChIRP peaks in wild type and Eprn KO cells. 7SK ChIRP probe was used as a negative control. (F) Lin28a promoter region H3K4me3 modification in wild type and Eprn KO cells in PD/LIF and 24 hr post PD/LIF withdrawal. Mean ± SD, n = 3. (G) Nanog ChIP profile at Lin28a and Esrrb loci based on published datasets (Marson et al., 2008) and Chen et al., 2008). (H) Lin28a expression upon Nanog knockdown in PD/LIF and up to 24 hr post PD/LIF withdrawal. Mean ± S.D, n = 3.
DOI:
http://dx.doi.org/10.7554/eLife.23468.014
Figure 3—figure supplement 1.
Characterisation of Eprn, Nanog and Lin28a genetic interaction.
(A) Rex1-GFP profiles of indicated genetic manipulations of wild type and Eprn KO cells in PD/LIF and 40 hr post PD/LIF withdrawal, related to Figure 3A–C. (B) Knockdown effects of several core pluripotency network factors on Rex1-GFP profile in wild type and Eprn KO cells in PD/LIF and upon 40 hr withdrawal. (C) Rex1-GFP profiles upon knockdown of core pluripotency factors singly or together with Nanog in wild type and Eprn KO cells at 40 hr post PD/LIF withdrawal. (D) Quantification of Rex1-GFP high population as gated in C in wild type and Eprn KO cells. (E) Representative immunostaining images of wild type and Eprn KO cells cultured in PD/LIF. (F) Correlation analysis of Nanog and Lin28a protein expression based on quantification of fluorescent intensity of individual cells in wild type and Eprn KO cells 24 hr post PD/LIF withdrawal. (G) Correlation analysis of Eprn, Lin28a and Nanog expression at single cell levels during pre-implantation embryo development based on published dataset (Ohnishi et al., 2014).
DOI:
http://dx.doi.org/10.7554/eLife.23468.013
Lin28a is downstream of Ephemeron and regulates Nanog expression.
(A) Rex1-GFP flow cytometry profiles (Left) and colony formation capacity (Right) 40 hr post PD/LIF withdrawal for wild type and Eprn KO cells transfected with indicated siRNAs. (B) Rex1-GFP flow cytometry profiles and colony formation capacity 40 hr post PD/LIF withdrawal for wild type and Eprn KO cells transfected with Lin28a expression vector. (C) Rex1-GFP flow cytometry profile and colony formation capacity 40 hr post PD/LIF withdrawal with Nanog and Lin28a single or dual knockdowns in wild type cells. Quantification of percentage of GFP high cells were shown in (A-C). Percentage clonogenicity in (A-C) is measured by the number of AP positive colonies divided by the total number of cells plated, with representative AP staining images shown. Mean ± SD, n = 3. (D) Lin28a and Nanog expression relative to β-actin upon PD/LIF withdrawal in Lin28a knockdown and control cells. Mean ± SD, n = 3. *p<0.05, Student’s t-test. (E) Correlation of Nanog and Lin28a protein expression immunostaining in wild type and Eprn KO cells 24 hr post PD/LIF withdrawal. (F) Representative images of cells co-immunostained with Nanog and Lin28a and quantified in E.DOI:
http://dx.doi.org/10.7554/eLife.23468.012
Characterisation of Eprn, Nanog and Lin28a genetic interaction.
(A) Rex1-GFP profiles of indicated genetic manipulations of wild type and Eprn KO cells in PD/LIF and 40 hr post PD/LIF withdrawal, related to Figure 3A–C. (B) Knockdown effects of several core pluripotency network factors on Rex1-GFP profile in wild type and Eprn KO cells in PD/LIF and upon 40 hr withdrawal. (C) Rex1-GFP profiles upon knockdown of core pluripotency factors singly or together with Nanog in wild type and Eprn KO cells at 40 hr post PD/LIF withdrawal. (D) Quantification of Rex1-GFP high population as gated in C in wild type and Eprn KO cells. (E) Representative immunostaining images of wild type and Eprn KO cells cultured in PD/LIF. (F) Correlation analysis of Nanog and Lin28a protein expression based on quantification of fluorescent intensity of individual cells in wild type and Eprn KO cells 24 hr post PD/LIF withdrawal. (G) Correlation analysis of Eprn, Lin28a and Nanog expression at single cell levels during pre-implantation embryo development based on published dataset (Ohnishi et al., 2014).DOI:
http://dx.doi.org/10.7554/eLife.23468.013
Eprn does not act on chromatin.
(A) ChIRP using probe sets recognising Eprn specifically enriched Eprn RNA quantified by RT-qPCR. Mean ± SD, n = 3. (B) Lin28a promoter region and H3K4me3 modification status base on published dataset (Marks et al., 2012). SL, serum/LIF. (C) ChIRP using Eprn probe set did not enrich Lin28a promoter chromatin quantified by qPCR. Mean ± SD, n = 3. The regions analysed are show in B. (D) Eprn ChIRP profile at Nanog locus. (E) Genome-wide Eprn ChIRP peaks in wild type and Eprn KO cells. 7SK ChIRP probe was used as a negative control. (F) Lin28a promoter region H3K4me3 modification in wild type and Eprn KO cells in PD/LIF and 24 hr post PD/LIF withdrawal. Mean ± SD, n = 3. (G) Nanog ChIP profile at Lin28a and Esrrb loci based on published datasets (Marson et al., 2008) and Chen et al., 2008). (H) Lin28a expression upon Nanog knockdown in PD/LIF and up to 24 hr post PD/LIF withdrawal. Mean ± S.D, n = 3.DOI:
http://dx.doi.org/10.7554/eLife.23468.014We investigated whether lowered expression of Lin28a contributes to the slower exit from naïve pluripotency and the increased Nanog expression. We manipulated Lin28a dosage by either overexpression or knockdown in Eprn KO cells. In wild type cells, Lin28a overexpression had no significant effect. In Eprn KO cells, however, it restored normal transition kinetics (Figure 3B). Conversely, Lin28a knockdown phenocopied Eprn loss, delaying exit from naïve pluripotency (Figure 3C). Concomitant knockdown of Nanog and Lin28a abolished this effect (Figure 3C). Lin28a knockdown cells exhibited marginally elevated Nanog mRNA in PD/LIF and persistence at higher levels after 8 hr of PD/LIF withdrawal (Figure 3D). At the protein level, Eprn null cultures displayed more cells with high Nanog and low Lin28a expression at the 24 hr time point as quantified by co-immunostaining (Figure 3E,F, Figure 3—figure supplement 1E). Interestingly, Lin28a was detected as concentrated foci in the nucleus and also in the cytoplasm (observed with two independent antibodies), and both nuclear and cytoplasmic expression were increased after PD/LIF withdrawal (Figure 3—figure supplement 1F). During early embryo development, expression of Lin28a and Eprn are positively correlated, while Lin28a and Nanog are negatively correlated (Figure 3—figure supplement 1G)(Ohnishi et al., 2014). These data are consistent with the proposition that Lin28a is genetically downstream of Eprn and may facilitate exit from naïve pluripotency by accelerating downregulation of Nanog.To assess whether Eprn could regulate Lin28a or Nanog expression directly, we employed chromatin isolation by RNA purification (ChIRP) (Chu et al., 2011). Using this method, we were able to selectively pull down endogenous Eprn RNA (Figure 3—figure supplement 2A). However, we did not detect chromatin enrichment at the Lin28a or Nanog promoter regions (Figure 3—figure supplement 2B–D). Indeed, no significant enrichment genome-wide was observed in wild type compared to Eprn KO cells (Figure 3—figure supplement 2E). Thus we found no evidence that Eprn functions by chromatin association (Rinn and Guttman, 2014).
Figure 3—figure supplement 2.
Eprn does not act on chromatin.
(A) ChIRP using probe sets recognising Eprn specifically enriched Eprn RNA quantified by RT-qPCR. Mean ± SD, n = 3. (B) Lin28a promoter region and H3K4me3 modification status base on published dataset (Marks et al., 2012). SL, serum/LIF. (C) ChIRP using Eprn probe set did not enrich Lin28a promoter chromatin quantified by qPCR. Mean ± SD, n = 3. The regions analysed are show in B. (D) Eprn ChIRP profile at Nanog locus. (E) Genome-wide Eprn ChIRP peaks in wild type and Eprn KO cells. 7SK ChIRP probe was used as a negative control. (F) Lin28a promoter region H3K4me3 modification in wild type and Eprn KO cells in PD/LIF and 24 hr post PD/LIF withdrawal. Mean ± SD, n = 3. (G) Nanog ChIP profile at Lin28a and Esrrb loci based on published datasets (Marson et al., 2008) and Chen et al., 2008). (H) Lin28a expression upon Nanog knockdown in PD/LIF and up to 24 hr post PD/LIF withdrawal. Mean ± S.D, n = 3.
DOI:
http://dx.doi.org/10.7554/eLife.23468.014
The H3K4me3 modification was reduced at the Lin28a promoter in Eprn KO cells, in line with reduced transcription (Figure 3—figure supplement 2F). One explanation for anti-correlated expression could be direct negative regulation of Lin28a by Nanog. We inspected two published Nanog chromatin immunoprecipitation (ChIP) sequencing datasets (Chen et al., 2008; Marson et al., 2008) but observed no localisation of Nanog at the Lin28a locus (Figure 3—figure supplement 2G). Furthermore, we did not observe Lin28a upregulation in Nanog knockdown cells (Figure 3—figure supplement 2H). Therefore, Nanog does not appear to be a direct upstream regulator of Lin28a.
The function of Lin28a in ESC transition may be mediated by suppression of let-7g
Lin28a is an RNA binding protein with a well-established function in suppressing maturation of let-7 family miRNAs (Cho et al., 2012; Viswanathan et al., 2008). We investigated whether the role of Lin28a in naïve state exit is let-7 dependent. We profiled mature miRNA expression of let-7 family members using RT-qPCR. Expression of let-7a, let-7d, let-7e, let-7g and let-7i decreased 24 hr after 2i/LIF withdrawal, coincident with the increase in Lin28a expression (Figure 4A). Mature miRNA let-7c expression was unaffected, suggesting that let-7c expression is independent of Lin28a. This observation is in agreement with a recent finding that let-7c-2, the major let-7c isoform expressed in mouse ESCs, bypasses Lin28a regulation due to lack of a GGAG recognition motif in its loop region (Triboulet et al., 2015). The Lin28a regulated let-7 miRNAs, but not let-7c, are expressed at higher levels in ESCs in 2i/LIF than in LIF/serum (Pandolfini et al., 2016) (Figure 4—figure supplement 1A), consistent with lower Lin28a in 2i/LIF.
Figure 4.
Lin28a function is mediated via members of let-7 miRNAs.
(A) Mature let-7 family microRNA expression quantified by RT-qPCR in 2i/LIF, 24 hr post 2i/LIF withdrawal, and EpiSCs. (B) Rex1-GFP flow cytometry profile upon forced expression of mature let-7g mimic during transition from 2i and PD/LIF. Quantification of percentage of GFP high cells was shown. (C) Colony formation assay in 2i/LIF of cells with forced expression of let-7g mimic and control 40 hr post PD/LIF withdrawal. Colonies were stained with alkaline phosphatase (AP). Percentage clonogenicity was calculated by the number of AP positive colonies divided by the total number of cells plated. Mean ± SD, n = 3. (D) Predicted target sites of let-7g in 3’UTRs of Dnmt3a and Dnmt3b by RNA22. (E) Dual luciferase assay measuring repression by let-7g mediated through 3’UTRs of Dnmt3a and Dnmt3b. Fold repression of Luc/Rluc relative to scramble was plotted. Mean ± SD, n = 3. (F) Relative expression normalised to β-actin of naïve and peri-implantation epiblast associated genes in ESCs with forced expression of let-7g mimics. Mean ± SD, n = 3.
DOI:
http://dx.doi.org/10.7554/eLife.23468.015
(A) let-7 family mature miRNA expression in ESCs cultured in 2i/LIF and Serum/LIF from published dataset (Pandolfini et al., 2016). (B) Mature miRNA sequence of Lin28a regulated let-7 members. Seed sequences are coloured in red. (C) Predicted let-7g target sites and target/miRNA heteroduplex structures and folding energy based on RNA22 V2 predictions. (D) Dual luciferase assay measuring repression by let-7g on the reporter mediated through wild type and mutated Dnmt3b 3’UTRs. Top, mutated reporter binding sites with the seed recognition site shaded grey and mutations highlighted in bold. Bottom, fold repression of Luc/Rluc relative to scramble was plotted. Mean ± SD, n = 3.
DOI:
http://dx.doi.org/10.7554/eLife.23468.016
Figure 4—figure supplement 1.
let-7 family mature miRNA expression, sequence and predicted let-7g sites in the 3’UTRs of Dnmt3a and Dnmt3b.
(A) let-7 family mature miRNA expression in ESCs cultured in 2i/LIF and Serum/LIF from published dataset (Pandolfini et al., 2016). (B) Mature miRNA sequence of Lin28a regulated let-7 members. Seed sequences are coloured in red. (C) Predicted let-7g target sites and target/miRNA heteroduplex structures and folding energy based on RNA22 V2 predictions. (D) Dual luciferase assay measuring repression by let-7g on the reporter mediated through wild type and mutated Dnmt3b 3’UTRs. Top, mutated reporter binding sites with the seed recognition site shaded grey and mutations highlighted in bold. Bottom, fold repression of Luc/Rluc relative to scramble was plotted. Mean ± SD, n = 3.
DOI:
http://dx.doi.org/10.7554/eLife.23468.016
Lin28a function is mediated via members of let-7 miRNAs.
(A) Mature let-7 family microRNA expression quantified by RT-qPCR in 2i/LIF, 24 hr post 2i/LIF withdrawal, and EpiSCs. (B) Rex1-GFP flow cytometry profile upon forced expression of mature let-7g mimic during transition from 2i and PD/LIF. Quantification of percentage of GFP high cells was shown. (C) Colony formation assay in 2i/LIF of cells with forced expression of let-7g mimic and control 40 hr post PD/LIF withdrawal. Colonies were stained with alkaline phosphatase (AP). Percentage clonogenicity was calculated by the number of AP positive colonies divided by the total number of cells plated. Mean ± SD, n = 3. (D) Predicted target sites of let-7g in 3’UTRs of Dnmt3a and Dnmt3b by RNA22. (E) Dual luciferase assay measuring repression by let-7g mediated through 3’UTRs of Dnmt3a and Dnmt3b. Fold repression of Luc/Rluc relative to scramble was plotted. Mean ± SD, n = 3. (F) Relative expression normalised to β-actin of naïve and peri-implantation epiblast associated genes in ESCs with forced expression of let-7g mimics. Mean ± SD, n = 3.DOI:
http://dx.doi.org/10.7554/eLife.23468.015
let-7 family mature miRNA expression, sequence and predicted let-7g sites in the 3’UTRs of Dnmt3a and Dnmt3b.
(A) let-7 family mature miRNA expression in ESCs cultured in 2i/LIF and Serum/LIF from published dataset (Pandolfini et al., 2016). (B) Mature miRNA sequence of Lin28a regulated let-7 members. Seed sequences are coloured in red. (C) Predicted let-7g target sites and target/miRNA heteroduplex structures and folding energy based on RNA22 V2 predictions. (D) Dual luciferase assay measuring repression by let-7g on the reporter mediated through wild type and mutated Dnmt3b 3’UTRs. Top, mutated reporter binding sites with the seed recognition site shaded grey and mutations highlighted in bold. Bottom, fold repression of Luc/Rluc relative to scramble was plotted. Mean ± SD, n = 3.DOI:
http://dx.doi.org/10.7554/eLife.23468.016To examine the role of Lin28a regulated let-7 miRNAs in naïve state exit, we first transfected ESCs with mature let-7g mimic. We used let-7g as a representative member since all apart from let-7e share the same seed sequence (Figure 4—figure supplement 1B). Forced expression of let-7g in RGd2 cells resulted in delayed GFP downregulation upon both 2i and PD/LIF withdrawal (Figure 4B). Elevated ESC colony formation capacity post PD/LIF withdrawal was also observed (Figure 4C). To identify downstream targets of let-7g, we curated genes that are upregulated upon 2i withdrawal in our RNA-sequencing dataset and searched for known or predicted let-7g targets using the RNA22 tool (Miranda et al., 2006). DNA methyltransferases Dnmt3a and Dnmt3b emerged as prime candidates, as has previously been proposed (Kumar et al., 2014). Expression of both increases during ESC transition (Kalkan et al., 2017). Dnmt3a/3b transcript levels were lower in Eprn KO cells than wild type control (Figure 2—figure supplement 2F). Multiple let-7g target sites were predicted by RNA22 within the Dnmt3a 3’UTR and one site in the Dnmt3b 3’UTR (Figure 4D, Figure 4—figure supplement 1C). ESCs were co-transfected with mature let-7g mimic and luciferase constructs containing the entire 3’UTRs of Dnmt3a and Dnmt3b. let-7g reduced luciferase expression by more than 60% relative to scrambled control (Figure 4E), suggesting that Dnmt3a/3b transcripts are indeed let7-g targets. To test specificity of this repression, we generated two Dnmt3b 3'UTR luciferase reporter constructs with the let-7 seed recognition site mutated (Figure 4—figure supplement 1D). These mutant reporters escaped repression by the let-7g mimic (Figure 4—figure supplement 1D).
Dnmt3a and Dnmt3b methylate the Nanog promoter during naïve state exit
Epiblast progression is associated with genome-wide de novo methylation during pre-to post-implantation development (Auclair et al., 2014). This phenomenon is recapitulated when naïve ESCs are withdrawn from 2i (Kalkan et al., 2017). Previous studies demonstrated hypomethylation of the Nanog promoter in mouse ESCs compared to lineage committed cells (Farthing et al., 2008; Yu et al., 2007). We speculated that impeded de novo DNA methylation could allow perdurance of Nanog expression at the onset of naïve state exit. To investigate this hypothesis, we carried out bisulfite sequencing analysis across the Nanog proximal promoter region, 1 kb upstream of the TSS, after siRNA knockdown of Dnmt3a/3b singly or together (Figure 5A). We observed a marked reduction of CpG methylation in the −1 kb to −761 bp region (region 1) 40 hr after PD/LIF withdrawal (Figure 5A). Cells transfected with scrambled control siRNA exhibited 40% CpG methylation at scored sites, whereas Dnmt3b depleted cells displayed 18% CpG methylation and Dnmt3a or Dnmt3a/b double knockdown cells showed only around 8%. Effects were less obvious in the −538 bp to +18 bp region (region 2), which was barely methylated at this time point. These data suggest that Dnmt3a and Dnmt3b have overlapping roles in mediating de novo methylation at the Nanog proximal promoter. Eprn KO cells also exhibited reduced methylation at the Nanog promoter, with region one again showing a more prominent reduction (Figure 5—figure supplement 1A).
Figure 5.
Loss of Dnmt3a and Dnmt3b delays naïve state exit associated with transient persistence of Nanog expression.
(A) Bisulfite sequencing analysis of Nanog proximal promoter CpG island DNA methylation in Dnmt3a and Dnm3b single and dual knockdown cells at 40 hr post PD/LIF withdrawal. The positions of cytosines analysed (mm10) are indicated on the left panel. Black and while circles represent methylated and unmethylated cytosine respectively. (B) Rex1-GFP flow cytometry profiles of Dnmt3a and Dnmt3b single and dual KO cells withdrawn from 2i or PD/LIF for 24 and 40 hr respectively. Percentage of GFP high cells were quantified. (C) colony formation capacity 40 hr post PD/LIF withdrawal for Dnmt3a and Dnmt3b single and compound KO cells. Percentage clonogenicity was measured by the number of AP positive colonies formed divided by the total number of cells plated, with representative AP staining images shown. Mean ± SD, n = 3. (D) Expression of Nanog relative to β-actin in Dnmt3a and Dnmt3b single and compound KO cells quantified by RT-qPCR. Mean ± SD, n = 2. (E) Schematic representation of the inferred Eprn pathway. Legends for Figures and Source Data.
DOI:
http://dx.doi.org/10.7554/eLife.23468.017
(A) Bisulfite sequencing analysis of Nanog proximal promoter CpG DNA methylation in wild type and Eprn KO cells at 40 hr post PD/LIF withdrawal. The positions of cytosines (mm10) analysed are indicated. Black and white circles represent methylated and unmethylated cytosine. (B) Dnmt3a and Dnmt3b variants with designed gRNA positions. Right panel, genotyping confirmation of homozygous deletions for Dnmt3a and Dnmt3b single and compound KO ESCs and the primer sequences are shown in Supplementary file 2B. (C) Rex1-GFP profiles over 2i withdrawal time course for wild type and Dnmt3a/3b single and compound KO ESCs. Percentage of Rex1-GFP high cells are quantified. (D) Rex1-GFP profiles for Dnmt3a/3b single and compound KO in PD/LIF and 40 hr post PD/LIF withdrawal. Percentage of Rex1-GFP high cells are quantified. (E) Expression of core pluripotency factors relative to β-actin in Dnmt3a/3b single and dual KO ESCs upon PD/LIF withdraw. Mean ± SD, n = 3. (F) Expression of peri-implantation markers relative to β-actin in Dnmt3/3b single and dual KO ESCs upon PD/LIF withdrawal. Mean ± SD, n = 3. Legends for Supplementary File.
DOI:
http://dx.doi.org/10.7554/eLife.23468.018
Figure 5—figure supplement 1.
Phenotypic and molecular characterisation of Dnmt3a/3b KO in naïve state exit.
(A) Bisulfite sequencing analysis of Nanog proximal promoter CpG DNA methylation in wild type and Eprn KO cells at 40 hr post PD/LIF withdrawal. The positions of cytosines (mm10) analysed are indicated. Black and white circles represent methylated and unmethylated cytosine. (B) Dnmt3a and Dnmt3b variants with designed gRNA positions. Right panel, genotyping confirmation of homozygous deletions for Dnmt3a and Dnmt3b single and compound KO ESCs and the primer sequences are shown in Supplementary file 2B. (C) Rex1-GFP profiles over 2i withdrawal time course for wild type and Dnmt3a/3b single and compound KO ESCs. Percentage of Rex1-GFP high cells are quantified. (D) Rex1-GFP profiles for Dnmt3a/3b single and compound KO in PD/LIF and 40 hr post PD/LIF withdrawal. Percentage of Rex1-GFP high cells are quantified. (E) Expression of core pluripotency factors relative to β-actin in Dnmt3a/3b single and dual KO ESCs upon PD/LIF withdraw. Mean ± SD, n = 3. (F) Expression of peri-implantation markers relative to β-actin in Dnmt3/3b single and dual KO ESCs upon PD/LIF withdrawal. Mean ± SD, n = 3. Legends for Supplementary File.
DOI:
http://dx.doi.org/10.7554/eLife.23468.018
To explore the role of de novo DNA methylation in ESC transition, we investigated functional consequences of Dnmt3a and Dnmt3b depletion. We created Dnmt3a and Dnmt3b single and compound knockouts in RGd2 ESCs using CRISPR/Cas9. Using two guide RNAs (gRNAs), we generated deletions of highly conserved PC and ENV motifs (motifs IV and V) within the catalytic domain for both Dnmt3a and Dnmt3b, recapitulating the previously characterised Dnmt3b and Dnmt3b mutant gene structures (Okano et al., 1999) (Figure 5—figure supplement 1B). Dnmt3a and Dnmt3b single and double KO cells exhibited delayed Rex1-GFP downregulation (Figure 5B). Colony formation capacity of the single and double KO cells 40 hr post PD/LIF withdrawal confirmed slower extinction of ESC identity (Figure 5C). Interestingly, however, as with Eprn KO, the delay in GFP downregulation did not endure (Figure 5—figure supplement 1C). Absence of Dnmt3a and Dnmt3b singly or together was associated with transient perdurance of Nanog expression (Figure 5D). At 8 hr after PD/LIF withdrawal, Nanog mRNA in Dnmt3a and/or Dnmt3b mutants was equivalent to wild type cells in PD/LIF, whereas wild type cells had downregulated Nanog expression by 50% (Figure 5D). We also observed elevated expression of Tfcp2l1, Klf2, Klf4 and Tbx3 in Dnmt3a/3b single or compound KO cells (Figure 5—figure supplement 1E). The promoters of these genes are methylation refractory in the 2i withdrawal time course (Kalkan et al., 2017). Therefore, the elevated expression should be secondary to some other factor(s) such as increased Nanog. Dnmt3a/3b compound KO also resulted in impeded upregulation of peri-implantation markers Fgf5, Oct6 and Otx2 at 24 hr post PD/LIF withdrawal (Figure 5—figure supplement 1F). These data indicate that de novo DNA methylation facilitates timely progression from the ESC state. Importantly, however, methylation by Dnmt3a/3b is not essential for the exit from naïve pluripotency.
Loss of Dnmt3a and Dnmt3b delays naïve state exit associated with transient persistence of Nanog expression.
(A) Bisulfite sequencing analysis of Nanog proximal promoter CpG island DNA methylation in Dnmt3a and Dnm3b single and dual knockdown cells at 40 hr post PD/LIF withdrawal. The positions of cytosines analysed (mm10) are indicated on the left panel. Black and while circles represent methylated and unmethylated cytosine respectively. (B) Rex1-GFP flow cytometry profiles of Dnmt3a and Dnmt3b single and dual KO cells withdrawn from 2i or PD/LIF for 24 and 40 hr respectively. Percentage of GFP high cells were quantified. (C) colony formation capacity 40 hr post PD/LIF withdrawal for Dnmt3a and Dnmt3b single and compound KO cells. Percentage clonogenicity was measured by the number of AP positive colonies formed divided by the total number of cells plated, with representative AP staining images shown. Mean ± SD, n = 3. (D) Expression of Nanog relative to β-actin in Dnmt3a and Dnmt3b single and compound KO cells quantified by RT-qPCR. Mean ± SD, n = 2. (E) Schematic representation of the inferred Eprn pathway. Legends for Figures and Source Data.DOI:
http://dx.doi.org/10.7554/eLife.23468.017
Phenotypic and molecular characterisation of Dnmt3a/3b KO in naïve state exit.
(A) Bisulfite sequencing analysis of Nanog proximal promoter CpG DNA methylation in wild type and Eprn KO cells at 40 hr post PD/LIF withdrawal. The positions of cytosines (mm10) analysed are indicated. Black and white circles represent methylated and unmethylated cytosine. (B) Dnmt3a and Dnmt3b variants with designed gRNA positions. Right panel, genotyping confirmation of homozygous deletions for Dnmt3a and Dnmt3b single and compound KO ESCs and the primer sequences are shown in Supplementary file 2B. (C) Rex1-GFP profiles over 2i withdrawal time course for wild type and Dnmt3a/3b single and compound KO ESCs. Percentage of Rex1-GFP high cells are quantified. (D) Rex1-GFP profiles for Dnmt3a/3b single and compound KO in PD/LIF and 40 hr post PD/LIF withdrawal. Percentage of Rex1-GFP high cells are quantified. (E) Expression of core pluripotency factors relative to β-actin in Dnmt3a/3b single and dual KO ESCs upon PD/LIF withdraw. Mean ± SD, n = 3. (F) Expression of peri-implantation markers relative to β-actin in Dnmt3/3b single and dual KO ESCs upon PD/LIF withdrawal. Mean ± SD, n = 3. Legends for Supplementary File.DOI:
http://dx.doi.org/10.7554/eLife.23468.018
Discussion
Mouse ES cell self-renewal is robust due to recursive wiring of a core transcription factor network (Dunn et al., 2014; Martello and Smith, 2014; Young, 2011). Rapid developmental progression from such a resilient state is achieved through parallel mechanisms. In this study, we find that a lncRNA, Ephemeron, participates in the timely dissolution of naïve identity. Genetic interactions link Eprn with known players in post-transcriptional and epigenetic regulation (Figure 5E). Eprn lies upstream of Lin28a/let-7g and Dnmt3a/3b, and ultimately contributes to timely downregulation of the pivotal naïve transcription factor Nanog. Eprn depletion reduces Lin28a expression, although the molecular mechanism underlying this effect remains unclear. Lower Lin28a stabilises expression of the let-7 miRNAs whose targets include de novo DNA methyltransferases Dnmt3a and Dnm3b. Resulting decreased Dnmt3a/3b reduces Nanog proximal promoter CpG methylation, correlating with transiently perduring expression. This lncRNA/miRNA/DNA methylation module provides an additional layer in the multi-layered machinery that enforces transition from naïve to formative pluripotency (Acampora et al., 2016; Jang et al., 2017; Kalkan et al., 2017; Kalkan and Smith, 2014; Smith, 2017).Eprn promotes ESC transition and is suppressed by Gsk3 inhibition during ground state self-renewal in 2i or 2i/LIF. ESCs cultured without Gsk3 inhibition can self-renew in the presence of PD/LIF or LIF/serum. In these conditions they express Eprn and higher levels of Lin28a. The lack of overt consequence is presumably due to the dominant self-renewal environment provided by Stat3 activation and MEK inhibition that sustain expression of Nanog and other naïve factors. Nonetheless, loss of Eprn in PD/LIF resulted in elevated Nanog and delayed transition kinetics.We observed a Mendelian ratio of homozygous Eprn mutant mice from heterozygous intercrosses (5:18:7, wild type: heterozygous: homozygous offspring). Therefore, in common with Lin28a (Shinoda et al., 2013), Eprn is dispensable for development of laboratory mice. Some protein-coding genes that exhibit demonstrable loss-of-function phenotypes in ESC self-renewal or transition also show no early embryo phenotype (Leeb et al., 2014; Martello and Smith, 2014). Our interpretation is that ESCs provide a sensitised platform for identifying components whose functions may be compensated during in vivo development.The majority of lncRNAs are not phylogenetically conserved (Necsulea et al., 2014). Due to their rapidly evolving nature, it is thought that lncRNAs are likely to acquire species or lineage-restricted functions and several examples have recently been described (Durruthy-Durruthy et al., 2016; Paralkar et al., 2014; Rani et al., 2016). The presence of Eprn exclusively in rodent may be associated with rapid embryonic progression from pre-implantation epiblast to gastrulation (Rossant and Tam, 2017), which necessitates acute extinction of the naïve pluripotency programme (Smith, 2017). LncRNAs are more tolerant to TE integration than protein coding genes, which could drive more rapid evolution (Kelley and Rinn, 2012; Necsulea et al., 2014). Non-coding transcripts harbouring TE sequences are enriched in ESCs and early embryo development in both mouse and human (Fort et al., 2014; Göke et al., 2015; Kelley and Rinn, 2012) and in several instances have been proposed to regulate pluripotency (Durruthy-Durruthy et al., 2016; Fort et al., 2014; Lu et al., 2014). Eprn is comprised of 76.4% TEs, compared to the average of 41.4% TE composition in the mouse genome and 33% reported for mouse multi-exon lincRNA sequences (Kelley and Rinn, 2012). The aligned sequence between Eprn and the rat transcript from the syntenic region includes ERVK LTR and SINE B2 elements. These sequences have been preserved for over 30 million years since the mouse-rat lineage divergence.Lin28a is known as a human somatic cell reprogramming factor (Yu et al., 2007). However, Lin28a is expressed at a lower level in ground state mouse ESCs (Marks et al., 2012) and pre-implantation epiblast, than in post-implantation epiblast and EpiSCs (Boroviak et al., 2015). The expression pattern is consistent with our evidence that up-regulation of Lin28a at the onset of mouse ESC differentiation functions to facilitate transition from the naïve state. During human iPSC generation, Lin28a may promote acquisition of primed pluripotency, the endpoint for current human somatic cell reprogramming. Lin28a itself is a target of let-7 miRNAs (Kumar et al., 2014; Melton et al., 2010) and the reciprocal negative feedback loops can act as a bimodal switch. Our findings are consistent with the recent report that loss of Lin28a reduced ESC heterogeneity in serum/LIF, favouring a more naïve state (Kumar et al., 2014). This effect was attributed to let-7g. We note, however, that Lin28a can post-transcriptionally regulate the expression and/or translation of many RNAs independently of let-7 (Cho et al., 2012; Zhang et al., 2016) that could also contribute to ESC transition.De novo methyltransferases Dnmt3a/3b have previously been proposed as targets of let-7g (Kumar et al., 2014). Our results show that loss of Dnmt3a and Dnmt3b, individually and in combination, delays naïve state exit. Naïve ESCs (Ficz et al., 2011; Habibi et al., 2013; Leitch et al., 2013) and pre-implantation epiblast (Monk et al., 1987; Sanford et al., 1987) have low expression of Dnmt3a/3b and display global DNA hypomethylation. However, the post-implantation epiblast rapidly acquires global DNA methylation and this process is dependent on Dnmt3a/3b (Auclair et al., 2014). A similar acute trend is observed upon naïve ESC withdrawal from 2i (Kalkan et al., 2017). Early de novo methylation may have functional consequences for specific naïve pluripotency associated factors, such as Nanog, enduring rapid downregulation. It is noteworthy, however, that the Dnmt3a/3b KO phenotype is transient and ESC identity still collapses. Therefore, although de novo DNA methylation facilitates ESC transition it is not mandatory for the exit from naïve pluripotency.Human naïve pluripotency shares molecular and cellular features with mouse, consistent with a conserved core pluripotency programme in mammals (Guo et al., 2017, 2016; Smith, 2017; Takashima et al., 2014; Theunissen et al., 2014). However, species-specific differences are evident. Notably, Gsk3 inhibition has less impact on human naïve state maintenance (Guo et al., 2017; Theunissen et al., 2016). This is partly explained by the lack of ESRRB expression in human pluripotent cells (Blakeley et al., 2015; Martello et al., 2012; Takashima et al., 2014; Theunissen et al., 2014), but absence of Eprn may be an additional factor that reduces requirement for Gsk3 inhibition.In summary, we have mapped a genetic interaction module consisting of a novel lncRNA, proteins and miRNAs that is integrated into the multi-pronged molecular machinery that propels mouse ESCs towards lineage competence. The fine-tuning effect of Eprn could be representative of lncRNA actions in the regulation of molecular networks and illustrative of their potential contribution to species diversification.
Materials and methods
Targeting, expression and gRNA vector construction
BAC RP24-353A19 (C57BL/6J background) was obtained from Wellcome Trust Sanger Institute for constructing the Eprn knockout targeting vectors by recombineering using bacterial strain EL350 (Lee et al., 2001). Floxed drug resistant cassettes containing hygromycin B phosphotransferase gene (Hygro) or Blasticidin S-resistance gene (Bsd) were PCR amplified using chimeric primers miniU and miniD (Supplementary file 1A) harbouring 80 bp mini-homologies to the genomic region flanking Eprn locus. The purified PCR fragments loxP-PGK-Hygro-bghpA-loxP and loxP-PGK-Bsd-bghpA-loxP were used to replace the entire genomic region of Eprn locus with the drug resistant cassettes. The retrieval homology arms were PCR amplified using primers ReUF and ReUR for upstream and ReDF and ReDF for downstream mini-arms (Supplementary file 1B). The mini arms were subsequently cloned into pBS-MC1-DTA vector by 3-way ligation using restriction enzymes, SpeI, HindIII and XhoI. The mini-arm containing vector was linearised by HindIII and used to retrieve the targeting vectors from the modified BACs, giving rise to the final targeting vectors, HygroTV and BsdTV.Lin28a overexpression vector was constructed by PCR cloning mouse Lin28a from cDNA using forward primer AATTGTCGACATGGGCTCGGTGTCCAACCAGCAGT and reverse primer AATTGCGGCCGCTCAATTCTGGGCTTCTGGGAGCAG and cloned into pENTR2B vector. It was subsequently cloned into PiggyBac-based expression vector using Gateway LR clonase (Thermo Fisher Scientific, Waltham, MA, USA, 11791020) to generate pCAG-Lin28a-pA:PGK-hygro-pA plasmid.The gRNA design was conducted using online CRISPR gRNA design tool https://www.atum.bio/eCommerce/cas9/input. The chosen gRNAs were based on minimal off-target scores. Deletions were designed to recapitulate the original Dnmt3a and Dnmt3b KO mutations (Okano et al., 1999), excising the highly conserved PC and ENV motifs (motifs IV and V) within the catalytic domain. The gRNAs were generated by annealing the indicated oligos (Supplementary file 2A), which were subsequently ligated into pX458 vector (Addgene) digested with BbsI. The constructs were sequence validated before transfection.
Cell culture
ESCs were cultured on 0.1% gelatin in 2i/LIF medium (homemade N2B27 base medium, supplemented with 1 μM PD0325901, 3 μM CHIR99021, and 20 ng/ml LIF) as described (Ying et al., 2008). For gene targeting, ESC were maintained with serum containing medium supplemented with 2i/LIF as above (KO-DMEM high glucose, 15% FCS, 2 mM L-Glutamine, NEAA, 1 mM Sodium Pyruvate (Thermo Fisher Scientific), 100 mM β-Mercaptoethanol (Sigma Aldrich, St. Louis, MO, USA). Correctly targeted clones were transferred to N2B27 based 2i/LIF medium for expansion and experimentation. The RGd2 reporter wild type subclones and Eprn KO ESC clones are of V6.5 origin (RRID:CVCL_C865). An independent wild type RGd2 reporter line is of E14 origin (RRID:CVCL_C320). All cell lines are mycoplasma negative by PCR screening in house.
Naïve pluripotency exit assays
ESCs were plated at 1 × 104/cm2 in 2i without LIF or PD/LIF. The next day, cells were carefully washed with PBS before switching to N2B27 medium. Rex1-GFP profile was analysed at indicated time points in at least two independent experiments using a Cyan or Fortessa FACs analyser. Live dead discrimination was performed using TO-PRO-3 (Thermo Fisher Scientific, T3605). For clonal assay, post 24 hr or 40 hr 2i or PD/LIF withdrawal respectively, 300–500 cells were plated per well of a 12 well plate coated with Laminin (1:100 dilution, Sigma Aldrich, L2020) and cultured in 2i/LIF for 6 days. Alkaline Phosphatase staining (Sigma Aldrich, 86R-1KT) was conducted to visualise ES colonies. AP-stained plates were imaged using an Olympus IX51, DP72 camera with CellSens software and subsequent colony counting was conducted manually using ImageJ software.
EpiSC derivation from ESCs and EpiSC resetting
ESCs were plated at 1 × 104/cm2 in 2i/LIF on a gelatin coated plate. The next day, cells were washed with PBS before medium switch to N2B27 medium supplemented with 20 ng/ml Activin A and 12 ng/ml Fgf2 together with 2 µM XAV939 (Sigma Aldrich, X3004), A/F/X. Cells were then passaged to fibronectin coated plate in A/F/X medium. EpiSCs were passaged for at least seven times before gene expression analysis and resetting. For EpiSC resetting, EpiSCs were stably transfected with GY118F construct by piggyBac transposition (Yang et al., 2010). 1 × 104 cells were plated in a one well of a 12 well plate in A/F/X, the next day, 2i plus GCSF was supplied to initiate resetting.
Differentiation assays
For neuronal differentiation, ESCs were plated at 1 × 104/cm2 in N2B27 medium on laminin (1:100 in PBS) for up to 4 days for gene expression analysis. For mesendoderm differentiation, cells were plated at 0.6 × 104/cm2 in N2B27 based medium containing 10 ng/ml ActivinA, 3 µM CHIR99021 on Fibronectin for up to 4 days for gene expression analysis. For definitive endoderm differentiation, cells were plated at 1.5 × 104/cm2 in N2B27 based medium containing 20 ng/ml ActivinA, 3 µM CHIR99021, 10 ng/ml FGF4, 1 µg/ml Heparin, 100 nM PI103. On day 2, the media was switched to SF5 based medium containing 20 ng/ml ActivinA, 3 µM CHIR99021, 10 ng/ml FGF4, 1 µg/ml Heparin, 100 nM PI103 and 20 ng/ml EGF2. Per 100 ml SP5 basal medium, it contains 500 µl N2, 1 ml B27 without VitaminA supplement, 1% BSA, 1 ml L-glutamine and 100 µl β-mercaptoethanol. Detailed protocols can be found in Mulas et al (Mulas et al., 2017).
siRNA, miRNA mimics and plasmid transfection
siRNAs and miRNA mimics were obtained from Qiagen and the catalogue numbers are listed in Supplementary file 3. Transfection was performed using Dharmafect 1 (Dharmacon, Lafeyette, CO, USA, T-2001–01) in a reverse transfection protocol with the final siRNA or miRNA mimics concentration to be 10 nM. Two siRNA combination were used per transfection for each target gene knockdown.Plasmid transfection was performed using Lipofectamine 2000 (Thermo Fisher Scientific, 11668027) following the manufacturers protocol. For piggyBac based stable integration, a piggyBac transposon and hyperactive PBase (hyPBase) ratio of 3:1 was used.
Generation of Dnmt3a and Dnmt3b KO ESCs with CRISPR/Cas9
A pair of gRNA containing plasmids based on px458 backbone (Ran et al., 2013) were transfected using Fugene HD (Promega, Madison, WI, USA, E2311). 100 ng of each plasmid were transfected with 0.6 ul Fugene HD (1:3 ratio) to 2 × 105 ESCs in suspension in 2i/LIF medium overnight. The next day, the media was refreshed and 48 hr post transfection, 1,000 GFP high cells were sorted into a well of a six well plate for colony formation. Individual colonies were picked and genotyping was conducted from extracted genomic DNA by triple primer PCR to identify clones with designed deletion (Supplementary file 2B). For Dnmt3a KO, deletion resulted in genotyping PCR product shift from 760 bp representing the wild type allele to 1132 bp. For Dnmt3b KO, deletion resulted in shift from 344 bp representing the wild type allele to 653 bp. Only homozygous mutants were chosen for subsequent experimentation.
Southern blotting
Genomic DNA of individually picked ESC clones was extracted and digested with XmnI, size-fractionated on a 0.8% agarose gel and transferred to Hybond-XL blotting membrane (GE Healthcare, Chicargo, IL, USA, RPN20203) using standard alkaline transfer methods. The 5’ and 3’ external probes were generated by PCR with primer sequences shown in Supplementary file 4A. Southern blot hybridization was conducted as described previously (Li et al., 2011).
Northern blotting
10 µg of purified RNA was resolved by denaturing formaldehyde agarose gel electrophoresis with MOPS buffer. RNA was transferred to Hybond-XL membrane in 1xSSC buffer overnight by capillary transfer. RNA was UV cross-linked to the membrane and pre-hybridised with Expresshyb (CloneTech, Mountainview, CA, USA, 636831) for 2 hr at 65°C. The DNA probe was generated by PCR (primers are shown in Supplementary file 4B) and 25 ng of probe DNA was labelled with [32P]-dCTP using Radprime DNA labeling system (Thermo Fisher Scientific, 18428–011). The free-nucleotide was removed from labelled probe using G-50 column (GE Healthcare, 27-5330-01), and was heat-denatured followed by snap cooling. The probe was added to the pre-hybridised membrane and incubated overnight at 65°C in a rolling incubator. Membrane was washed with wash buffer containing 0.1 x SSC and 0.1% SDS 3 times at 65°C with 10 min intervals. The membrane was placed in a phosphoimager and exposed for at least overnight at −80°C before scanned using Typhoon 9410 phosphoimager system (GE Healthcare).
5’ and 3’ RACE
5’ RACE was conducted using 5'-Full RACE Core Set (Takara, Kusatsu, Japan, #6122) following manufacture’s protocol. The sequences for RT-primer and nested PCR primers A1, A2, S1, and S2 are shown in Supplementary file 5A. 3’ RACE was conducted by using a polyT RT-primer with a unique sequence tag to synthesis cDNA. The 3’ end region was PCR amplified using a primer specific to the RT-primer and a gene specific primer. The primers are shown in Supplementary file 5B. Both 5’ and 3’ RACE PCR products were cloned into plasmids using Zero blunt TOPO PCR cloning kit (Thermo Fisher Scientific, 451245) for subsequent sequencing.
RNA extraction, reverse transcription and Real-time PCR
Total RNA was isolated using Trizol (Thermo Fisher Scientific, 15596026) or RNeasy kit (Qiagen, Hilden, Germany, 74136) and DNase treatment was conducted either after RNA purification or during column purification. cDNA was transcribed from 0.5 ~ 1 ug RNA using SuperScriptIII (Thermo Fisher Scientific, 18080044) and oligo-dT priming. Real-time PCR was performed using StepOnePlus machine (Applied Biosystems) with Fast Sybrgreen master mix (Thermo Fisher Scientific, 4385612). Target gene primer sequences are shown in Supplementary file 6. Expression level were normalised to Actinβ. Technical replicates for at least two independent experiments were conducted. The results were shown as mean and standard deviation calculated by StepOnePlus software (Applied Biosystems). The cDNA library for E7-E17 embryos and adult tissues were purchased from Clontech (Mouse Total RNA Master Panel, 636644).
RNA-FISH
RNA-FISH was conducted using ViewRNA ISH Cell Assay for Fluorescence RNA In Situ Hybridization system (Thermo Fisher Scientific, QVC0001) with modifications and imaged on a DeltaVision Core system (Applied Precision), as described in Bergmann et al. (2015). The probe set used for Ephemeron was VX1-99999-01.
Mature miRNA expression profiling
Total RNA was extracted using Trizol. 1 ug RNA was reverse transcribed using Taqman MicroRNA Reverse Transcription Kit (Thermo Fisher Scientific, 366596). Mature miRNA expression was analysed using Taqman Array Rodent MicroRNA A + B Cared Set V3.0 (Thermo Fisher Scientific, 444909).
Luciferase assay
The Entire 3’UTR of both Dnmt3a and Dnmt3b were PCR cloned downstream of the firefly luciferase coding region into pGL3 vector. For Dnmt3a 3’UTR, forward primer AATTGGCCGGCCGGGACATGGGGGCAAACTGAAGTAG and reverse primer AATTGGATCCGGGAAGCCAAAACATAAAGATGTTTATTGAAGCTC were used for PCR cloning. For Dnmt3b 3’UTR, forward primer AATTGGCCGGCCTTCTACCCAGGACTGGGGAGCTCTC and reverse primer AATTGGATCCTTATAGAGAAATACAACTTTAATCAACCAGAAAGG were used for PCR cloning. To generate mutant Dnmt3b reporter constructs, let-7g binding site was mutated to include BsrGI (mutation V1) and EcoRI (mutation V2) sites by PCR cloning. Each firefly luciferase construct (500 ng) together with Renilla luciferase construct (10 ng) were con-transfected with either let-7g mimic or scrambled control (20 nM). The firefly and Renilla luciferase activity was determined by dual luciferase assay (Promega, E1960) 48 hr post-transfection.
Immunostaining
Cells were fixed in 4% paraformaldehyde for 10 min at room temperature and were blocked with blocking buffer (5% semi-skimmed milk with 0.1% Triton in PBS) for 2 hr at room temperature. Primary antibodies were diluted in blocking buffer and incubated at 4°C overnight. Primary antibody was carefully washed away with 0.1% Triton in PBS three times with 10 min incubation between each wash. Secondary antibody diluted in blocking buffer (1:1000) was incubated at room temperature for 1 hr followed by 3 washes with 0.1% Triton in PBS. Nuclei were counterstained with DAPI. Primary antibodies used were Nanog (eBioscience, 14–5761, RRID:AB_763613, 1:200) and Lin28a (Cell signalling, 3978, RRID:AB_2297060, 1:800; 8706, RRID:AB_10896850, 1:200). Images from random fields were taken with Leica DMI3000 and the images from different fields at each time point were combined and analysed using CellProfiler software (Broad Institute, RRID:SCR_007358) to conduct nuclear and cytoplasmic compartmentalisation and total fluorescent intensity for each sub-cellular compartments as well as the whole cell for each cell was extracted for correlation analysis.
Chromatin isolation by RNA purification (ChIRP)
The antisense oligo probes were selected with GC content in the range of 40–50% in regions of the Eprn exons without repetitive sequences (Figure 1—figure supplement 1A). The probes sequences are in shown in Supplementary file 7. CHIRP was conducted following published protocol (Chu et al., 2011). The data is available at the NCBI Gene Expression Omnibus (accession number: GSE90574). The link to the data is as follows: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE90574.
ChIP
The experimental procedure was conducted as described previously (Betschinger et al., 2013). 2 ug of H3K4me3 antibody (Diagenode, Ougrée, Belgium pAb-003–050) and IgG control (Santa Cruz, Dallas, TX, USA, sc-2345) was used for 4 × 106 cells per ChIP. qPCR was performed with primers shown in Supplementary file 8.
Nanog promoter DNA methylation analysis
Genomic DNA was extracted using GenElute Mammalian Genomic DNA miniprep kit (Sigma Aldrich, G1N70-1KT). 500 ng purified genomic DNA was treated with sodium bisulfite to convert all unmethylated cytosine residues into uracil residues using Imprint DNA modification Kit (Sigma Aldrich, MOD50-1KT) according to the manufacturer's protocol. Nanog proximal promoter regions (Region 1 and 2 as indicated in Figure 5a) were amplified using a nested PCR approach with KAPA HiFi Uracil + Readymix (KapaBiosystems/Roche, Basel, Switzerland, KK2801). The PCR condition for both nested rounds of PCR is as follows: denaturation at 98°C for 5 min followed by 10 cycles of gradient PCR, 98°C for 15 s, 62°C (starting annealing temperature) for 15 s with annealing temperature reduced by 1°C per cycle and 72°C for 1.5 min. Followed by this, a 35 cycles of 98°C for 15 s, 58°C for 15 s and 72°C for 1.5 min were conducted. 2 µl first round PCR product was used as template for the nested PCR. All primer sequences are shown in Supplementary file 9. The PCR products were verified and purified by gel electrophoresis and subsequently subcloned by TOPO cloning. Reconstructed plasmids were purified and individual clones were sequenced (Eurofins).
Transcriptome sequencing and analysis
Total RNA was isolated with RNeasy RNA purification. Ribo-zero rRNA depleted RNA was used to generate sequencing libraries for wild type and Ephemeron knockout cells in PD/LIF and 8 hr withdrawal from PDL from three independent cell lines. Single end sequencing was performed and the reads were mapped using NCBI38/mm10 with Ensembl version 75 annotations. RNA-seq reads were aligned to the reference genome using tophat2. Only uniquely mapped reads were used for further analysis. Gene counts from SAM files were obtained using htseq-count with mode intersection non-empty, -s reverse. Differential gene expression analysis was conducted using Bioconductor R package DESeq2 version 1.4.5. DESeq2 provides two P-values, a raw P-value and a Benjamini-Hochberg P-value (adjusted p value). An adjusted p-Value threshold of 0.05 was used to determine differential gene expression (95% of the results are not false discoveries, error rate 0.05 = 5%). The data is available at the NCBI Gene Expression Omnibus (accession number: GSE90574, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE90574).
Eprn promoter CpG methylation analysis
Using published genome-wide bisulpite sequencing data (Kalkan et al., 2017; Seisenberger et al., 2012; Wang et al., 2014), Eprn promoter region was defined as the 2 kb region upstream of the TSS and the percentage of CpG methylation within the region was quantified. For promoter average, percentage of CpG methylation around the 2 kb promoter region of each annotated gene was quantified and averaged for all values. For genome average, percentage of CpG methylation of all 50 kb tiling windows was quantified and averaged all values.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your article "A lncRNA/Lin28/let7 axis coupled to DNA methylation fines tunes the dynamics of a cell state transition" for consideration by eLife. Your article has been reviewed by three peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Fiona Watt as the Senior Editor. The reviewers have opted to remain anonymous.The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.Summary:In this study Li et al. describe the actions of a novel lncRNA in the exit of mouse embryonic stem cells from pluripotency. The authors show that Ephemeron (Eprn), identified through an in silico lncRNA knockdown screen for support of naïve or primed pluripotency, is required for ES cells to progress towards the exit from pluripotency in what the authors refer to as a timely fashion. They present further evidence to show that this effect is mediated through Lin28a via DNMT3a and DNMT3b. The authors further reveal that Eprn is found only in mouse and rat and that its knockout is fully compatible with normal development to term.The mechanisms that underlie the dismantling of the pluripotent state in preparation for lineage specification are not fully understood. The authors have employed an interesting screening strategy to address this question and have found a lncRNA that certainly seems to play some type of regulatory role in the process.Essential revisions:The reviewers have some concerns about the overall significance of the study, and are not convinced regarding the mechanistic studies that link Eprn, Lin28a and downstream targets.Reviewer 2 notes:"1) There is really no insight into how the lncRNA functions, 2) The lncRNA is not conserved and thus its relevance appears to be limited to mice, 3) The Eph knockout mouse has no phenotype, 4) along the same lines, the in vitro phenotype is rather subtle, manifesting itself in somewhat contrived experimental conditions."To clarify the significance of Eprn in the regulation of pluripotency, it would be helpful to provide more information on the knockdown cells.Reviewer 1:"Subsection “The function of Lin28a in ESC transition is mediated by suppression of let‐7g” and elsewhere-what exactly do the knockdown cells represent? Are they able to propagate under conditions that support primed pluripotency? This question speaks to how the authors define exit from ESC in these experiments and whether or not this represents the "natural" pathway out of naïve pluripotency.""The ultimate fate of Eprn KO or knockdown ES cells deprived of self-renewing signals is not clear from the study; although one would assume that they would eventually progress towards germ layer lineage specification, their gene expression patterns do not appear to reflect normal developmental progression of pre-implantation and post-implantation epiblast."Reviewer 3 notes that the proposed mechanism (Eprn-Lin28a-Nanog) is largely based on correlative evidence. Provide some additional data along the lines suggested by the reviewer concerning Eprn-nanog promoter regulation, Lin28a-nanog promoter interactions and nanog depletion effects on Lin28a."Using experiments based on single and combined deficiencies, the authors provde evidence that both Nanog and Lin28a likely act downtream of Eprn, which I find justified. However, I failed to be convinced by their conclusion that Lin28a acts upstream of Nanog in this threesome, and that Eprn directly acts on Lin28a. Accordingly, they could not find enrichment for the Lin28a promoter in Eprn ChIRP experiments. But what about the Nanog promoter in this case? Does Eprn associate with it or not? And could they provide data to document as to whether the promoter of Lin28a is occupied or not by Nanog? Moreover, in all their Nanog depletion experiments, could they report on Lin28a expression?"[Editors' note: further revisions were requested prior to acceptance, as described below.]Thank you for resubmitting your work entitled "A lncRNA/Lin28/ Mirlet7 axis coupled to DNA methylation fine tunes the dynamics of a cell state transition" for further consideration at eLife. Your revised article has been favorably evaluated by Fiona Watt (Senior editor), a Reviewing editor and two reviewers.The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:You have provided additional information to address many of the concerns raised in the first round of review, as both referees acknowledge, and your reply to the referees was considered and clear. However, both reviewers continue to have concerns about how strongly the evidence supports the molecular regulatory cascade you describe, and about the overall significance of the role of Eprn in control of pluripotency. It would be appropriate to revise the Discussion and the Abstract to acknowledge some of the remaining uncertainties around mechanism and the putative axis of regulation. Concerning the overall significance of the study, your point about species differences in the regulation of transit through pluripotency is important and perhaps should be highlighted a bit more strongly. For example might there be any relationship between the Eprn fine tuning mechanism (and its suppression by GSK3b inhibition) and the ease of capture of naive pluripotency?Reviewer #2:This revision adds important additional data and responds well to number of the specific concerns. However, several key concerns remain.1) Without mechanism, it is unclear whether the Eprn-Lin28 link is direct or in the same pathway. Therefore, describing it as an Eprn-Lin28 axis seems premature.2) The evidence for let-7 roles in the phenotype is not convincing. Authors present new analysis of sequencing data showing that while let-7 is upregulated in the naïve state, it still exists at very low levels (all let-7 family members combined appear to make up less than 0.3% of all expressed miRNAs). These are low levels especially given that let-7 function is known to be spread across many targets (1). Also, experiments testing let-7 function both in the pluripotency phenotype and on suppressing DNMT3a/b are done at non-physiological levels using transfected miRNA mimics. By the authors' measurements, the exogenously introduced let-7 is introduced at levels at least 30 times higher than the physiological let-7 levels in the same cells. Therefore, there remains a good chance that the let-7 results are not physiologically relevant.3) While I appreciate the importance of the naïve to primed transition as outlined in the response to reviewers, the relatively weak in vitro phenotype (1 day delay) and absence of an in vivo phenotype still raise concern about Eprn's functional importance. Again, I think this issue would not be a major issue if there were more insight into mechanism. That is, either a strong phenotype that provides new major insight into the development of the early mouse embryo or mechanism that provide novel insight to a lncRNA's function would significantly strengthen the paper.1. A. D. Bosson, J. R. Zamudio, P. A. Sharp. Mol Cell 56, 347-359 (2014).Reviewer #3:In this revised version, the authors have provided new data to document the expression patterns of Eprn in vivo and in cellular transitions, the potential for transposable elements and DNA methylation in contributing to Eprn regulation and the epistatic relationship between Eprn, Lin28 and Nanog. They have therefore addressed my request, but we still don' t know how this lnRNA/miRNA/DNA methylation pathway is really organized and acting and it is difficult to estimate whether the Eprn-triggered moleclar cascade has any important role or not.Essential revisions:The reviewers have some concerns about the overall significance of the study, and are not convinced regarding the mechanistic studies that link Eprn, Lin28a and downstream targets.We have identified a lncRNA/protein/miRNA pathway which is an integral part of the multi-layered machinery regulating the irreversible exit from the naïve ESC state. Our finding shows that lncRNA Eprn has a biological function in fine tuning the dynamics of state transition in pluripotent stem cells. We further delineate a genetic pathway downstream of Eprn involving known players in post-transcriptional and epigenetic regulation, specifically Lin28, let-7 and de novo DNA methyltransferases. This cascade leads to timely silencing of Nanog, a major component of the naïve pluripotency transcription factor network. Our findings have additional value in clarifying the functions of Lin28a/let-7 and Dnmt3a/3b in embryonic stem cells. Kumar et al., 2014 proposed that Lin28a destabilises the naïve state in a let-7 dependent fashion and leads to the high heterogeneity of pluripotent stem cells cultured in LIF/serum. Our work unifies these observations with analyses of homogenous stem cell populations in a defined culture system. Specifically, we show that Lin28a acts to promote transition from naïve towards primed pluripotency. This is significant because Lin28 is often presented as a core pluripotency factor. Furthermore, we demonstrated that global de novo methylation, which is rapidly acquired upon naïve state exit in vitro and in vivo (Auclair et al., 2014, Kalkan et al., 2017), facilitates, but is not required for, progression of pluripotency out of the naïve state.Reviewer 2 notes:1) "There is really no insight into how the lncRNA functions.Our study aimed to pinpoint a lncRNA that has a measurable biological function and to reveal the downstream genetic interactions. Given the vast number of lncRNAs in the mammalian genome, a key current goals in the field are: (i) to identify biological functions relevant to cellular behaviours, (ii) to elucidate integration with established regulatory frameworks predominantly comprised of protein coding genes. We believe our study is significant in demonstrating substantial progress towards both of these two goals in the context of the previously uncharacterised lncRNA Eprn.Although we do not have a molecular mechanism on how Eprn regulate Lin28a expression, we include evidence from the effect of siRNA that Eprn RNA is the active entity, and rule out the prevalent mechanism of chromatin association. These results set the stage for investigation of direct molecular mechanism of a lncRNA in a biologically relevant context, but such studies are technologically challenging since there is no consensus on lncRNA mechanism of action and go beyond the scope of our present investigation. We have modified the text to be more explicit about our goals and to qualify our conclusions.2) The lncRNA is not conserved and thus its relevance appears to be limited to mice.Although Eprn is not present in human, it is conserved over 30 million years since mouse-rat divergence. LncRNAs evolve more rapidly than protein coding genes and species–specific lncRNAs represent a large fraction of total lncRNAs (Necsulea et al., 2014). It is thought that lncRNAs are more likely to acquire functions which contribute to species-specific regulation and several examples have recently been discovered (Paralkar et al., 2014, Rani et al., 2016, Durruthy-Durruthy et al., 2016). Understanding how species-specific lncRNAs integrate conserved factors and pathways can offer insight into genome evolution. The rodent specificity of Eprn could be directly related to the more rapid progression from the pre-implantation epiblast to gastrulation in rodents than in other mammals, which necessitates acute extinction of the naïve pluripotency program.3) The Eph knockout mouse has no phenotype.In vitro culture of ESC provides a sensitised platform for delineating redundant individual components within multi-layered regulatory machineries. We surmise that Eprn is dispensable in the laboratory mouse due to the high compensatory capacity of early mouse development. Notably several other well-characterised ES cell regulators, such as Esrrb, Tfcp2l1, LIF, Klf4 and Tfe3, are not essential for the establishment or progression of the epiblast in vivo.4) Along the same lines, the in vitro phenotype is rather subtle, manifesting itself in somewhat contrived experimental conditions. "ESC and naïve pre-implantation epiblast must transit from a naïve state in order to initiate lineage specification. The ESC defined culture system is directly relevant to the trajectory of pre-implantation to early post-implantation epiblast, as documented in recent studies from our group and others (Kalkan et al., 2017; Mulas et al., 2016; Semrau et al. 2016 BioRxiv; Stumpf et al. 2017 BioRxiv; Jang et al., 2017). We exploited this system to demonstrate that from two different starting conditions ESC exhibit a reproducible Eprn mutant phenotype. The phenotype is transient and may be considered subtle, but such fine tuning of complex molecular machinery is likely important in evolutionary terms, as indicated by Eprn conservation between mice and rats. We have reworded the text to make the description of the culture system more clear and better justified.Reviewer 1:" Subsection “The function of Lin28a in ESC transition is mediated by suppression of let‐7g”and elsewhere-what exactly do the knockdown cells represent? Are they able to propagate under conditions that support primed pluripotency? This question speaks to how the authors define exit from ESC in these experiments and whether or not this represents the "natural" pathway out of naïve pluripotency."Despite a delay in naïve state exit, Eprn KO cells downregulate naïve pluripotency associated markers and concomitantly upregulate post-implantation associated markers, as shown in Figure 2—figure supplement 2F. This expression profile indicates that after initial delay Eprn KO cells do progress towards an early post-implantation epiblast-like state in vitro, as we have recently documented for wild type ESC in these conditions (Kalkan et al. 2017 Development). In response to the reviewer’s question we provide new data showing that Eprn KO cells can be converted into primed EpiSC and maintained for at least 10 passages in medium containing Activin/Fgf2/Xav939. They show similar morphology and gene expression to WT ESC derived EpiSCs, as shown in Figure 2—figure supplement 4. Thus the Eprn mutant phenotype is transitory leading to the conclusion that the role of Eprn is to expedite normal timely progression of pluripotency but not to influence the trajectory.“The ultimate fate of Eprn KO or knockdown ES cells deprived of self-renewing signals is not clear from the study; although one would assume that they would eventually progress towards germ layer lineage specification, their gene expression patterns do not appear to reflect normal developmental progression of pre-implantation and post-implantation epiblast."We now demonstrate that Eprn KO cells have the capacity to undergo neuronal and mesendodermal lineage specification. These new data are shown in Figure 2—figure supplement 4 and described in the text in subsection “Molecular consequences of Ephemeron loss”. In line with the observations above these findings confirm that Eprn depletion does not compromise the potency of transitional cells upon naïve state extinction. This is consistent with the development of embryos lacking Eprn and is in line with the phenotypes of several other factors that delay exit from the ESC state in vitro without impairing multi-lineage potency (Betschinger et al., 2013; Leeb et al., 2014; Kalkan and Smith 2014).Reviewer 3 notes that the proposed mechanism (Eprn-Lin28a-Nanog) is largely based on correlative evidence. Provide some additional data along the lines suggested by the reviewer concerning Eprn-nanog promoter regulation, Lin28a-nanog promoter interactions and nanog depletion effects on Lin28a."Using experiments based on single and combined deficiencies, the authors provde evidence that both Nanog and Lin28a likely act downtream of Eprn, which I find justified. However, I failed to be convinced by their conclusion that Lin28a acts upstream of Nanog in this threesome, and that Eprn directly acts on Lin28a. Accordingly, they could not find enrichment for the Lin28a promoter in Eprn ChIRP experiments. But what about the Nanog promoter in this case? Does Eprn associate with it or not? And could they provide data to document as to whether the promoter of Lin28a is occupied or not by Nanog? Moreover, in all their Nanog depletion experiments, could they report on Lin28a expression?"As the reviewer points out, our observations are consistent with Eprn acting upstream of Lin28a, but the specific mechanism by which Eprn regulates Lin28a expression remains unclear. Regarding the possible regulation of Nanog by Eprn, we examined Nanog promoter in our ChIRP experiment. There was no Eprn peak present at the Nanog locus (Figure 2—figure supplement 2D). In fact, from the genome-wide ChIRP analysis, we did not detect any enriched regions in the present of Eprn, indicating that Eprn does not function by chromatin association.As for the possibility of Nanog regulation of Lin28a, we examined two published Nanog ChIP-seq datasets (Chen et al., 2008 and Marson et al., 2008) and could not find any Nanog localisation at the Lin28a locus, contrasting with prominent peaks at the bona fide target gene Esrrb (Figure 2—figure supplement 2G). We also examined the expression of Lin28a in Nanog knockdown cells and found no reduction in Lin28a expression during the naïve state exit (Figure 2—figure supplement 2H). Therefore we conclude that Lin28a is not directly regulated by Nanog.[Editors' note: further revisions were requested prior to acceptance, as described below.]The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:You have provided additional information to address many of the concerns raised in the first round of review, as both referees acknowledge, and your reply to the referees was considered and clear. However, both reviewers continue to have concerns about how strongly the evidence supports the molecular regulatory cascade you describe, and about the overall significance of the role of Eprn in control of pluripotency. It would be appropriate to revise the Discussion and the Abstract to acknowledge some of the remaining uncertainties around mechanism and the putative axis of regulation. Concerning the overall significance of the study, your point about species differences in the regulation of transit through pluripotency is important and perhaps should be highlighted a bit more strongly. For example might there be any relationship between the Eprn fine tuning mechanism (and its suppression by GSK3b inhibition) and the ease of capture of naive pluripotency?We thank the editors and reviewers for their favourable evaluation. We have further revised the Abstract and Discussion and describe the observations as a “connection” and “genetic interaction module” rather than “pathway” to acknowledge the mechanistic uncertainties.We have incorporated the suggestion to further highlight the role of Eprn in species-specific regulation and in this context have discussed the contrasting differences in the requirement of Gsk3 inhibition in maintaining mouse and human naïve pluripotency. While Gsk3 inhibition protects the naïve state in mouse ES cells, it has little impact in human (Theunissen et al., 2016, Guo et al., 2017 in press). This can partly be explained by the lack of ESRRB expression in human pluripotent cells (Blakeley et al., 2015; Martello et al., 2012; Takashima et al., 2014; Theunissen et al., 2014), but our findings suggest that absence of Eprn may be an additional factor that reduces requirement for Gsk3 inhibition. Eprn action in the modulation of a molecular network exemplifies the potential contribution of lncRNAs to species diversification.Reviewer #2:This revision adds important additional data and responds well to number of the specific concerns. However, several key concerns remain.1) Without mechanism, it is unclear whether the Eprn-Lin28 link is direct or in the same pathway. Therefore, describing it as an Eprn-Lin28 axis seems premature.We agree with the reviewer that the direct molecular mechanism linking Eprn to Lin28a is missing. We now describe this link as a connection between Eprn and Lin28a-mirlet7-DNA methylation, rather than an axis, and have revised the title, Abstract and Discussion accordingly.2) The evidence for let-7 roles in the phenotype is not convincing. Authors present new analysis of sequencing data showing that while let-7 is upregulated in the naïve state, it still exists at very low levels (all let-7 family members combined appear to make up less than 0.3% of all expressed miRNAs). These are low levels especially given that let-7 function is known to be spread across many targets (1).The reviewer rightly points out that all let-7 family members combined make up only a small fraction of total miRNA expression in ESCs grown in 2i+LIF. However, a small number of highly expressed miRNA clusters dominate the profile (mir-182/96/183, mir-290-295 and mir-30 clusters constitute 20.2%, 18.3% and 6.0% of all expressed miRNAs respectively). The target pool is restricted amongst these clusters. To reflect potential targets of all expressed miRNAs, we summed the expression of miRNAs sharing the same seed sequence as a class (Author response image 1). “GAGGUAG”, which is the seed sequence class for all let-7 miRNAs ranked 39th (out 1558 seed sequence classes in total), i.e. within the top 2.5% of miRNA seed sequences classes in 2i+LIF. This suggests that let-7 targets are more likely to be regulated than the majority of miRNA targets in ESCs.
Author response image 1.
DOI:
http://dx.doi.org/10.7554/eLife.23468.028
DOI:
http://dx.doi.org/10.7554/eLife.23468.028Also, experiments testing let-7 function both in the pluripotency phenotype and on suppressing DNMT3a/b are done at non-physiological levels using transfected miRNA mimics. By the authors' measurements, the exogenously introduced let-7 is introduced at levels at least 30 times higher than the physiological let-7 levels in the same cells. Therefore, there remains a good chance that the let-7 results are not physiologically relevant.We agree that the expression level of miRNA and the miRNA/target ratio may be functionally significant as described by Bosson et al. (2014). The interaction affinity and the stability of miRNA and target could also affect the outcome. Therefore, the effect of a given miRNA on an individual target has to be investigated experimentally. Currently the field largely relies on overexpression and reporter assays. We have now extended the luciferase reporter analysis (Figure 4 D,E) by assaying mutant Dnmt3b 3’UTR reporters. The results presented in Figure 4—figure supplement 1D confirm that repression by let7-g depends on an intact seed sequence.We attempted to address the reviewer’s concern regarding non-physiological expression levels by using a let-7g inhibitor (miRIDIAN miRNA hairpin inhibitor, Dharmacon) to provide orthogonal evidence. The results were inconclusive, however, because we observed an increase in Dnmt3b but a decrease in Dnmt3a expression upon inhibitor treatment. Since the capacity of this let7-g inhibitor to block other let7 family members is unknown, the approach is technically limited.Functionally, we demonstrated that Dnmt3a/b KO cells have a delayed exit phenotype, phenocopying loss of Lin28a and gain of let-7g, which is consistent with Dnmt3a/b being targets of let-7g. These observations are also consistent with published work (Kumar et al., 2014), in which forced expression of let-7g and loss of Lin28a sustain the naïve state in ESCs cultured in LIF/serum. Therefore, our work unifies these observations with analyses of homogenous stem cell populations in defined culture systems and further clarifies the role of Lin28a/let7 in pluripotency regulation.3) While I appreciate the importance of the naïve to primed transition as outlined in the response to reviewers, the relatively weak in vitro phenotype (1 day delay) and absence of an in vivo phenotype still raise concern about Eprn's functional importance. Again, I think this issue would not be a major issue if there were more insight into mechanism. That is, either a strong phenotype that provides new major insight into the development of the early mouse embryo or mechanism that provide novel insight to a lncRNA's function would significantly strengthen the paper.We agree that the phenotype of Eprn is transient and may be considered subtle. We surmise that rodent specific Eprn-mediated regulation contributes to rapid extinction of the naïve state, which is more acute in rodents than other mammals. High compensatory capacity in early development may nonetheless render Eprn dispensable, at least in the contest of laboratory reared animals.Given the vast number of lncRNAs with unknown functions, experimental demonstration of the functional relevance of a lncRNA to cellular behaviour and mapping its genetic interactions to known regulatory mechanisms constitute a contribution in the current phase of lncRNA biology when there are limited technologies available to dissect mechanism. Additionally, we have defined functional effects of Lin28a, let-7 and Dnmt3a/Dnmt3b in pluripotency progression.1. A. D. Bosson, J. R. Zamudio, P. A. Sharp. Mol Cell 56, 347-359 (2014).Reviewer #3:In this revised version, the authors have provided new data to document the expression patterns of Eprn in vivo and in cellular transitions, the potential for transposable elements and DNA methylation in contributing to Eprn regulation and the epistatic relationship between Eprn, Lin28 and Nanog. They have therefore addressed my request, but we still don' t know how this lnRNA/miRNA/DNA methylation pathway is really organized and acting and it is difficult to estimate whether the Eprn-triggered moleclar cascade has any important role or not.As discussed in our response to reviewer 2 above, although we do not have direct mechanism for Eprn regulation of Lin28, we believe that we have provided strong evidence for the genetic interactions between Eprn, Lin28a/let-7 and Nanog. Furthermore, we have provided evidence that Dnmt3a/3b are targets of the let-7 family and effect Nanog promoter methylation during ES cell transition. The Eprn/miRNA/Dnmt3a/b interaction module is part of a multi-layered machinery that provides acute extinction of the naïve state in rodents. Eprn exemplifies a role of lcnRNAs in fine-tuning regulatory circuitry in species-specific fashion, which we suggest is an important principle.
Authors: Ehsan Habibi; Arie B Brinkman; Julia Arand; Leonie I Kroeze; Hindrik H D Kerstens; Filomena Matarese; Konstantin Lepikhov; Marta Gut; Isabelle Brun-Heath; Nina C Hubner; Rosaria Benedetti; Lucia Altucci; Joop H Jansen; Jörn Walter; Ivo G Gut; Hendrik Marks; Hendrik G Stunnenberg Journal: Cell Stem Cell Date: 2013-07-11 Impact factor: 24.633
Authors: Jin Zhang; Sutheera Ratanasirintrawoot; Sriram Chandrasekaran; Zhaoting Wu; Scott B Ficarro; Chunxiao Yu; Christian A Ross; Davide Cacchiarelli; Qing Xia; Marc Seligson; Gen Shinoda; Wen Xie; Patrick Cahan; Longfei Wang; Shyh-Chang Ng; Supisara Tintara; Cole Trapnell; Tamer Onder; Yuin-Han Loh; Tarjei Mikkelsen; Piotr Sliz; Michael A Teitell; John M Asara; Jarrod A Marto; Hu Li; James J Collins; George Q Daley Journal: Cell Stem Cell Date: 2016-06-16 Impact factor: 24.633
Authors: Nianwei Lin; Kung-Yen Chang; Zhonghan Li; Keith Gates; Zacharia A Rana; Jason Dang; Danhua Zhang; Tianxu Han; Chao-Shun Yang; Thomas J Cunningham; Steven R Head; Gregg Duester; P Duc Si Dong; Tariq M Rana Journal: Mol Cell Date: 2014-02-13 Impact factor: 17.970
Authors: P Carninci; T Kasukawa; S Katayama; J Gough; M C Frith; N Maeda; R Oyama; T Ravasi; B Lenhard; C Wells; R Kodzius; K Shimokawa; V B Bajic; S E Brenner; S Batalov; A R R Forrest; M Zavolan; M J Davis; L G Wilming; V Aidinis; J E Allen; A Ambesi-Impiombato; R Apweiler; R N Aturaliya; T L Bailey; M Bansal; L Baxter; K W Beisel; T Bersano; H Bono; A M Chalk; K P Chiu; V Choudhary; A Christoffels; D R Clutterbuck; M L Crowe; E Dalla; B P Dalrymple; B de Bono; G Della Gatta; D di Bernardo; T Down; P Engstrom; M Fagiolini; G Faulkner; C F Fletcher; T Fukushima; M Furuno; S Futaki; M Gariboldi; P Georgii-Hemming; T R Gingeras; T Gojobori; R E Green; S Gustincich; M Harbers; Y Hayashi; T K Hensch; N Hirokawa; D Hill; L Huminiecki; M Iacono; K Ikeo; A Iwama; T Ishikawa; M Jakt; A Kanapin; M Katoh; Y Kawasawa; J Kelso; H Kitamura; H Kitano; G Kollias; S P T Krishnan; A Kruger; S K Kummerfeld; I V Kurochkin; L F Lareau; D Lazarevic; L Lipovich; J Liu; S Liuni; S McWilliam; M Madan Babu; M Madera; L Marchionni; H Matsuda; S Matsuzawa; H Miki; F Mignone; S Miyake; K Morris; S Mottagui-Tabar; N Mulder; N Nakano; H Nakauchi; P Ng; R Nilsson; S Nishiguchi; S Nishikawa; F Nori; O Ohara; Y Okazaki; V Orlando; K C Pang; W J Pavan; G Pavesi; G Pesole; N Petrovsky; S Piazza; J Reed; J F Reid; B Z Ring; M Ringwald; B Rost; Y Ruan; S L Salzberg; A Sandelin; C Schneider; C Schönbach; K Sekiguchi; C A M Semple; S Seno; L Sessa; Y Sheng; Y Shibata; H Shimada; K Shimada; D Silva; B Sinclair; S Sperling; E Stupka; K Sugiura; R Sultana; Y Takenaka; K Taki; K Tammoja; S L Tan; S Tang; M S Taylor; J Tegner; S A Teichmann; H R Ueda; E van Nimwegen; R Verardo; C L Wei; K Yagi; H Yamanishi; E Zabarovsky; S Zhu; A Zimmer; W Hide; C Bult; S M Grimmond; R D Teasdale; E T Liu; V Brusic; J Quackenbush; C Wahlestedt; J S Mattick; D A Hume; C Kai; D Sasaki; Y Tomaru; S Fukuda; M Kanamori-Katayama; M Suzuki; J Aoki; T Arakawa; J Iida; K Imamura; M Itoh; T Kato; H Kawaji; N Kawagashira; T Kawashima; M Kojima; S Kondo; H Konno; K Nakano; N Ninomiya; T Nishio; M Okada; C Plessy; K Shibata; T Shiraki; S Suzuki; M Tagami; K Waki; A Watahiki; Y Okamura-Oho; H Suzuki; J Kawai; Y Hayashizaki Journal: Science Date: 2005-09-02 Impact factor: 47.728
Authors: Yasuhiro Takashima; Ge Guo; Remco Loos; Jennifer Nichols; Gabriella Ficz; Felix Krueger; David Oxley; Fatima Santos; James Clarke; William Mansfield; Wolf Reik; Paul Bertone; Austin Smith Journal: Cell Date: 2014-09-11 Impact factor: 41.582
Authors: Ge Guo; Ferdinand von Meyenn; Maria Rostovskaya; James Clarke; Sabine Dietmann; Duncan Baker; Anna Sahakyan; Samuel Myers; Paul Bertone; Wolf Reik; Kathrin Plath; Austin Smith Journal: Development Date: 2017-08-01 Impact factor: 6.868
Authors: Thorold W Theunissen; Marc Friedli; Yupeng He; Evarist Planet; Ryan C O'Neil; Styliani Markoulaki; Julien Pontis; Haoyi Wang; Alexandra Iouranova; Michaël Imbeault; Julien Duc; Malkiel A Cohen; Katherine J Wert; Rosa Castanon; Zhuzhu Zhang; Yanmei Huang; Joseph R Nery; Jesse Drotar; Tenzin Lungjangwa; Didier Trono; Joseph R Ecker; Rudolf Jaenisch Journal: Cell Stem Cell Date: 2016-07-14 Impact factor: 25.269
Authors: Karin C Kiontke; R Antonio Herrera; Edward Vuong; Jintao Luo; Erich M Schwarz; David H A Fitch; Douglas S Portman Journal: Dev Cell Date: 2019-04-04 Impact factor: 12.270
Authors: Carla Mulas; Tüzer Kalkan; Ferdinand von Meyenn; Harry G Leitch; Jennifer Nichols; Austin Smith Journal: Development Date: 2019-03-26 Impact factor: 6.862
Authors: Emma Bell; Edward W Curry; Wout Megchelenbrink; Luc Jouneau; Vincent Brochard; Rute A Tomaz; King Hang T Mau; Yaser Atlasi; Roshni A de Souza; Hendrik Marks; Hendrik G Stunnenberg; Alice Jouneau; Véronique Azuara Journal: Nat Commun Date: 2020-02-28 Impact factor: 14.919