Atg4 plays an important role in efficient expansion of autophagic isolation membranes by cleaving lipidated Atg8 in Saccharomyces cerevisiae.

Autophagy, an intracellular degradation system, is highly conserved among eukaryotes from yeast to mammalian cells. In the yeast Saccharomyces cerevisiae, most Atg (autophagy-related) proteins, which are essential for autophagosome formation, are recruited to a restricted region close to the vacuole, termed the vacuole-isolation membrane contact site (VICS), upon induction of autophagy. Subsequently, the isolation membrane (IM) expands and sequesters cytoplasmic materials to become a closed autophagosome. In S. cerevisiae, the ubiquitin-like protein Atg8 is C-terminally conjugated to the phospholipid phosphatidylethanolamine (PE) to generate Atg8-PE. During autophagosome formation, Atg8-PE is cleaved by Atg4 to release delipidated Atg8 (Atg8G116) and PE. Although delipidation of Atg8-PE is important for autophagosome formation, it remains controversial whether the delipidation reaction is required for targeting of Atg8 to the VICS or for subsequent IM expansion. We used an IM visualization technique to clearly demonstrate that delipidation of Atg8-PE is dispensable for targeting of Atg8 to the VICS, but required for IM expansion. Moreover, by overexpressing Atg8G116, we showed that the delipidation reaction of Atg8-PE by Atg4 plays an important role in efficient expansion of the IM other than supplying unlipidated Atg8G116. Finally, we suggested the existence of biological membranes at the Atg8-labeled structures in Atg8-PE delipidation-defective cells, but not at those in atg2Δ cells. Taken together, it is likely that Atg2 is involved in localization of biological membranes to the VICS, where Atg4 is responsible for IM expansion.

Introduction

Eukaryotic cells have an intracellular degradation system, macroautophagy (hereafter autophagy), which is conserved from yeast to mammals [1]. When autophagy is induced by starvation or other stresses, most Atg proteins are recruited to a dot close to the vacuole, termed the vacuole-isolation membrane contact site (VICS) [2]. Next, the isolation membrane (IM), a membrane sac, expands by engulfing cytoplasmic materials and subsequently closes to form the autophagosome, a double-membrane organelle [3, 4]. The outer membrane of a completed autophagosome then fuses with the vacuole (lysosome in mammals) to release the autophagic body and its inner membrane compartment for degradation [3]. Currently, 41 Atg (autophagy-related) proteins have been identified in Saccharomyces cerevisiae, of which 19 are essential for autophagosome formation.

Among the Atg proteins involved in autophagosome formation, Atg8, a ubiquitin-like protein, is a reliable marker for monitoring progression of autophagy because it localizes to the VICS, IM, and autophagosome (hereafter, autophagy-related structures) and is ultimately transported into the vacuole [5-7]. Initially, Atg8 is synthesized with an arginine (residue 117) at the C-terminus, but is processed by the cysteine protease Atg4 to produce glycine-exposed Atg8 (Atg8G116) [8]. Subsequently, Atg8 undergoes a ubiquitin-like conjugation reaction involving Atg7 and Atg3, an E1- and an E2-like enzyme, respectively; the Atg16·Atg5-Atg12 complex serves as an E3-like enzyme in this reaction. Finally, Atg8 is conjugated to the phospholipid phosphatidylethanolamine (PE), which anchors it to membranes [9]. Atg4 also enzymatically cleaves the amide bond between Atg8 and PE to facilitate their recycling and promote autophagosome formation [5, 8].

Cleavage of the arginine residue of Atg8 by Atg4 (hereafter, ‘cleavage’) is required for Atg8-PE production, which is in turn necessary for targeting of Atg8 to autophagy-related structures. The requirement for Atg8 cleavage can be bypassed by cells expressing Atg8G116 instead of full-length Atg8. Atg8G116 cells can produce Atg8-PE in the absence of Atg4 cleavage activity, but autophagy is still defective [5, 10, 11]. Thus, cleavage of Atg8-PE by Atg4 (hereafter, ‘delipidation’) is also important for autophagy. However, it remains unknown whether the defect in delipidation affects targeting of Atg8 to the VICS or subsequent IM expansion.

In this study, we bypassed the cleavage reaction using Atg8G116 cells and visualized the IM as a cup-shaped structure under the fluorescence microscope by overexpressing precursor Ape1, a selective cargo of autophagosomes [2]. This analysis showed that the delipidation reaction did not affect Atg8 targeting to the VICS and that IM expansion was severely impaired in delipidation mutants. We conclude that delipidation of Atg8-PE is important for efficient IM expansion.

Materials and methods

Plasmids

The plasmids and primers used in this study are listed in Tables 1 and 2. Plasmid pRS314[mNeonGreen-Atg8] was created by replacing the GFP sequence of pRS314[GFP-Atg8] [12] with the BamHI cassette of mNeonGreen, amplified from pFA6a-2×mNeonGreen-kanMX using primers mNeonGreen_F and mNeonGreen_R [13]. Next, pRS314[mNeonGreen-Atg8] was digested with XhoI and SacI, and the fragment was cloned into pRS305 after digestion with XhoI and SacI to generate pRS305[mNeonGreen-Atg8]. Plasmid pRS303[mNeonGreen-Atg8] was generated by cloning the mNeonGreen-Atg8 fragment from pRS314[mNeonGreen-Atg8] digested with XhoI and SacI into pRS303 digested with the same enzymes. Plasmid pRS303[mNeonGreen-Atg8G116] was generated by PCR-based site-directed mutagenesis using pRS303[mNeonGreen-Atg8] as a template and Atg8deltaRF and Atg8deltaRR as primers. pRS316[Atg4] was digested with XhoI and SacI, and the fragment was cloned into pRS314 after digestion with the same enzymes to generate pRS314[Atg4].

Table 1

Plasmids used in this study.

Name	Alias	Properties	Marker	Source
pYEX-BX[prApe1]		Plasmid for expression of the Ape1 proform from the CUP1 promoter	URA3	[2]
pRS424[prApe1]		Plasmid for expression of the Ape1 proform from the CUP1 promoter	TRP1	[2]
pRS314[GFP-Atg8]		Plasmid for expression of GFP-Atg8	TRP1	[12]
pRS314		Centromeric plasmid	TRP1	[25]
pRS424		2μ plasmid	TRP1	[25]
pRS426		2μ plasmid	URA3	[25]
pRS316		Centromeric plasmid	URA3	[25]
pRS303		Integration plasmid	HIS3	[25]
pRS305		Integration plasmid	LEU2	[25]
pFA6a-hphNT1		Plasmid for gene disruption	hphNT1	[26]
pYEX-BX		2μ plasmid	URA3	Clontech
pRS306[Atg8G116]ΔClaI		plasmid for integration of Atg8G116	URA3	Lab stock
pRS316[Atg4]	pNAK274	Plasmid for expression of Atg4	URA3	Provided by Dr. Hitoshi Nakatogawa
pRS426[Atg8]		Plasmid for overexpression of Atg8	URA3	Provided by Dr. Hitoshi Nakatogawa
pRS426[Atg8G116]		Plasmid for overexpression of Atg8G116	URA3	Provided by Dr. Hitoshi Nakatogawa
pRS314[GFP-Atg8G116]		Plasmid for expression of GFP-Atg8G116	URA3	Provided by Dr. Yoshinori Ohsumi
pFA6a-2×mNeonGreen-kanMX		Plasmid for C-terminal integration of 2×mNeonGreen	KanMX	Provided by Dr. Yoshinori Ohsumi
pRS314[Atg4]		Plasmid for expression of Atg4	TRP1	This study
pRS314[mNeonGreen-Atg8]	pYO3283	Plasmid for expression of mNeonGreen-Atg8	TRP1	This study
pRS305[mNeonGreen-Atg8]	pYO3284	Plasmid for integration of mNeonGreen-Atg8	LEU2	This study
pRS303[mNeonGreen-Atg8]		Plasmid for integration of mNeonGreen-Atg8	HIS3	This study
pRS303[mNeonGreen-Atg8G116]	pYO3287	Plasmid for integration of mNeonGreen-Atg8G116	HIS3	This study

Table 2

Primers used in this study.

Name	Sequence
APG04N-500F	GCCCTTCCTGCTTGTAGGTCAG
APG04C+600R	CCCACCTCTATTCATCAAATCTTCAC
ATG11N-800F	CATCATCGAGTGTTTTTCCTTTTATGTGGCC
ATG11C+500R	CCGGGTGTCGGTC
APG17N-600F	CAACCACCTCATCCTCAGAGCTC
APG17C+600R	CGTTGCATGCAGAACTACTACCATC
Atg8deltaRF	GTCACTTACTCAGGAGAAAATACATTTGGCTAGTCTTTTATATGAAAAGAAATGAAGCG
Atg8deltaRR	CGCTTCATTTCTTTTCATATAAAAGACTAGCCAAATGTATTTTCTCCTGAGTAAGTGAC
Atg2_del_Univ_F	GCATAAAGATTAAAGCAAATTAAGAGGAACCCTTTTTTTTTTTGATTTCGATACAATGCGTACGCTGCAGGTCGAC
Atg2_del_Univ_R	CGGCCGAATAATTGCCACAGGTGCAGCTCTAGCAACATAAACTGCTGCGGCGCTCGGCCCATCGATGAATTCGAGCTCG
mNeonGreen_F	AAAGGATCCGTTTCGAAAGGCGAAGAAGACAATG
mNeonGreen_R	AAAGGATCCCTTGTATAACTCGTCAG
Atg1_C_Univ_F	GATAGTATTGCAAACAGGTTGAAAATATTGAGGCAGAAGATGAACCACCAAAATGGTGGTGCAGCAGGAGGATCG
Atg1_C_Univ_R	CTTGAAAATATAGCAGGTCATTTGTACTTAATAAGAAAACCATATTATGCATCACTTAATCGATGAATTCGAGCTCG
Atg16_C_Univ_F	GGCTAAAAAAGACAGAGAAAGAGACAGAAGCCATGAACAGCGAAATAGATGGAACGAAAGGTGGTGCAGCAGGAGGATCG
Atg16_C_Univ_R	CCACAATGATTTTATTTTCTTTTGTATGCATTTTGTGACGATTTGACAACTGATGCATTAATCGATGAATTCGAGCTC

Strains, media, and growth conditions

The yeast strains used in this study are listed in Table 3. Cells were cultured in YPD (1% Bacto™ yeast extract, 2% Bacto™ peptone, 2% glucose), SDCA (0.17% Difco™ yeast nitrogen base w/o amino acids and ammonium sulfate, 0.5% ammonium sulfate, 0.5% Bacto™ casamino acids, 2% glucose), or SDDO medium (0.17% Difco™ yeast nitrogen base w/o amino acids and ammonium sulfate, 0.5% ammonium sulfate, 2% glucose, appropriate nutrients for plasmid selection). Amplification of plasmids was carried out utilizing E. coli cells grown in LB medium (1% Bacto™ tryptone, 0.5% Bacto™ yeast extract, 1% NaCl). When relevant, ampicillin was added to the LB medium at a concentration of 60 μg/ml. To drive the Cu2+-inducible CUP1 promoter, cells were cultured for 1 day in medium containing 250 μM CuSO4 prior to experiments. Autophagy was induced by addition of 0.2 μg/ml rapamycin.

Table 3

Yeast strains used in this study.

Strain	Genotype	Source
YCK445	SEY6210; dpm1Δ::DPM1-YEGFP:kanMX	[2]
KVY13	SEY6210; atg4Δ::LEU2	[8]
KVY53	SEY6210; atg4Δ::LEU2 pho8Δ::pho8Δ60	[8]
ORY0804	SEY6210; atg8Δ::GFP-ATG8 atg4Δ::spHIS5	[17]
SEY6210	MATα lys2 suc2 his3 leu2 trp1 ura3	[27]
KVY55	SEY6210; pho8Δ::pho8Δ60	[28]
GYS608	SEY6210; atg8Δ::ATG8G116 atg4Δ::LEU2	Lab stock
GYS622	SEY6210; atg8Δ::GFP-ATG8G116 atg4Δ::LEU2	Lab stock
GYS891	SEY6210; ypt7Δ::natNT2 atg11Δ::cgHIS3 atg17Δ::hphNT1	Lab stock
YOC5308	SEY6210; pho8Δ::pho8Δ60 ATG8::ATG8G116	This study
YOC5309	SEY6210; atg4Δ::LEU2 pho8Δ::pho8Δ60 ATG8::ATG8G116	This study
YOC5270	SEY6210; atg8Δ::GFP-ATG8G116 atg4Δ::LEU2 atg11Δ::cgHIS3	This study
YOC5269	SEY6210; atg8Δ::GFP-ATG8G116 atg4Δ::LEU2 atg17Δ::hphNT1	This study
YOC5271	SEY6210; atg8Δ::GFP-ATG8G116 atg4Δ::LEU2 atg11Δ::cgHIS3 atg17Δ::hphNT1	This study
YOC5209	SEY6210; leu2Δ::mNeonGreen-ATG8:LEU2	This study
YOC5272	SEY6210; leu2Δ::mNeonGreen-ATG8:LEU2 atg4Δ::spHIS5	This study
YOC5330	SEY6210; atg8Δ::ATG8G116 his3Δ::mNeonGreen-ATG8G116:HIS3 atg4Δ::LEU2	This study
YOC5331	SEY6210; atg8Δ::ATG8G116 his3Δ::mNeonGreen-ATG8G116:HIS3 atg4Δ::LEU2 atg2Δ::hphNT1	This study
YOC5469	SEY6210; atg8Δ::ATG8G116 atg4Δ::LEU2 atg1Δ::ATG1-2×mNeonGreen-kanMX	This study
YOC5470	SEY6210; atg8Δ::ATG8G116 atg4Δ::LEU2 atg16Δ::ATG16-2×mNeonGreen-kanMX	This study

To construct pho8Δ60 Atg8G116 (YOC5308) and pho8Δ60 Atg8G116 atg4Δ (YOC5309) strains, the pRS306[Atg8G116]ΔClaI plasmid was digested with EcoRI and integrated into pho8Δ60 (KVY55) and pho8Δ60 atg4Δ (KVY53) strains, respectively. Then, colonies selected by SDCA (-URA) plates were transferred onto 5-Fluoroorotic acid (5-FOA) plates (0.17% Difco™ yeast nitrogen base w/o amino acids and ammonium sulfate, 0.5% ammonium sulfate, 0.5% Bacto™ casamino acids, 2% glucose, 0.1% 5-FOA) for gene replacement by homologous recombination.

The mNeonGreen-Atg8–expressing wild-type strain (YOC5209) was constructed by integrating pRS305[mNeonGreen-Atg8] digested with AflII into the LEU2 locus of the wild-type strain SEY6210. The mNeonGreen-Atg8G116 expressing Atg8G116 atg4Δ strain (YOC5330) was constructed by integrating pRS303[mNeonGreen-Atg8G116] digested with NheI into the HIS3 locus of the Atg8G116 atg4Δ strain GYS608.

Gene disruptions of ATG2, ATG4, ATG11, and ATG17 were performed by homologous recombination. For disruption of ATG2, the DNA fragment was PCR-amplified using plasmid pFA6a-hphNT1 as template and Atg2_del_Univ_F and Atg2_del_Univ_R as primers. For ATG4 disruption, genomic DNA obtained from ORY0804 was used as a template, and APG04N-500F and APG04C+600R were used as primers. For disruption of ATG11 and ATG17, genomic DNA obtained from GYS891 was used as a template and ATG11N-800F/ATG11C+500R and APG17N-600F/APG17C+600R as primers, respectively.

The Atg8G116 atg4Δ Atg1-2×mNeonGreen (YOC5469) and Atg8G116 atg4Δ Atg16-2×mNeonGreen (YOC5470) strains were constructed by transformation of the DNA fragments amplified from the pFA6a-2×mNeonGreen-kanMX plasmid into Atg8G116 atg4Δ cells using Atg1_C_Univ_F/Atg1_C_Univ_R or Atg16_C_Univ_F/Atg16_C_Univ_R as primers, respectively.

Alkaline phosphatase (ALP) assay

The ALP assay was performed as described previously [14]. Cells were grown to mid-log phase and shifted to SD(-N) medium (0.17% Difco™ yeast nitrogen base w/o amino acids and ammonium sulfate, 2% glucose) to induce autophagy. Lysates were prepared by disrupting the cells with glass beads in the ice-cold ALP assay buffer (250 mM Tris-HCl (pH9.0), 10 mM MgSO4, 10 μM ZnSO4, 1 mM phenylmethylsulfonyl fluoride) and the cell debris was removed by centrifugation at 2,000 × g for 5 min. ALP activity in the lysate was assayed with 5.5 mM 1-naphthyl phosphate as a substrate for 10 min at 30°C, and the reaction was stopped by addition of the ALP stop buffer (2 M glycine-NaOH (pH 11.0)). The fluorescence intensity (excitation: 360nm, emission: 465nm) was measured using an RF-5300PC spectrofluorophotometer (Shimadzu).

Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) and western blotting analysis

Cells cultured in SDCA medium (2×107 cells/ml) were subjected to alkaline trichloroacetic acid (TCA) lysis followed by SDS-PAGE and western blotting analysis [15]. For analysis of Ape1 maturation, SDS-PAGE was performed using 10% acrylamide gel. For analysis of Atg8-PE formation, a 13.5% acrylamide gel containing 6 M urea was used. For analysis of GFP-Atg8 cleavage, 12% acrylamide gel was used. Proteins were transferred to polyvinylidene fluoride (PVDF) membranes (Immobilon-P, Millipore) utilizing a semi-dry transfer apparatus (Bio-Rad) at 2 mA per 1 cm2 for 45 min (10% or 12% gel) or 15 V constant voltage for 30 min (13.5% gel with 6 M urea). Following transfer, the membranes were blocked with 2% skim milk in Tris-buffered saline containing 0.05% Tween 20 (TBST) for 30 min at room temperature (RT). Membranes were then incubated with primary anti-Atg8 (1:5000) [6], anti-Ape1 (1:10000) [16] anti-GFP (1:10000; JL-8, Clontech) antibodies for 60 min at RT. Subsequently, membranes were washed three times with TBST and treated with horseradish peroxidase (HRP)-labeled anti-rabbit or -mouse secondary antibodies (Promega) at a dilution of 1:5000 for 30 min, followed by an additional wash cycle in TBST. Chemiluminescent signals generated with the enhanced chemiluminescence (ECL) reagent (GE Healthcare) were detected on an IR-LAS 1000 imaging system (FUJIFILM).

Fluorescence microscopy

Cells were cultured in SDCA medium to a density of about 5×107 cells/ml, and autophagy was induced by addition of rapamycin. Cells were harvested, spun at RT with a microcentrifuge, and subjected to fluorescence microscopy using an IX83 inverted system microscope (Olympus) equipped with a UPlanSApo100×/1.40 Oil (Olympus) and a CoolSNAP HQ CCD camera (Nippon Roper). A U-FGFP and U-FMCHE filter sets (Olympus) were used for GFP/mNeonGreen and octadecyl rhodamine B (R18, Invitrogen)/FM4-64 staining visualization, respectively. Images were acquired using the MetaVue imaging software (Molecular Devices). For determination of IM length, fluorescence intensities of mNeonGreen-labeled Atg proteins were measured using the ‘linescan’ function of the MetaView software, and the full width at half maximum was calculated manually.

For R18 staining, cells were stained with 10 μg/ml of R18 (1 mg/ml stock dissolved in dimethyl sulfoxide) for 10 min in nutrient-rich medium at 30°C. After cells were washed three times with fresh medium, rapamycin was added to induce autophagy. FM 4–64 staining was performed as previously described [16].

Results

Localization of Atg8 to autophagy-related structures requires Atg8 cleavage but not Atg8-PE delipidation

Cleavage of Atg8 by Atg4 is a prerequisite for Atg8-PE formation, which is in turn essential for localization of Atg8 to autophagy-related structures; thus, autophagosome formation is abolished in atg4Δ cells [8, 17]. When Atg8 lacking the C-terminal arginine residue (Atg8G116) is expressed in atg4Δ cells, cleavage of Atg8 can be bypassed; Atg8-PE is produced in the absence of Atg4, but autophagosome formation is still defective in this mutant [5]. We examined the autophagic activity of Atg8G116 atg4Δ cells by performing Ape1 maturation, GFP-Atg8 cleavage, and alkaline phosphatase assays. The results revealed that these cells are defective in autophagy (Fig 1).

Fig 1

Autophagic activity of ATG8G116 atg4Δ cells.

(A) ATG8 atg4Δ (KVY13) or ATG8G116 atg4Δ (GYS608) cells carrying an empty or Atg4-expressing plasmid were grown in SDCA medium to mid-log phase and treated with rapamycin for 2 h. Western blot analysis was performed using anti-Atg8 and anti-Ape1 antisera. Slower-migrating bands in the upper panel correspond to Atg8/Atg8G116 (Unlipidated Atg8), and faster-migrating bands correspond to Atg8-PE. Slower-migrating bands in the lower panel correspond to the precursor form of Ape1 (prApe1), and faster-migrating bands correspond to the mature Ape1 (mApe1). (B) ATG8 atg4Δ (KVY13) or ATG8G116 atg4Δ (GYS608) cells carrying the indicated plasmids were grown in SDCA medium to mid-log phase and treated with rapamycin for 2 h. Western blot analysis was performed with anti-GFP antibodies. Slower-migrating bands represent GFP-tagged Atg8 (GFP-Atg8), and faster-migrating bands represent cleaved GFP. (C) ATG8G116 (YOC5308) and ATG8G116 atg4Δ (YOC5309) cells were grown in SDCA medium to mid-log phase and shifted to SD(-N) medium and incubated for 4 h at 30°C. Then autophagic activity was measured by the alkaline phosphatase assay. Error bars indicate standard deviations. N.S. indicates not significant. *P < 0.05, **P < 0.01 (two-tailed Student’s t-test) (n = 3).

It remains controversial whether delipidation of Atg8-PE is required for targeting of Atg8 to autophagy-related structures [5, 10, 11]. To address this issue, we first examined localization of Atg8 and Atg8G116 by fluorescence microscopy. In GFP-Atg8 expressing wild-type cells, GFP-Atg8 was visualized as puncta close to the vacuole, which corresponded to autophagy-related structures (Fig 2A). By contrast, the abundance of puncta was markedly reduced in atg4Δ cells (Fig 2A); this observation was supported by counting the number of puncta per cell (Fig 2B). This result is reasonable because lipidation of GFP-Atg8 is inhibited in the absence of Atg4. Next, we examined the localization of GFP-Atg8G116. GFP-Atg8G116 was detected as puncta in wild-type and atg4Δ cells (Fig 2A). Quantification of the puncta revealed that the number of puncta was significantly smaller in atg4Δ cells than in wild-type cells (Fig 2B). This decrease is probably caused by lacking the localization of GFP-Atg8G116 to at least autophagosomes in atg4Δ cells because autophagosome formation is severely defective in Atg8G116 atg4Δ cells [5]. Moreover, GFP-Atg8G116 exhibited a vacuolar membrane pattern in atg4Δ cells, as previously reported (Fig 2A, arrows) [5].

Fig 2

Localization of GFP-Atg8 and GFP-Atg8G116 in atg4Δ cells.

(A) GFP-ATG8 atg4Δ (ORY0804) or GFP-ATG8G116 atg4Δ (GYS622) cells carrying an empty or Atg4-expressing plasmid were grown to mid-log phase in SDCA medium and treated with rapamycin for 1 h. Arrows indicate the vacuole rim. DIC, differential interference contrast. Scale bar: 5 μm. (B) Number of GFP-Atg8 puncta per cell. Error bars indicate standard deviations. **P < 0.01 (two-tailed Student’s t-test). At least 40 cells were counted for each experiment (n = 4).

Autophagy-related structures disappear in atg11Δ atg17Δ cells because Atg11 and Atg17 are scaffold proteins playing a role in recruitment of Atg proteins [17, 18]. To determine whether the puncta observed in GFP-Atg8G116–expressing cells represented autophagy-related structures, we disrupted ATG11 and ATG17 genes in these strains. In ATG4 cells expressing GFP-Atg8G116, the number of puncta decreased in atg11Δ, atg17Δ, and atg11Δ atg17Δ cells (Fig 3). In atg4Δ cells expressing GFP-Atg8G116, the number of puncta decreased upon disruption of ATG11, ATG17, or both (Fig 3A). Quantification revealed that the number of the puncta was at the basal level in atg11Δ, atg17Δ, and atg11Δ atg17Δ cells (Fig 3B). Therefore, the puncta observed in GFP-Atg8G116–expressing ATG4 and atg4Δ cells are unlikely to be dead-end structures, and instead correspond to autophagy-related structures.

Fig 3

Localization of GFP-Atg8G116 in atg4Δ cells lacking the scaffold complex for autophagy-related structures.

(A) atg4Δ (GYS622), atg4Δ atg11Δ (YOC5270), atg4Δ atg17Δ (YOC5269), and atg4Δ atg11Δ atg17Δ (YOC5271) cells expressing GFP-Atg8G116 and carrying an empty or Atg4-expressing plasmid were grown to mid-log phase in SDCA medium and treated with rapamycin for 1 h. Scale bar: 5 μm. (B) Number of GFP-Atg8G116 puncta per cell. Error bars indicate standard deviations. N.S., not significant. **P < 0.01 (two-tailed Student’s t-test). At least 40 cells were counted for each experiment (n = 4).

Atg8-PE delipidation is important for IM expansion

The number of GFP-Atg8G116 dots observed in ATG4 cells markedly decreased in atg4Δ cells (Fig 2), and these dots corresponded to autophagy-related structures (Fig 3). Together, these observations support the fact that the autophagosome is hardly generated in Atg8G116 atg4Δ cells. Next, we examined whether the IM expands in Atg8G116 atg4Δ cells by the prApe1-overexpression system, which enables visualization of the IM as a cup-shaped structure [2]. In this experiment, Atg8 and Atg8G116 were visualized by fusing green fluorescent mNeonGreen to their N-termini.

Cup-shaped IMs were visualized in wild-type cells expressing mNeonGreen-Atg8, but no autophagy-related structures were observed in atg4Δ cells due to their defect in cleavage (Fig 4A). mNeonGreen-Atg8G116 was visualized as a cup-shaped structure in wild-type cells, but as dots in atg4Δ and atg2Δ cells (Fig 4A). We observed no significant difference in IM lengths between wild-type cells expressing mNeonGreen-Atg8 and those expressing mNeonGreen-Atg8G116 (Fig 4B), indicating that cleavage by Atg4 does not have a large impact on IM lengths. The average IM lengths in mNeonGreen-Atg8G116 expressing wild-type, atg4Δ, and atg2Δ cells were 0.83 μm, 0.43 μm, and 0.41 μm, respectively (Fig 4B), indicating that the IM lengths in atg4Δ cells were significantly shorter than those in wild-type cells. In atg2Δ cells, Atg8G116 can localize to the VICS, but the IM does not expand [2, 17]. We detected no significant differences in IM lengths between Atg8G116 expressing atg4Δ and atg2Δ cells (Fig 4B). Thus, IM expansion was reduced to the basal level without delipidation.

Fig 4

IM expansion in delipidation-mutant cells.

(A) mNeonGreen(mNG)-Atg8 atg4Δ (YOC5272) and mNG-Atg8G116 atg4Δ (YOC5330) cells carrying an empty or Atg4-expressing plasmid, mNG-Atg8G116 atg4Δ atg2Δ (YOC5331) cells carrying an Atg4-expressing plasmid, and mNG-Atg8G116 atg4Δ (YOC5330) cells carrying an Atg8- or Atg8G116-overexpressing (ox) plasmid were grown to mid-log phase in SDCA medium containing CuSO4, and then treated with rapamycin for 1 h. Scale bar: 2 μm. (B) Lengths of IMs were measured. Error bars indicate standard deviations. **P < 0.01 (two-tailed Student’s t-test).

In mammalian cells, the IM can expand without lipidation of Atg8 or Atg8 itself [19-21]. Therefore, we examined the IMs labeled with other marker proteins in Atg8G116 ATG4 and Atg8G116 atg4Δ cells. Previously, our group have shown that Atg1 and Atg16 are localized to the IM [2]. Therefore, we examined localization of Atg1 and Atg16 in Atg8G116 ATG4 or Atg8G116 atg4Δ cells overexpressing prApe1. In Atg8G116 ATG4 cells, Atg1 and Atg16 were visualized as cup-shaped structures, whereas they are observed as dots in Atg8G116 atg4Δ cells (Fig 5A). The IM lengths of the structures in Atg8G116 atg4Δ cells were significantly shorter than those in Atg8G116 ATG4 cells (Fig 5B). These results show that the IMs labeled with Atg1 and Atg16 cannot fully expand without delipidation. Taken together, we conclude that delipidation of Atg8-PE is important for IM expansion.

Fig 5

Lengths of Atg1 or Atg16-labeled IMs in delipidation-mutant cells.

(A) Atg1-mNG Atg8G116 atg4Δ (YOC5469) and Atg16-mNG Atg8G116 atg4Δ (YOC5470) cells carrying an empty or Atg4-expressing plasmid were grown to mid-log phase in SDCA medium containing CuSO4, and then treated with rapamycin for 1 h. Scale bar: 2 μm. (B) Lengths of IMs were measured. Error bars indicate standard deviations. **P < 0.01 (two-tailed Student’s t-test).

Atg8-PE delipidation plays an important role in IM expansion other than supplying unlipidated Atg8

Most Atg8G116 expressed in atg4Δ cells was detected as Atg8-PE (Fig 6, lane 2) [5]. We hypothesized that the shortage of unlipidated Atg8G116 caused a defect in IM expansion in Atg8G116-expressing atg4Δ cells as shown in Fig 4. To address this issue, we overexpressed Atg8 or Atg8G116 in Atg8G116 background cells. In Atg8G116 ATG4 cells, overexpressed Atg8 and Atg8G116 were mostly detected as an unlipidated form, and Atg8-PE was detected as minor bands (Fig 6, lanes 3 and 4). Overexpression of Atg8 and Atg8G116 in Atg8G116 ATG4 cells did not affect the maturation of Ape1 (Fig 6, lanes 3 and 4). When Atg8 was overexpressed in Atg8G116 atg4Δ cells, most Atg8 was detected as an unlipidated form (Fig 6, lane 5). On the other hand, Atg8-PE as well as unlipidated Atg8 was detected in Atg8G116 atg4Δ cells overexpressing Atg8G116 (Fig 6, lane 6). Nevertheless, the maturation of Ape1 was severely defective in Atg8G116 atg4Δ cells overexpressing Atg8G116 (Fig 6, lane 6). These results indicate that only the presence of unlipidated Atg8G116 in addition to Atg8-PE is insufficient to recover autophagic activity in Atg8G116 atg4Δ cells, suggesting that the shortage of unlipidated Atg8G116 is not the main cause of a defect in autophagy in these cells.

Fig 6

Autophagic activity of Atg8G116 atg4Δ cells overexpressing Atg8/Atg8G116.

ATG8G116 atg4Δ (GYS608) cells expressing indicated proteins were grown in SDCA medium to mid-log phase, and then treated with rapamycin for 2 h. Western blot analysis was performed with anti-Atg8 and anti-Ape1 antisera. Short- and long-exposed images were shown. Slower-migrating bands in the upper and middle panels correspond to unlipidated Atg8, and faster-migrating bands correspond to Atg8-PE. Slower-migrating bands in the lower panel correspond to the precursor form of Ape1 (prApe1), and faster-migrating bands correspond to the mature Ape1 (mApe1). ox indicates overexpression.

Next, we measured IM lengths in Atg8G116 atg4Δ cells overexpressing Atg8 or Atg8G116. The IM lengths in both strains were significantly longer than those in Atg8G116 atg4Δ cells but significantly shorter than those in Atg8G116 ATG4 cells (Fig 4). This result suggests that the defect in IM expansion in Atg8G116 atg4Δ cells cannot be fully recovered by supplying unlipidated Atg8G116. Taken together, we conclude that delipidation of Atg8 itself plays an important role in efficient IM expansion.

Autophagic membranes are present in cells defective in Atg8-PE delipidation, but not in atg2Δ cells

We tested several kinds of lipophilic fluorescent dyes and found that octadecyl rhodamine B (R18) preferentially stained the ER labeled with Dpm1-GFP, an ER transmembrane marker, with slight staining of the vacuolar membrane, under nutrient-rich conditions (Fig 7A). In R18-stained cells, GFP-Atg8 was visualized as a dot close to the vacuole without rapamycin treatment (Fig 7B). A cup-shaped IM emerged after treatment with rapamycin, and the IM was labeled with R18 (Fig 7B), suggesting that lipids constituting the IM can be labeled by R18 staining. Because the vacuolar membrane was slightly stained with R18, we also explored the possibility that the IM is stained with FM 4–64, a lipophilic dye that labels the vacuolar membrane. The vacuolar membrane was stained with FM 4–64 and treated with rapamycin. In contrast to R18, the IM was not stained with FM 4–64 (Fig 7C). Therefore, R18 preferentially labels IM lipids, whereas FM 4–64 does not.

Fig 7

Staining of autophagy-related structures with octadecyl rhodamine B.

(A) Dpm1-GFP expressing cells (YCK445) harboring the pYEX-BX[prApe1] plasmid were grown in SDCA medium containing CuSO4 and stained with octadecyl rhodamine B (R18). After the cells were washed with fresh medium, they were observed by fluorescence microscopy. (B) Wild-type cells harboring pRS314[GFP-Atg8] and pYEX-BX[prApe1] plasmids were grown in SDCA medium containing CuSO4 and stained with R18. After the cells were washed with fresh medium, they were treated with rapamycin for 3 h. (C) Wild-type cells harboring pRS314[GFP-Atg8] and pYEX-BX[prApe1] plasmids were grown in SDCA medium containing CuSO4 and stained with FM 4–64. After the cells were incubated with fresh medium without dye for 30 min, they were treated with rapamycin for 3 h. (D) mNG-Atg8 atg4Δ (YOC5272) and mNG-Atg8G116 atg4Δ (YOC5330) cells carrying an empty or Atg4-expressing plasmid and mNG-Atg8G116 atg4Δ atg2Δ (YOC5331) cells carrying an Atg4-expressing plasmid were grown to mid-log phase in SDCA medium containing CuSO4, and then stained with R18. After the cells were washed with fresh medium, they were treated with rapamycin for 1 h. Scale bar: 2 μm. (E) Frequencies of mNG-positive structures stained with R18. Error bars indicate standard deviations. N.S., not significant. **P < 0.01 (two-tailed Student’s t-test). At least 40 cells were counted for each experiment (n = 4).

Cup-shaped IMs were stained with R18 in ATG4 cells expressing mNeonGreen-Atg8 or mNeonGreen-Atg8G116 (Fig 7D). In mNeonGreen-Atg8G116 expressing atg4Δ cells, mNeonGreen-labeled structures were also stained with R18, and there were no significant differences in frequency of R18-labeling relative to wild-type cells (Fig 7D and 7E). On the other hand, mNeonGreen-labeled structures in atg2Δ cells barely stained with R18 (Fig 7D and 7E). These results suggest that mNeonGreen-Atg8G116 expressing atg4Δ cells are capable of recruiting lipids to the IM, whereas atg2Δ cells are not.

Discussion

In this study, we demonstrated that delipidation of Atg8-PE by Atg4 is dispensable for targeting of Atg8-PE to the VICS, but required for expansion of the IM (Fig 4). We also obtained a result suggesting that biological membranes exist at the Atg8-labeled structures in delipidation-defective cells (Fig 7). From these facts, we think that Atg4 is involved in efficient expansion of the IM by cleaving Atg8-PE localized at the VICS.

Here we show that IM expansion is impaired in Atg8G116 atg4Δ cells at the same level as in Atg8G116 atg2Δ cells (Fig 4). On the other hand, previous studies showed that a small number of closed autophagosomes are formed in Atg8G116 atg4Δ cells, whereas no autophagosomes are detected in atg2Δ cells [5, 22, 23]. These facts suggest that the IM in Atg8G116 atg4Δ cells has an ability to become a closed autophagosome, whereas that of Atg8G116 atg2Δ cells does not. Thus, Atg8-PE delipidation by Atg4 is unlikely to play a role in closure of the IM; instead, the delipidation reaction is mainly involved in IM expansion. We also found that autophagy-related structures in Atg8G116 atg4Δ cells were stained with lipophilic dye R18, whereas those in Atg8G116 atg2Δ cells were not (Fig 7D and 7E). Based on these observations, we hypothesize that Atg2 is involved in recruitment of lipids to the VICS, and that subsequent delipidation of Atg8-PE by Atg4 serves to expand the IM. The minimal autophagic activity in Atg8G116 atg4Δ cells might be explained by the presence of lipids in the autophagy-related structures.

In ATG4 cells, Atg8-PE is produced, and GFP-Atg8 localizes to autophagy-related structures (Figs 1A and 2A), suggesting that Atg8 localized to autophagy-related structures is conjugated to PE. On the other hand, when we visualized the IM, we demonstrated that the IM length of Atg8G116 atg4Δ cells did not significantly differ from that in Atg8G116 atg2Δ cells (Fig 4), indicating that Atg8-PE delipidation is required for IM expansion. Therefore, we assume that delipidation activity of Atg4 is initially repressed at the VICS, but derepressed upon IM expansion.

Previous reports proposed that delipidation supplies Atg8G116 to promote autophagosome formation [5, 11]. However, overexpression of Atg8G116 cannot rescue the defect in autophagic activity in atg4Δ atg8Δ cells [10, 11]. We examined the level of unlipidated Atg8G116 in Atg8G116-overexpressing Atg8G116 atg4Δ cells and detected a certain amount of unlipidated Atg8G116 (Fig 6). However, IM expansion and autophagic activity were not rescued in these cells (Figs 4 and 6), suggesting that the role of Atg8-PE delipidation is not limited to supplying unlipidated Atg8G116. Based on these results, we propose three possible scenarios: (1) a cycle of lipidation and delipidation is involved in IM expansion; (2) because accumulation of Atg8-PE at the VICS may disturb IM expansion, surplus Atg8-PE must be delipidated by Atg4; or (3) the site of delipidation occurs is important, i.e., Atg8-PE must be delipidated at a specific membrane, and then Atg8G116 plays a role at the site of delipidation. Notably, IM lengths slightly increased by overexpression of Atg8 or Atg8G116 in Atg8G116 atg4Δ cells (Fig 4), whereas autophagic activity remained unchanged (Fig 6, lanes 2, 5 and 6). These facts suggest that excess unlipidated Atg8/Atg8G116 affects the shape of the Atg8-labeled structures but does not improve the activity of autophagosome formation.

Lipidation of Atg8 mediates the tethering and hemifusion of liposomes in vitro [24]. Based on this fact, Atg8-PE is thought to be involved in IM expansion. Here, we report that delipidation of Atg8-PE is also essential for IM expansion, implying that Atg8G116 plays a role in this step. Addition of delipidated Atg8 to the in vitro Atg8-PE conjugation reaction may modulate the hemifusion activity of Atg8-PE.

The ER marker proteins GFP-HDEL and Dpm1-GFP do not label the IM [2], indicating that these proteins do not transit to the IM from the ER. However, we found that a lipophilic dye R18 labeled the IM (Fig 7B). This result could be interpreted in two ways. First, the dye could be transported to the IM via canonical vesicular trafficking pathways from the ER. Alternatively, lipids could be supplied from the ER to the IM directly. We prefer the latter ‘lipid flow’ model because we have never observed any vesicle-like structures around the IM, despite intensive observation by electron microscopy (data not shown). Future work should seek to clarify the mechanisms involved in transport of lipids from the ER to the IM. It is worth noting that we cannot exclude the possibility that other organelles supply lipids to the IM.

Further studies of Atg4 will be necessary to reveal the mechanisms of IM expansion mediated by delipidation of Atg8-PE.