Literature DB >> 28620270

Flucytosine and Amphotericin B Coadministration Induces Dose-Related Renal Injury.

Alexandra Folk1, Cornel Balta2, Hildegard Herman2, Alexandra Ivan3, Oana Maria Boldura4, Lucian Paiusan1, Aurel Ardelean2, Anca Hermenean2,5.   

Abstract

Invasive fungal infections remain an important clinical problem, and despite recent approaches, they bring high morbidity and mortality. Combination therapies are the most effective; however, adverse effects need to be considered. In this study, we aimed to evaluate the nephrotoxicity induced by combined therapy of flucytosine (FL) and amphotericin B (AMF) at 3 different doses administered to mice for 14 days: 300 μg/kg AMF+50 mg/kg FL; 600 μg/kg AMF+100 mg/kg FL; 900 μg/kg AMF+150 mg/kg FL. Antifungal coadministration triggered nuclear translocation of NF-κB and upregulated nuclear factor kappa-light-chain-enhancer of activated B cells subunit p65 (NF-κB p65) messenger RNA mRNA level in dose-dependent manner. The immunopositivity of tumor necrosis factor-α and interleukin-6 (IL-6), together with IL-6 gene expression, increased both in tubular and glomerular cells. Amphotericin B-flucytosine cotreatment increased significantly the number of terminal deoxy-nucleotidyl transferase (TdT)-mediated dUTP nick end-labeling positive nuclei. Apoptotic cells in renal tubuli were confirmed by electron microscopy. Histopathological analysis revealed collagen accumulation at the glomerular level. Collagen was also evidenced in the glomeruli at the dose of 900 μg/kg AMF+150mg/kg FL by Masson-Goldner trichrome staining and electron microscopy. Moreover, antifungal cotherapy induced upregulation of transforming growth factor beta 1 (TGF-β1) gene expression in a dose-dependent manner. Inflammation and epithelial tubular apoptosis are associated with TGF-β1 activation and initiation of the early stage of glomerular fibrosis at higher doses, leading to tubule-interstitial fibrosis.

Entities:  

Keywords:  amphotericin B; apoptosis; flucytosine; inflammatory cytokines; kidney injury

Year:  2017        PMID: 28620270      PMCID: PMC5464384          DOI: 10.1177/1559325817703461

Source DB:  PubMed          Journal:  Dose Response        ISSN: 1559-3258            Impact factor:   2.658


Introduction

Invasive fungal infections remain an important clinical problem, and despite recent approaches, they bring high morbidity and mortality.[1] The estimated annual incidence of invasive mycoses due to main pathogens is 72 to 228 infections per million population for Candida species, 30 to 66 infections per million population for C neoformans, and 12 to 34 infections per million population for Aspergillus species.[2] Among the 5 most common species of Candida, C albicans, C parapsilosis, and C tropicalis are susceptible to polyenes, flucytosine, azoles, and echinocandin antifungal agents,[2] while aspergillosis treatment requires administration of amphotericin B (sodium deoxycholate) or 1 of its lipid-based formulations.[3] Amphotericin B administration is often associated with severe dose-limited toxicity, as anemia and nephrotoxicity, which strongly limits its use.[4,5] Monomeric drug interacts with ergosterol in fungal cell membranes, while aggregated amphotericin B preferentially associates with cholesterol, which causes toxicity in mammalian cells. Amphotericin B-associated nephrotoxicity is characterized by acute renal failure due to acute tubular necrosis. Toxic activity is frequently accompanied by rising creatinine, hypokalemia, hypomagnesemia, and a nonanion gap metabolic acidosis, and less often by hypernatremia.[6-10] Acute renal failure occurs in about a quarter of the patients receiving amphotericin B, and higher dosage and longer duration of therapy are associated with a higher risk of nephrotoxicity.[6] Luber et al[11] found that greater cumulative dose of amphotericin B and the use of concomitant nephrotoxic drugs including acyclovir, cisplatin, carboplatin, cyclosporine, furosemide, radiocontrast dye, nonsteroidal anti-inflammatory agents, rifampicin, or vancomycin were associated with increased risk of kidney injuries. Flucytosine is a synthetic antimycotic compound used for systemic fungal infections caused by sensitive organisms together with other agents, because of the rapid emergence of resistance when used alone.[12] Previously, we showed that flucytosine and amphotericin B combined antifungal therapy exerts a synergistic hepatic inflammatory activation in a dose-dependent manner, through the NF-κB pathway, which promotes an inflammatory cascade during inflammation.[13] In the present study, we extended the dose-limiting analysis of flucytosine and amphotericin B coadministration at the renal level and inquired nephrotoxic mechanism. This study attempted to elucidate if NF-κB signaling was involved in the cross talk between inflammation and epithelial tubular apopotosis or glomerular fibrosis.

Material and Methods

Materials

Amphotericin B was purchased from Bristol-Myers Squibb (Saint-Remy-Sur-Avre, France) and flucytosine (Ancotil) from MEDA Pharma (Paris, France). Anti-tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), and NF-κB antibodies were supplied from Santa Cruz Biotechnology (Santa Cruz, California), immunohistochemistry DAB kit (Novocastra) was purchased from Leica Microsystems (Wetzalar, Germany) and In Situ Apoptosis Detection Kit was from Trevigen (Gaithersburg, Maryland, USA).

Animals and Experimental Procedure

Male CD1 mice (25 ± 3 g) were obtained from Animal Facility of “Vasile Goldis” Western University of Arad (Romania), and the experimental procedures were approved by the ethical committee of the university (Approval no. 86/2014) and are in compliance with the Directive 2010/63/EU of the European Parliament and of the Council of September 22, 2010 on the protection of animals used for scientific purposes. Mice groups were divided as follows: control group—received 0.9% normal saline solution by gavage for 14 days; 3 experimental groups—received 50, 100, or 150 mg/kg flucytosine orally, respectively, with concomitant 100 µL Intraperitoneal injections of 300, 600, and 900 μg/kg/d amphotericin B for 14 days, respectively. Selection of 3 doses of AMF-FL cotreatment was based on previous published reports related to systemic antifungal efficacy.[12,14,15] Mice were euthanized 24 hours after the last administration, and renal samples were used for histopathology, immunohistochemistry, electron microscopy, and molecular biology analyses.

Histopathology

The kidney samples were fixed in 4% paraformaldehyde. Following dehydration in an ascending series of ethanol, the tissue samples were cleared in toluene, embedded in paraffin and sliced in 5 μm sections. The sectioned samples were stained with hematoxylin and eosin (H&E). A minimum of 10 fields for each kidney slide were examined with Olympus BX43 microscope (Tokyo, Japan) and photographed using a digital camera (Olympus XC30). The severity of the changes was determined using scores of none (−), mild (+), moderate (++), and severe (+++). Masson-Goldner trichrome staining was used for the differentiated visualization of collagen in kidneys, according to the manufacturer’s instructions (Titolchimica, Pontecchio Polesine, Italy).

Immunohistochemistry

Immunohistochemical studies were performed on paraffin-embedded liver tissue sections of 5 μm thickness, previously deparaffinized and rehydrated by using a standard technique. Rabbit polyclonal anti-TNF-α, IL-6, or NF-κB p65 diluted 1:100 (Santa Cruz, California) were used as primary antibodies. Immunoreactions were visualized employing Novocastra (Leica Biosystems, Germany), Peroxidase/DAB kit (Wetzlar, Germany), according to the manufacturer’s instructions. Negative control sections were processed by substitution of primary antibodies with irrelevant immunoglobulins of matched isotype used in the same conditions as primary antibodies. Stained slides were analyzed by light microscopy.

Real-Time Polymerase Chain Reaction Analysis

Total RNA from renal tissue was extracted and purified using SV Total RNA Isolation System (Promega, Madison, Wisconsin), according to the manufacturer’s instructions. Quantity and quality of purified RNA were determined by spectrophotometric method using NanoDrop 8000 spectrophotometer (Thermo Scientific, Vilnius, Lithuania). Complementary deoxyribonucleic acid (cDNA) was obtained from 2 μg of total RNA using First Strand cDNA Synthesis Kit (Thermo Scientific, Vilnius, Lithuania) and oligo d(T)8 primer and was used as template in quantitative polymerase chain reaction (qPCR) experiments. Real-time polymerase chain reaction (PCR) was performed using Luminaris HiGreen qPCR Master Mix, low ROX (Thermo Scientific) using the Applied Biosystems 7500 Real-time PCR System. All the samples were run in triplicate. The primer sequences and all experimental validation data were obtained from the PrimerBank website, http://pga.mgh.harvard.edu/primerbank/. Primers were synthesized at Eurogentec (Seraing, Belgium; Table 1). The ratio for the gene expression was normalized using glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Results were interpreted by 2ΔΔ C(T) method[16](Table 1).
Table 1.

Primer Sequences Used in the Study.

CodeSenseAntisense
GAPDHCGACTTCAACAGCAA CTCCCACTCTTCCTGGGTGGTCCAGGGTTT CTTACTCCTT
TGF-β 1TTTGGAGCCTGGAC ACACTGTGTTGGTTGTAGAGGG
IL-6AAAGAGTTGTGCAAT GGCAATTCTAAGTGCATCATCGTTGTT CATACA
NF-κB p65CTTGGCAACAGCAC AGACCGAGAAGTCCATGTCCGC AAT
Primer Sequences Used in the Study.

In Situ Detection of DNA Fragmentation

In Situ Apoptosis Detection Kit (Trevigen) was used to assess in situ nuclear DNA fragmentation by terminal deoxy-nucleotidyl transferase (TdT)-mediated dUTP nick end-labeling (TUNEL). The incorporation of biotinylated nucleotides allows chromosomal DNA fragmentation to be visualized by binding streptavidin–horseradish peroxidase followed by reaction with a peroxidase substrate that produces a stable, insoluble blue reaction product at the site of peroxidase activity (TACS) Blue Label to generate a dark blue precipitate. Sections were imaged by light microscopy (Olympus X43, Japan). Microscopic pictures were analyzed with the Image J software, and apoptotic index was expressed as the percentage of TUNEL positive nuclei versus the total number of nuclei previously counterstained with nuclear fast red (version 1.4.).

Electron Microscopy

Electron microscopy renal samples were prefixed with 2.7% glutaraldehyde solution in 0.1 M phosphate buffer at 4°C for 1.5 hours, washed in 0.15 M phosphate buffer (pH 7.2) and postfixed in 2% osmic acid solution in 0.15 M phosphate buffer. Dehydration was performed in acetone, and kidney samples were embedded in the epoxy embedding resin Epon 812. Thick sections of 60 nm were cut with Leica EM UC7 ultramicrotome and analyzed with a transmission electron microscopy (TEM) Tecnai 12 Biotwin electron microscope (Hillsboro, Oregon).

Statistical Analysis

Statistical analysis was conducted with a one-way analysis of variance using Stata 13 software (StataCorp LP, Texas, USA). A value of P < .05 was considered to be statistically significant.

Results

Flucytosine and Amphotericin B Coadministration Induces Dose-Dependent Histopathological Changes of Mouse Kidney

Histology of the kidney showed glomerular atrophy and congestions of interstitium and blood vessels. Tubular necrosis and reduction in the size of glomeruli were seen in high dose of AMF+FL-treated kidneys (Table 2; Figure 1).
Table 2.

Amphotericin B and Flucytosine Cotreatment on Histopathological Changes in the Kidney.

GroupsGlomerular AtrophyBlood Vessel ThickeningTubular EdemaTubular Necrosis
Control
300 μg/kg AMF + 50 mg/kg FL++
600 μg/kg AMF + 100 mg/kg FL++++++
900 μg/kg AMF + 150 mg/kg FL++++++++++

Abbreviations: AMF, amphotericin B; FL, flucytosine; −, no morphological changes in the histology; +, mild; ++, moderate; +++, severe morphological changes in the histology.

Figure 1.

Photomicrograph of mice kidney showing the dose-dependent effects of Flucytosine and amphotericin B co-administration (hematoxylin and eosin [H&E]). (A) control group; (B) 50 mg/kg flucytosine + 300 μg/kg amphotericin B group; (C) 100 mg/kg flucytosine + 600 μg/kg amphotericin B group; (D) 150 mg/kg flucytosine + 900 μg/kg amphotericin B group. Asterisk indicates glomerular atrophy and arrow indicates tubular cells swelling.

Amphotericin B and Flucytosine Cotreatment on Histopathological Changes in the Kidney. Abbreviations: AMF, amphotericin B; FL, flucytosine; −, no morphological changes in the histology; +, mild; ++, moderate; +++, severe morphological changes in the histology. Photomicrograph of mice kidney showing the dose-dependent effects of Flucytosine and amphotericin B co-administration (hematoxylin and eosin [H&E]). (A) control group; (B) 50 mg/kg flucytosine + 300 μg/kg amphotericin B group; (C) 100 mg/kg flucytosine + 600 μg/kg amphotericin B group; (D) 150 mg/kg flucytosine + 900 μg/kg amphotericin B group. Asterisk indicates glomerular atrophy and arrow indicates tubular cells swelling.

Flucytosine and Amphotericin B Coadministration Upregulates Production of Pro-Inflammatory Cytokines through NF-κB Activation of Glomerular and Tubular Cells

In order to evaluate the occurrence of an inflammatory status, the cytosolic and nuclear distribution of the transcription factor NF-κB subunit p65 and the expression of pro-inflammatory targets TNF-α and IL-6 were evidenced in renal cortex of experimental groups. An increase in the NF-κB p65 messenger RNA (mRNA) levels by 6.96, 16.39, and 62.87-fold for 300 AMF/50 FL, 600 AMF/100 FL, and 900 AMF/150 FL, respectively, was noticed, as compared to the corresponding levels in the control group (P < .001; Figure 2I). Moreover, NF-κB p65 mRNA level 900 AMF/150 FL was significantly raised than 300 AMF/50 FL (P < .001). Immunocytochemical photoimages revealed that antifungal coadministration triggered nuclear translocation of NF-κB of glomerular and tubular cells in a dose-dependent manner (Figure 2).
Figure 2.

Dose-dependent effects of Flucytosine and amphotericin B coadministration on the expression of NF-κB p65, Tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6) in the renal cortex of mice. (A) control group; (B) 50 mg/kg flucytosine + 300 μg/kg amphotericin B group; (C) 100 mg/kg flucytosine + 600 μg/kg amphotericin B group; (D) 150 mg/kg flucytosine + 900 μg/kg amphotericin. Real-time polymerase chain reaction (PCR) was used to investigate mRNA levels of IL-6 (I) and NF-κB p65 (II) target genes. Significance levels are marked as follows: ***P < .001 compared with control, 300 AMF/50 FL, 600 AMF/100 FL, or 900AMF/150 FL groups; **P < .01 compared with control or 300 AMF/100 FL

Dose-dependent effects of Flucytosine and amphotericin B coadministration on the expression of NF-κB p65, Tumor necrosis factor-α (TNF-α), and interleukin-6 (IL-6) in the renal cortex of mice. (A) control group; (B) 50 mg/kg flucytosine + 300 μg/kg amphotericin B group; (C) 100 mg/kg flucytosine + 600 μg/kg amphotericin B group; (D) 150 mg/kg flucytosine + 900 μg/kg amphotericin. Real-time polymerase chain reaction (PCR) was used to investigate mRNA levels of IL-6 (I) and NF-κB p65 (II) target genes. Significance levels are marked as follows: ***P < .001 compared with control, 300 AMF/50 FL, 600 AMF/100 FL, or 900AMF/150 FL groups; **P < .01 compared with control or 300 AMF/100 FL Tumor necrosis factor-α expression was found in all treated groups (Figure 2). The immunopositivity of TNF-α increased in a dose-dependent manner. Tumor necrosis factor-α immunoreactivity was observed both in tubular and glomerular cells. The IL-6 gene expression analysis showed significantly increasing by 1.82, 5.7, and 17.29 times for 300 AMF/50 FL (P < .001), 600 AMF/100 FL (P < .01), and 900 AMF/150 FL (P < .001) antifungal cotreated groups, respectively, compared to control (Figure 2II). Moreover, IL-6 mRNA level 900 AMF/150 FL was significantly raised than 300 AMF/50 FL (P < .001). The effects of antifungal drug coadministration on the IL-6 expression are shown in Figure 2. Flucytosineamphotericin B cotreatment increased the number of tubular and glomerular cells labeled with IL-6 antibody in a dose-dependent manner.

Flucytosine and Amphotericin B Coadministration Induces Dose-Dependent Apoptotic Death of Renal Cells in Mouse Kidney

Flucytosine and amphotericin B cotreatment increased significantly the number of TUNEL positive nuclei (Figure 3I) by 10.15, 12.53, and 19.56-folds for 300 AMF/50 FL, 600 AMF/100 FL, and 900 AMF/150 FL groups, respectively, compared to control (Figure 3II). The presence of apoptotic cells in renal tubuli was confirmed by electron microscopy (Figure 3III).
Figure 3.

Dose-dependent effects of Flucytosine and amphotericin B coadministration on apoptosis of epithelial tubular cells by (I) Terminal deoxy-nucleotidyl transferase (TdT)-mediated dUTP nick end-labeling (TUNEL) assay (II) TUNEL (+) cells/field (III) electron microscopy. Experimental groups: (A) control group; (B) 50 mg/kg flucytosine + 300 μg/kg amphotericin B group; (C) 100 mg/kg flucytosine + 600 μg/kg amphotericin B group; (D) 150 mg/kg flucytosine + 900 μg/kg amphotericin B group. Significance levels are marked as follows: ***P < .001 compared with control, ###P < .001 compared with 300 AMF/50 FL group. N, normal nuclei; 1, peroxisomes; 2, microvilli; 3, smooth endoplasmic reticulum (Ser); 4, apopototic nuclei; 5, altered mitochondria; 6, cell lysis.

Dose-dependent effects of Flucytosine and amphotericin B coadministration on apoptosis of epithelial tubular cells by (I) Terminal deoxy-nucleotidyl transferase (TdT)-mediated dUTP nick end-labeling (TUNEL) assay (II) TUNEL (+) cells/field (III) electron microscopy. Experimental groups: (A) control group; (B) 50 mg/kg flucytosine + 300 μg/kg amphotericin B group; (C) 100 mg/kg flucytosine + 600 μg/kg amphotericin B group; (D) 150 mg/kg flucytosine + 900 μg/kg amphotericin B group. Significance levels are marked as follows: ***P < .001 compared with control, ###P < .001 compared with 300 AMF/50 FL group. N, normal nuclei; 1, peroxisomes; 2, microvilli; 3, smooth endoplasmic reticulum (Ser); 4, apopototic nuclei; 5, altered mitochondria; 6, cell lysis.

Flucytosine and Amphotericin B Coadministration Induces Dose-Dependent Mesangial Fibrosis of Mice Kidney

In order to assess the degree of renal fibrosis, the deposition of total collagen was determined by Masson-Goldner trichrome staining. We found that collagen accumulation in kidney tissues increased significantly in a dose-dependent manner (Figure 4I). Collagen was also evidenced at the glomerular level by electron microscopy at 900/150 dose of flucytosine and amphotericin B (Figure 4II). In the present study, as shown in Figure 4c, antifungal drug coadministration induced upregulation of TGF-β1 in a dose-dependent manner.
Figure 4.

Dose-dependent effects of Flucytosine and amphotericin B coadministration induced dose-dependent glomerular fibrosis of mice kidney. (I) The Masson-Goldner trichrome staining staining of collagen deposition in kidney. (II) Electron microscopy details of glomeruli in 900 AMF/150 FL group. Real-time PCR was used to investigate mRNA levels of TGF-β1 (III) target genes. Arrow: collagen. Experimental groups: (A) Control group; (B) 50 mg/kg flucytosine + 300 μg/kg amphotericin B group; (C) 100 mg/kg flucytosine + 600 μg/kg amphotericin B group; (D) 150 mg/kg flucytosine + 900 μg/kg amphotericin B group. Significance levels are marked as follows: ***P < .001 compared with control, 300 AMF/50 FL, 600 AMF/100 FL, or 900AMF/150 FL groups.

Dose-dependent effects of Flucytosine and amphotericin B coadministration induced dose-dependent glomerular fibrosis of mice kidney. (I) The Masson-Goldner trichrome staining staining of collagen deposition in kidney. (II) Electron microscopy details of glomeruli in 900 AMF/150 FL group. Real-time PCR was used to investigate mRNA levels of TGF-β1 (III) target genes. Arrow: collagen. Experimental groups: (A) Control group; (B) 50 mg/kg flucytosine + 300 μg/kg amphotericin B group; (C) 100 mg/kg flucytosine + 600 μg/kg amphotericin B group; (D) 150 mg/kg flucytosine + 900 μg/kg amphotericin B group. Significance levels are marked as follows: ***P < .001 compared with control, 300 AMF/50 FL, 600 AMF/100 FL, or 900AMF/150 FL groups.

Discussion

In the present study, we showed that NF-κB signaling is involved in the cross talk between inflammation and epithelial tubular apoptosis or glomerular fibrosis occurring in response to coadministration of amphotericin B and flucytosine as antifungal systemic therapy. In normal conditions, kidney performs a variety of essential functions for the maintenance of metabolic homeostasis, especially through glomerular filtration. In order to support the renal metabolism, a large renal blood flow is necessary. As a result, endothelial, glomerular, and tubular cells are exposed to high volumes of blood drug metabolites or toxicants.[17] During nephrotoxicant-induced acute renal failure, inflammation plays a major role. Many studies suggest that initial nephrotoxic insult results in changes in endothelial and/or tubular epithelial cells, leading to the generation of inflammatory cytokines and chemokines.[18] These mediators induce migration and infiltration of leukocytes into the injured kidneys and amplify the primary damage induced by the nephrotoxicant.[19] Activation of pro-inflammatory and cell death pathways is directly mediated by transcription factor NF-κB.[20] Previous study demonstrated that only 15 minutes of ischemia, with or without reperfusion, activates the transcription factor NF-κB and increases TNF-α bioactivity in the kidney.[21] The activated form of NF-κB is a heterodimer, which consists of 2 proteins, a p65 subunit and a p50 subunit. The p65 subunit rapidly translocates into the nucleus, binding to promoter/enhancer region of different genes, promoting their transcription and regulating various inflammatory responses. In our study, we evidenced translocated nuclear p65 subunit of NF-κB both in the epithelial tubular cells and glomeruli, while recent studies revealed that NF-κB is activated in the glomeruli of an experimental model of mesangial proliferative glomerulonephritis of cisplatin-induced acute kidney injury.[22,23] As a response of NF-κB activation, IL-6 is significantly upregulated in the kidney in a dose-dependent manner, whereas activation of p65 subunit by lipopolysaccharide subsequently facilitates IL-6 transcription.[24,25] Moreover, our immunhistochemical analysis revealed significant renal expression of the main inflammatory mediator TNF-α, secreted by proximal tubular epithelial cells,[26,27] as well as by the infiltrating immune cells.[28] Other drugs have also been shown to upregulate TNF-α levels in the kidneys, including adefovir,[29] methotrexate,[30] and mitomycin C.[31] In turn, TNF-α can induce supplementary NF-κB activation in renal cells.[32] In the present study, we highlighted apoptotic renal cells by electron microscopy and TUNEL assay. Previously, in vitro studies evidenced apoptosis-specific DNA fragmentation in proximal tubular cells, significantly lower apoptotic distal tubular cells and many apoptotic mesangial cells after exposure to amphotericin B.[33] In addition, it was shown that amphotericin B increased tubular permeability due to binding of the toxicant to cell membrane, formation of transmembrane pores, leakage of electrolytes,[34,35] and apoptosis in the rat kidney in a dose-dependent fashion.[33] Nephrotoxicity of amphotericin B in patients was clinically related with pronounced fall in glomerular filtration rate and renal blood flow and consistent changes in proximal tubular function with an increased clearance of uric acid. The major changes in distal tubular functions were associated with increased clearance of potassium, development of renal tubular acidosis, and rise in urine pH.[36] In our study, we noticed the appearance of apoptotic tubular cells by electron microscopy and TUNEL assay. These results are significantly overlapped with the increased expression of the proinflammatory cytokine TNF-α, an important contributor to drug’s nephrotoxicity. In addition, Benedetti[18] revealed 8 out of the 16 nephrotoxicants analyzed to induce cell death, 5 of which induced both apoptosis and necrosis. Moreover, TNF-α significantly enhanced apoptotic cell death induced by cisplatin, cyclosporine A, tacrolimus, and azidothymidine.[18] Apoptosis in tubular epithelial cells is also associated with TGF-β1 activation, leading to atrophy and renal disease progression, including chronic obstructive or diabetic nephropathy.[37] In the early stage of glomerulosclerosis, podocytes undergo TGF-β1-induced apoptosis.[38] In vitro studies showed that TGF-β1 also induced apoptosis in glomerular capillary endothelial cells.[39] In our study, antifungal cotreatment with flucytosine and amphotericin B enhanced TGF-β1 mRNA expression, together with increase in the number of apoptotic renal cells, in a dose-dependent manner. Similarly, the administration of another antifungal agent, trichostatin inhibits TGF-β1-induced extracellular signal regulated kinase activation and over-rides pro-apoptotic signals like Smad3 and p38 in human renal proximal tubular epithelial cells.[40] Furthermore, recent studies reveal that apoptosis in tubular cells appears to be associated with renal interstitial fibrosis. Apoptotic discharging of the tubular epithelial cells leading to tubular atrophy induces a favorable microenvironment for the induction and proliferation of the fibrogenic cells, exacerbating the accumulation and deposition of extracellular matrix components and resulting in renal fibrosis.[41,42] Renal tubular extracellular matrix is also thought to be a major cause of renal fibrosis.[43] Meanwhile, it is well known that the progression of the disease process in the tubule is secondary to that in the glomerulus, whereas tubulointerstitial fibrosis development begins in the glomerulus.[44] Tumor necrosis factor-α and TGF-β treatment enhances the expression of connective tissue growth factor and pro-fibrotic factors in mesangial cells, and increased TNF-α and TGF-β expression was observed in rat models of unilateral ureteral obstruction.[45] In our study, we noticed a deposition of total collagen at 600 μg/kg AMF+100 mg/kg FL and 900 μg/kg AMF+150 mg/kg FL doses at the glomerular level, which are strongly related with significant increase of TGF-β1 mRNA expression in both groups. These results suggested that higher doses of antifungal cotherapy could initiate early stage of renal fibrosis, TGF-β1/Smad signaling being involved in the production of profibrotic mediators and in the synthesis and deposition of extracellular matrix.[46,47] Our results suggest that inflammation and epithelial tubular apoptosis are associated with TGF-β1 activation and initiation of the early stage of glomerular fibrosis at higher doses, leading to tubule–interstitial fibrosis.
  46 in total

1.  TNF-alpha neutralization ameliorates obstruction-induced renal fibrosis and dysfunction.

Authors:  K K Meldrum; R Misseri; P Metcalfe; C A Dinarello; K L Hile; D R Meldrum
Journal:  Am J Physiol Regul Integr Comp Physiol       Date:  2006-12-14       Impact factor: 3.619

2.  Correlates of acute renal failure in patients receiving parenteral amphotericin B.

Authors:  D W Bates; L Su; D T Yu; G M Chertow; D L Seger; D R Gomes; R Platt
Journal:  Kidney Int       Date:  2001-10       Impact factor: 10.612

Review 3.  Amphotericin B.

Authors:  A Lemke; A F Kiderlen; O Kayser
Journal:  Appl Microbiol Biotechnol       Date:  2005-04-09       Impact factor: 4.813

4.  Apoptosis contributes to amphotericin B-induced nephrotoxicity.

Authors:  D E Varlam; M M Siddiq; L A Parton; H Rüssmann
Journal:  Antimicrob Agents Chemother       Date:  2001-03       Impact factor: 5.191

5.  Renal fibrosis: collagen composition and assembly regulates epithelial-mesenchymal transdifferentiation.

Authors:  M Zeisberg; G Bonner; Y Maeshima; P Colorado; G A Müller; F Strutz; R Kalluri
Journal:  Am J Pathol       Date:  2001-10       Impact factor: 4.307

6.  Adefovir dipivoxil modulates cytokine expression in Th1/Th2 cells in patients with chronic hepatitis B.

Authors:  Rong-Li Piao; Yuan-Yuan Liu; Dan Tian; Zhen-Hua Ma; Manli Zhang; Chong Zhao; Jun-Qi Niu
Journal:  Mol Med Rep       Date:  2011-10-11       Impact factor: 2.952

7.  Suppression of NF-kappaB by cyclosporin a and tacrolimus (FK506) via induction of the C/EBP family: implication for unfolded protein response.

Authors:  Shuqi Du; Nobuhiko Hiramatsu; Kunihiro Hayakawa; Ayumi Kasai; Maro Okamura; Tao Huang; Jian Yao; Masayuki Takeda; Isao Araki; Norifumi Sawada; Adrienne W Paton; James C Paton; Masanori Kitamura
Journal:  J Immunol       Date:  2009-06-01       Impact factor: 5.422

Review 8.  The role of epithelial-to-mesenchymal transition in renal fibrosis.

Authors:  Michael Zeisberg; Raghu Kalluri
Journal:  J Mol Med (Berl)       Date:  2004-01-30       Impact factor: 4.599

9.  NF-κB transcriptional inhibition ameliorates cisplatin-induced acute kidney injury (AKI).

Authors:  Abdullah Ozkok; Kameswaran Ravichandran; Qian Wang; Danica Ljubanovic; Charles L Edelstein
Journal:  Toxicol Lett       Date:  2015-11-03       Impact factor: 4.372

10.  Evaluation of Hepatotoxicity with Treatment Doses of Flucytosine and Amphotericin B for Invasive Fungal Infections.

Authors:  Alexandra Folk; Coralia Cotoraci; Cornel Balta; Maria Suciu; Hildegard Herman; Oana Maria Boldura; Sorina Dinescu; Lucian Paiusan; Aurel Ardelean; Anca Hermenean
Journal:  Biomed Res Int       Date:  2016-02-02       Impact factor: 3.411

View more
  1 in total

1.  Retinal and circulating miRNA expression patterns in diabetic retinopathy: An in silico and in vivo approach.

Authors:  Chiara Bianca Maria Platania; Rosa Maisto; Maria Consiglia Trotta; Michele D'Amico; Settimio Rossi; Carlo Gesualdo; Giovanbattista D'Amico; Cornel Balta; Hildegard Herman; Anca Hermenean; Franca Ferraraccio; Iacopo Panarese; Filippo Drago; Claudio Bucolo
Journal:  Br J Pharmacol       Date:  2019-05-09       Impact factor: 8.739

  1 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.