Literature DB >> 28583252

Mice deficient of Myc super-enhancer region reveal differential control mechanism between normal and pathological growth.

Kashyap Dave1, Inderpreet Sur1, Jian Yan1, Jilin Zhang1, Eevi Kaasinen1, Fan Zhong1, Leander Blaas2, Xiaoze Li3, Shabnam Kharazi3, Charlotte Gustafsson3, Ayla De Paepe3, Robert Månsson3, Jussi Taipale1,4.   

Abstract

The gene desert upstream of the MYC oncogene on chromosome 8q24 contains susceptibility loci for several major forms of human cancer. The region shows high conservation between human and mouse and contains multiple MYC enhancers that are activated in tumor cells. However, the role of this region in normal development has not been addressed. Here we show that a 538 kb deletion of the entire MYC upstream super-enhancer region in mice results in 50% to 80% decrease in Myc expression in multiple tissues. The mice are viable and show no overt phenotype. However, they are resistant to tumorigenesis, and most normal cells isolated from them grow slowly in culture. These results reveal that only cells whose MYC activity is increased by serum or oncogenic driver mutations depend on the 8q24 super-enhancer region, and indicate that targeting the activity of this element is a promising strategy of cancer chemoprevention and therapy.

Entities:  

Keywords:  cancer; cancer biology; enhancer; human; mouse; oncogene regulation

Mesh:

Substances:

Year:  2017        PMID: 28583252      PMCID: PMC5461110          DOI: 10.7554/eLife.23382

Source DB:  PubMed          Journal:  Elife        ISSN: 2050-084X            Impact factor:   8.140


Introduction

Deregulated expression of the MYC oncogene is associated with many cancer types (Reviewed in Albihn et al., 2010; Dang, 2012; Evan, 2012). MYC acts primarily as a transcriptional activator that increases expression of many genes required for RNA and protein synthesis above the level that is required in resting cells. In cancer cells, aberrantly elevated levels of MYC drive global amplification of transcription rates, providing the cells with necessary resources for rapid proliferation (see, for example Brown et al., 2008; van Riggelen et al., 2010; Ji et al., 2011; Lin et al., 2012; Sabò et al., 2014; Walz et al., 2014). Transcription of the MYC gene is regulated by a diverse array of regulatory elements located both upstream and downstream of the MYC transcription start site (TSS). Variants in the MYC upstream region contribute to inherited susceptibility to most major forms of human cancer, and account for a very large number of cancer cases at the population level (Amundadottir et al., 2006; Gudmundsson et al., 2007; Yeager et al., 2007; Al Olama et al., 2009; Yeager et al., 2009). For example, the polymorphism rs6983267 linked to colorectal (Tomlinson et al., 2007) and prostate (Yeager et al., 2007) cancers contributes more to cancer morbidity and mortality than any other known inherited variant or mutation, including the inherited mutations in classic tumor suppressors such as RB, TP53 and APC. Through computational and experimental analyses, we and others have shown that the risk allele G of rs6983267 creates a strong binding site for the colorectal-cancer associated transcription factor Tcf7l2 (Pomerantz et al., 2009; Tuupanen et al., 2009). This binding site is located within the Myc-335 enhancer element that is dispensable for mouse viability, but required for efficient Tcf7l2-driven intestinal tumorigenesis (Sur et al., 2012b). More recently, another enhancer element, located 1.47 Mb downstream of Myc was shown to be required for formation of acute lymphoblastic leukemia (ALL) in mice (Herranz et al., 2014). However, in contrast to the Myc-335 element, this element is also required for normal T-cell development. Thus, the mechanism by which individual Myc enhancer elements contribute to normal development and tumorigenesis is still unclear. Several studies have shown that the 8q24 region contains a large number of additional enhancer elements (see, for example [Hallikas et al., 2006; Ahmadiyeh et al., 2010; Yan et al., 2013; Yao et al., 2014]) and super-enhancers that are active in many different types of human cancer (Hnisz et al., 2013; Lovén et al., 2013; Zhou et al., 2015). The MYC-associated super-enhancers are activated during the process of tumorigenesis (Hnisz et al., 2013), and downregulation of super-enhancer activity leads to selective inhibition of MYC expression (Lovén et al., 2013). Thus, MYC-associated super-enhancer activity is required for tumorigenesis, but the role of these elements in normal tissue morphogenesis and homeostasis has been unclear. To address this problem, we have in this work generated multiple mouse strains deficient of regulatory elements upstream of the Myc promoter. Since this region contains multiple tumor type and tissue -specific enhancers and super-enhancers, for the sake of clarity we refer to the deleted region here as the `super-enhancer region´. By analysis of the mice, we found that the entire super-enhancer region conferring multi-cancer susceptibility contributes to MYC expression in vivo, yet is not required for mouse embryonic development and viability. However, this region is required for the growth of normal cells in culture and cancer cells in vivo. As cultured cells are exposed to serum, which is a signal of tissue damage, this finding suggests that tumor cells and cells responding to damage signals share regulatory mechanisms that are dispensable for normal physiological growth control.

Results

Functional mapping of the super-enhancer region upstream of Myc

To dissect functional significance of the 8q24 region during normal development, we generated series of Myc alleles in mice using homologous recombination in ES cells. These include the Myc-335 enhancer deletion allele we have described previously (Sur et al., 2012b), and deletions of two additional conserved enhancer elements, Myc-196 and Myc-540, both of which are active in mouse intestine and colorectal cancer cells. In addition, we generated a point mutation that inactivates a conserved CCCTC-Binding factor (CTCF) site 2 kb upstream of the Myc TSS. This site has previously been reported to be required for MYC expression (Gombert and Krumm, 2009), and to have insulator activity (Gombert et al., 2003) (Figure 1a). Each allele contained loxP site(s) in the same orientation to allow conditional knockouts of the enhancers, and to facilitate generation of large deletions and duplications by interallelic recombination (Wu et al., 2007). All alleles were bred to homozygosity, and resulted in generation of viable mice. Expression of Myc in the colon of Myc-196 and Myc-540 mice was not markedly altered, suggesting that these elements have little effect on regulation of Myc in the intestine under normal laboratory conditions (Figure 1b). Myc expression level was also normal in Myc-CTCF mouse colon despite loss of CTCF and cohesin (Rad21) binding to the region proximal to the Myc promoter (Figure 1c).
Figure 1.

Cancer susceptibility region upstream of Myc contains several conserved enhancer elements that are dispensable for normal mouse development and MYC expression.

(a) Comparison of Myc locus between human and mouse. The susceptibility regions for prostate cancer (PrCa), chronic lymphocytic leukemia (CLL), breast cancer (BrCa), colorectal cancer (CRC) and bladder cancer (BlCa) are marked. Red vertical lines mark the location of the Tcf7l2-binding CRC Myc enhancers in the two species. The lower panel shows the regional conservation probability predicted by PhastCons (hg19 assembly, UCSC) with non-overlapping sliding windows for the whole region and each enhancer locus with a size of 500 bp and 10 bp, respectively. (b) Deletion of Myc-196 and Myc-540 enhancer elements does not affect Myc expression in the colon as determined by qPCR analysis (Myc-196 = 2, Myc-540 = 3 and wild-type n = 5). See Figure 1—source data 1 for details. (c) Mutation of the Myc-CTCF site causes loss of CTCF and Rad21 binding at the Myc locus (top panel). Binding of CTCF and Rad21 at a control Actb locus is not affected. Red and black arrowheads denote binding sites at Myc and Actb loci, respectively; green: Myc-CTCF, blue: wild-type. The gene body for Myc and Actb is shown below the respective panels. The qPCR analysis reveals that despite loss of CTCF/cohesin binding, the expression of Myc mRNA is not altered in the colon (for qPCR, Myc-CTCF n = 4, wild-type n = 3). See Figure 1—source data 1 for details. Error bars denote one standard deviation.

DOI: http://dx.doi.org/10.7554/eLife.23382.003

DOI: http://dx.doi.org/10.7554/eLife.23382.004

Cancer susceptibility region upstream of Myc contains several conserved enhancer elements that are dispensable for normal mouse development and MYC expression.

(a) Comparison of Myc locus between human and mouse. The susceptibility regions for prostate cancer (PrCa), chronic lymphocytic leukemia (CLL), breast cancer (BrCa), colorectal cancer (CRC) and bladder cancer (BlCa) are marked. Red vertical lines mark the location of the Tcf7l2-binding CRC Myc enhancers in the two species. The lower panel shows the regional conservation probability predicted by PhastCons (hg19 assembly, UCSC) with non-overlapping sliding windows for the whole region and each enhancer locus with a size of 500 bp and 10 bp, respectively. (b) Deletion of Myc-196 and Myc-540 enhancer elements does not affect Myc expression in the colon as determined by qPCR analysis (Myc-196 = 2, Myc-540 = 3 and wild-type n = 5). See Figure 1—source data 1 for details. (c) Mutation of the Myc-CTCF site causes loss of CTCF and Rad21 binding at the Myc locus (top panel). Binding of CTCF and Rad21 at a control Actb locus is not affected. Red and black arrowheads denote binding sites at Myc and Actb loci, respectively; green: Myc-CTCF, blue: wild-type. The gene body for Myc and Actb is shown below the respective panels. The qPCR analysis reveals that despite loss of CTCF/cohesin binding, the expression of Myc mRNA is not altered in the colon (for qPCR, Myc-CTCF n = 4, wild-type n = 3). See Figure 1—source data 1 for details. Error bars denote one standard deviation. DOI: http://dx.doi.org/10.7554/eLife.23382.003

Myc transcript levels in wild-type and mutant mice in Figure 1b-c.

DOI: http://dx.doi.org/10.7554/eLife.23382.004

Mice lacking the Myc super-enhancer region are viable and fertile

As the individual mutations and deletions had limited effect, we next decided to generate two large deletions in the Myc locus using interallelic recombination between the Myc-CTCF loxP site and the loxP sites at Myc-335 and Myc-540, yielding deletions of 365 kb (GRCm38/mm10 chr15:61618287–61983375) and 538 kb (chr15:61445326–61983375), respectively (Figure 2a). The resulting alleles, Myc and Myc, were then segregated out from the corresponding duplications, and bred to homozygosity. Given the very large regions that were deleted (Figure 2b), we expected to see a strong phenotype. However, no overt phenotype was identified in the Myc mice. The mice were born at the expected mendelian ratio, and both males and females were viable and fertile. Analysis of Myc expression, however, revealed a strong decrease in Myc expression in the colon and ileum of the mice (not shown).
Figure 2.

Deletion of the 8q24 super-enhancer region is well tolerated during normal development and homeostasis.

(a) Schematic representation of the 365 kb and 538 kb deletions. (b) Myc deletion removes a region containing several active enhancer elements upstream of Myc as shown by ChIP-seq analysis of histone H3 lysine 27 acetylation (H3K27ac) and lysine four trimethylation (H3K4me3). The deletion also removes several Tcf7l2 ChIP-seq peaks. Signal from Myc and wild-type mice are shown in green and blue, respectively. Red arrowheads and horizontal lines mark the different enhancer positions. (c) Haematoxylin/ Eosin stained sections of spleen, bladder, prostate, colon (Bar = 100 µm) and Carmine Alum stained whole mounts of mammary glands, Bars = 3 mm, 100 µm (inset) showing normal development and homeostasis of different organs in Myc mice. (d) Myc mice have a reduced number of B-cells compared to the wild-types. Left panel: FACS plots of a representative Myc and wild-type mouse spleen showing B-cell (B) population. Right panel: Scatter dot plot of total number of B cells in the spleen and bone marrow of wild-type (squares), n = 5 and Myc (filled circles), n = 5. Each point represents individual mouse. Line represents the median. See Figure 2—source data 1 for details. The number of CD4+ and CD8+ T-cells is not affected by the deletion (see Figure 2—figure supplement 1 and appendix 1).

DOI: http://dx.doi.org/10.7554/eLife.23382.005

DOI: http://dx.doi.org/10.7554/eLife.23382.006

(a) Super-enhancer region deletion results in a lower number of total cells in the spleen (average number in wild-type = 150.1×106 and Myc = 117.2×106) which manifests as a specific decrease of B-cell numbers both in the spleen and peripheral blood without an affect on the CD4+ and CD8+ T-cell population. Line marks the median. See Figure 2—figure supplement 1—source data 1 for details. (b) ChIP-seq analysis of histone marks H3K4me2 (red), H3K27ac (green) and RNA-seq (grey: signals from plus and minus strand are shown) shows the presence of B-cell specific enhancer both 3´and 5´ side of the Myc ORF. One of these enhancers (black arrow, mature B-cells panel) is located at the 5´boundary of the deleted region (black solid bar). The 2–540 deletion will bring this element very close to the Myc TSS, potentially explaining the increased Myc expression in the spleen. The different enhancer regions used in this study are marked by red arrowhead and the 5´ boundary of the super-enhancer region is marked by dashed line. The increase in MYC levels in the spleen and decrease in B-cell number could potentially be explained by a direct effect of MYC in inducing apoptosis of B-cells (Hoffman and Liebermann, 2008). However, further studies are necessary for dissection of the role of specific Myc enhancers during hematopoiesis.

DOI: http://dx.doi.org/10.7554/eLife.23382.007

DOI: http://dx.doi.org/10.7554/eLife.23382.008

Deletion of the 8q24 super-enhancer region is well tolerated during normal development and homeostasis.

(a) Schematic representation of the 365 kb and 538 kb deletions. (b) Myc deletion removes a region containing several active enhancer elements upstream of Myc as shown by ChIP-seq analysis of histone H3 lysine 27 acetylation (H3K27ac) and lysine four trimethylation (H3K4me3). The deletion also removes several Tcf7l2 ChIP-seq peaks. Signal from Myc and wild-type mice are shown in green and blue, respectively. Red arrowheads and horizontal lines mark the different enhancer positions. (c) Haematoxylin/ Eosin stained sections of spleen, bladder, prostate, colon (Bar = 100 µm) and Carmine Alum stained whole mounts of mammary glands, Bars = 3 mm, 100 µm (inset) showing normal development and homeostasis of different organs in Myc mice. (d) Myc mice have a reduced number of B-cells compared to the wild-types. Left panel: FACS plots of a representative Myc and wild-type mouse spleen showing B-cell (B) population. Right panel: Scatter dot plot of total number of B cells in the spleen and bone marrow of wild-type (squares), n = 5 and Myc (filled circles), n = 5. Each point represents individual mouse. Line represents the median. See Figure 2—source data 1 for details. The number of CD4+ and CD8+ T-cells is not affected by the deletion (see Figure 2—figure supplement 1 and appendix 1).
Figure 2—figure supplement 1.

The loss of the Myc super-enhancer region results in a decrease in the number of B-cells, but no major defects in hematopoiesis.

(a) Super-enhancer region deletion results in a lower number of total cells in the spleen (average number in wild-type = 150.1×106 and Myc = 117.2×106) which manifests as a specific decrease of B-cell numbers both in the spleen and peripheral blood without an affect on the CD4+ and CD8+ T-cell population. Line marks the median. See Figure 2—figure supplement 1—source data 1 for details. (b) ChIP-seq analysis of histone marks H3K4me2 (red), H3K27ac (green) and RNA-seq (grey: signals from plus and minus strand are shown) shows the presence of B-cell specific enhancer both 3´and 5´ side of the Myc ORF. One of these enhancers (black arrow, mature B-cells panel) is located at the 5´boundary of the deleted region (black solid bar). The 2–540 deletion will bring this element very close to the Myc TSS, potentially explaining the increased Myc expression in the spleen. The different enhancer regions used in this study are marked by red arrowhead and the 5´ boundary of the super-enhancer region is marked by dashed line. The increase in MYC levels in the spleen and decrease in B-cell number could potentially be explained by a direct effect of MYC in inducing apoptosis of B-cells (Hoffman and Liebermann, 2008). However, further studies are necessary for dissection of the role of specific Myc enhancers during hematopoiesis.

DOI: http://dx.doi.org/10.7554/eLife.23382.007

DOI: http://dx.doi.org/10.7554/eLife.23382.008

DOI: http://dx.doi.org/10.7554/eLife.23382.005

B cell numbers in the wild-type and Myc mice in Figure 2d.

DOI: http://dx.doi.org/10.7554/eLife.23382.006

The loss of the Myc super-enhancer region results in a decrease in the number of B-cells, but no major defects in hematopoiesis.

(a) Super-enhancer region deletion results in a lower number of total cells in the spleen (average number in wild-type = 150.1×106 and Myc = 117.2×106) which manifests as a specific decrease of B-cell numbers both in the spleen and peripheral blood without an affect on the CD4+ and CD8+ T-cell population. Line marks the median. See Figure 2—figure supplement 1—source data 1 for details. (b) ChIP-seq analysis of histone marks H3K4me2 (red), H3K27ac (green) and RNA-seq (grey: signals from plus and minus strand are shown) shows the presence of B-cell specific enhancer both 3´and 5´ side of the Myc ORF. One of these enhancers (black arrow, mature B-cells panel) is located at the 5´boundary of the deleted region (black solid bar). The 2–540 deletion will bring this element very close to the Myc TSS, potentially explaining the increased Myc expression in the spleen. The different enhancer regions used in this study are marked by red arrowhead and the 5´ boundary of the super-enhancer region is marked by dashed line. The increase in MYC levels in the spleen and decrease in B-cell number could potentially be explained by a direct effect of MYC in inducing apoptosis of B-cells (Hoffman and Liebermann, 2008). However, further studies are necessary for dissection of the role of specific Myc enhancers during hematopoiesis. DOI: http://dx.doi.org/10.7554/eLife.23382.007

B and T-cell populations in the wild-type and Myc mice in Figure 2—figure supplement 1a.

DOI: http://dx.doi.org/10.7554/eLife.23382.008 The larger deletion, Myc, could also be bred to homozygosity, and both males and females were viable. Given that the entire Myc regulatory region spans more than 2 Mb of DNA and is located on both sides of the Myc coding region (Rosenbloom et al., 2013; Sloan et al., 2016), the deletion is not expected to be equivalent to deletion of the Myc gene itself. Still, the viability of the mice is striking, since the region deleted contains regions linked to risk for myeloma, chronic lymphocytic leukemia and pancreatic, thyroid, bladder, prostate, breast, and colon cancers (Chung and Chanock, 2011; Sahasrabudhe et al., 2015; Mitchell et al., 2016; Zhang et al., 2016). To characterize the mice further, we analyzed histology and MYC expression in the tissues where these tumors originate from. This analysis revealed normal morphology of mammary gland, spleen, bladder, prostate and colon in Myc mice (Figure 2c).

Loss of the super-enhancer region leads to tissue-specific changes in Myc expression

Although the Myc mice exhibited a normal phenotype, Myc expression was altered in a tissue-specific manner in these mice. This is expected since this region contains individual tissue specific regulatory elements. The expression of Myc was strongly decreased in colon, small intestine and prostate of these mice (Figure 3a and not shown). Immunohistochemical analysis of MYC expression in intestine revealed strong decrease of nuclear staining, and loss of MYC expression from the transit amplifying cell compartment. However, expression of MYC was still detected at the base of the crypt in the region where the intestinal stem cells are known to reside (Figure 3b). These results are consistent with the role of the deleted region in tumorigenesis of colon and prostate. To analyze the effect of decreased MYC expression on the proliferation in the transit amplifying compartment, we performed immunohistochemistry (IHC) for the proliferation marker Ki-67. Both the wild-type and Myc had similar proliferative activity in the intestinal crypts (Figure 3b).
Figure 3.

Tissue-specific effect of Myc deletion on MYC expression.

(a) qPCR data showing the percentage of Myc expression in Myc relative to the wild-type in colon (Co) n = 4, prostate (Pr) n = 2, bladder (Bl) n = 5, spleen (Sp) n = 4 and mammary gland (Ma) n = 3. Red line marks the expression level (100%) in wild-type mice. Error bars indicate one standard deviation. See Figure 3—source data 1 for details. (b) Immunohistochemistry shows reduced expression of MYC (n = 3 for each genotype) protein in intestinal crypts of Myc mice without any significant effect on proliferation as indicated by Ki-67 (n = 2 for each genotype) immunostaining, Bar = 10 µm. Brown: IHC staining, Blue: Haematoxylin staining.

DOI: http://dx.doi.org/10.7554/eLife.23382.009

DOI: http://dx.doi.org/10.7554/eLife.23382.010

Tissue-specific effect of Myc deletion on MYC expression.

(a) qPCR data showing the percentage of Myc expression in Myc relative to the wild-type in colon (Co) n = 4, prostate (Pr) n = 2, bladder (Bl) n = 5, spleen (Sp) n = 4 and mammary gland (Ma) n = 3. Red line marks the expression level (100%) in wild-type mice. Error bars indicate one standard deviation. See Figure 3—source data 1 for details. (b) Immunohistochemistry shows reduced expression of MYC (n = 3 for each genotype) protein in intestinal crypts of Myc mice without any significant effect on proliferation as indicated by Ki-67 (n = 2 for each genotype) immunostaining, Bar = 10 µm. Brown: IHC staining, Blue: Haematoxylin staining. DOI: http://dx.doi.org/10.7554/eLife.23382.009

Myc transcript levels in Myc mice relative to the wild-types in Figure 3a.

DOI: http://dx.doi.org/10.7554/eLife.23382.010 In contrast to colon and prostate, Myc expression was not markedly affected in the bladder, and was elevated in the spleen (Figure 3a). To analyze the cellular composition of the spleen, we performed flow cytometric analysis of markers for hematopoietic stem cells and lymphoid lineage cells. Myc mice had a near normal hematopoietic compartment (Figure 2d). The only observed difference was a small reduction of B cells in the Myc mice compared to the wild-type mice both in the spleen and the bone marrow. In contrast to the decrease in B-cells, the T cell numbers were not affected by the deletion (Figure 2—figure supplement 1a). This finding is consistent with the published data that regulatory elements controlling T-cell development and T-cell acute lymphoblastic leukemia are located 1.47 Mb downstream of the Myc ORF (Herranz et al., 2014). To identify regulatory elements that could explain the effect in B-cells, we performed ChIP-seq analysis of chromatin from LSK-Flt3neg hematopoietic stem cells and mature B-cells isolated from wild-type mice. This analysis identified two B-cell specific regulatory elements. The Myc 2–540 deletion results in loss of one of the elements, and moves the other element very close to the Myc TSS (Figure 2—figure supplement 1b). Although the exact regulatory mechanism is not clear and requires further study, the above data is consistent with a role of the super-enhancer region in development of chronic lymphocytic leukemia, which is primarily a B-cell malignancy. However, the decrease in B-cell number does not affect viability, and the Myc mice are healthy and do not display an immune-deficient phenotype under normal ‘clean’ mouse housing conditions in the absence of known pathogenic microorganisms. To compare the role of the 8q24 super-enhancer region in growth of cells in vivo and in cell culture, we isolated fibroblasts from the skin of adult Myc and wild-type mice. Based on presence of active histone marks, and undermethylation of focal elements, the super-enhancer region is active in fibroblasts from both humans and mice (Figure 4a and Figure 4—figure supplement 1). However, the resident fibroblasts in the skin of Myc mice appeared normal as judged by Vimentin expression (Figure 4b). Ki-67 staining (IHC) of skin sections showed comparable proliferation levels in wild-type and Myc mice (Figure 4b). In contrast, most lines of fibroblasts (6 out of 7) isolated from Myc mice grew slower in culture compared to fibroblasts isolated from wild-type mice (Figure 4c; p-value=0.0256, Mann-Whitney one tailed test).
Figure 4.

Myc deletion results in a proliferation defect of adult skin fibroblasts cultured in vitro.

(a) The super-enhancer region deleted in the Myc has under methylated DNA as determined through bisulfite sequencing of the wild-type fibroblasts grown in culture. H3K27ac ChIP-seq shows the presence of active enhancer marks within this region in the wild-type fibroblasts whereas the Myc fibroblasts show a complete absence of the super-enhancer region. The Myc super-enhancer region is also active in human fibroblasts (see Figure 4—figure supplement 1). (b) Normal morphology and proliferation of resident fibroblasts in the mouse skin as determined by Vimentin and Ki-67 IHC staining respectively in both the wild-type (n = 3) and Myc mice (n = 3), Bar = 50 µm. Brown: IHC staining, Blue: Haematoxylin staining (c) Representative phase contrast images of wild-type and Myc primary fibroblasts showing growth defect of Myc fibroblasts in culture.

DOI: http://dx.doi.org/10.7554/eLife.23382.011

ChIP-seq analysis of H3 lysine 27 acetylation (H3K27ac), cohesion (SMC1A) and CTCF binding shows several active enhancer marks in the super-enhancer region upstream of the MYC gene in human fibroblasts. Red arrows mark the positions of the conserved enhancer elements used in this study.

DOI: http://dx.doi.org/10.7554/eLife.23382.012

Figure 4—figure supplement 1.

The Myc super-enhancer region is also active in human fibroblasts.

ChIP-seq analysis of H3 lysine 27 acetylation (H3K27ac), cohesion (SMC1A) and CTCF binding shows several active enhancer marks in the super-enhancer region upstream of the MYC gene in human fibroblasts. Red arrows mark the positions of the conserved enhancer elements used in this study.

DOI: http://dx.doi.org/10.7554/eLife.23382.012

Myc deletion results in a proliferation defect of adult skin fibroblasts cultured in vitro.

(a) The super-enhancer region deleted in the Myc has under methylated DNA as determined through bisulfite sequencing of the wild-type fibroblasts grown in culture. H3K27ac ChIP-seq shows the presence of active enhancer marks within this region in the wild-type fibroblasts whereas the Myc fibroblasts show a complete absence of the super-enhancer region. The Myc super-enhancer region is also active in human fibroblasts (see Figure 4—figure supplement 1). (b) Normal morphology and proliferation of resident fibroblasts in the mouse skin as determined by Vimentin and Ki-67 IHC staining respectively in both the wild-type (n = 3) and Myc mice (n = 3), Bar = 50 µm. Brown: IHC staining, Blue: Haematoxylin staining (c) Representative phase contrast images of wild-type and Myc primary fibroblasts showing growth defect of Myc fibroblasts in culture. DOI: http://dx.doi.org/10.7554/eLife.23382.011

The Myc super-enhancer region is also active in human fibroblasts.

ChIP-seq analysis of H3 lysine 27 acetylation (H3K27ac), cohesion (SMC1A) and CTCF binding shows several active enhancer marks in the super-enhancer region upstream of the MYC gene in human fibroblasts. Red arrows mark the positions of the conserved enhancer elements used in this study. DOI: http://dx.doi.org/10.7554/eLife.23382.012

Deletion of the Myc super-enhancer region affects MYC target gene expression only under culture conditions

To understand the mechanism by which the deletion of the 8q24 super-enhancer region has a differential effect on growth during normal tissue homeostasis and growth under culture conditions, we subjected both the mouse tissues and cultured cells to RNA-seq analysis. Analysis of mouse tissues confirmed the changes in Myc expression observed by qPCR (Figure 5a and Figure 5—figure supplement 1). Surprisingly, despite more than 80% decrease of Myc expression in the colon, very few genes were downregulated in the tissues, and none of the significantly altered genes were known MYC targets (Supplementary file 1). These results suggest that expression of canonical MYC target genes is not sensitive to decreases in MYC protein level during normal tissue homeostasis. In contrast to the in vivo situation, where Myc is downregulated but key target genes are not affected, in cultured Myc fibroblasts that grew slowly in culture, the downregulation of Myc lead to a loss of expression of key target genes that drive cell growth and division. Upstream regulator analysis performed using Ingenuity Pathway Analysis revealed that the highest-ranked potential regulator for the identified gene set was MYC (Figure 5b).
Figure 5.

Differential effect of Myc deletion on MYC target gene expression.

(a) Scatter plot comparing the average Fragments per kilobase of exons per million fragments mapped (FPKM) values of gene transcripts in colon and spleen of wild-type (n = 4) and Myc (n = 4) mice. Genes showing significant (q < 0.05) differential expression are marked in red (Myc) or green (other genes). For median FPKM values of gene transcripts see Figure 5—figure supplement 1 (b) Upstream regulator analysis of RNA-seq data shows that the highest ranked potential regulator affected in the slow growing Myc fibroblasts is MYC. The activation z-scores are to infer the activation states of predicted upstream regulators. The overlap p-values were calculated from all the regulator-targeted differential expression genes using Fisher’s Exact Test. Two independent Myc fibroblasts lines were analysed to confirm the downregulation of Myc. Ingenuity pathway analysis performed on one of these is shown.

DOI: http://dx.doi.org/10.7554/eLife.23382.013

Genes showing significant (q < 0.05) differential expression are marked in red (Myc) or green (other genes). The plot was generated using ggplot2 (version 2.2.1, RRID:SCR_014601). The median FPKM values of gene transcripts were plotted for the colon data since one of the wild-type samples for unknown reason had higher amounts of ribosomal structural protein transcripts.

DOI: http://dx.doi.org/10.7554/eLife.23382.014

Figure 5—figure supplement 1.

Scatter plot comparing the median of FPKM values of gene transcripts in colon of wild-type (n = 4) and Myc (n = 4) mice.

Genes showing significant (q < 0.05) differential expression are marked in red (Myc) or green (other genes). The plot was generated using ggplot2 (version 2.2.1, RRID:SCR_014601). The median FPKM values of gene transcripts were plotted for the colon data since one of the wild-type samples for unknown reason had higher amounts of ribosomal structural protein transcripts.

DOI: http://dx.doi.org/10.7554/eLife.23382.014

Differential effect of Myc deletion on MYC target gene expression.

(a) Scatter plot comparing the average Fragments per kilobase of exons per million fragments mapped (FPKM) values of gene transcripts in colon and spleen of wild-type (n = 4) and Myc (n = 4) mice. Genes showing significant (q < 0.05) differential expression are marked in red (Myc) or green (other genes). For median FPKM values of gene transcripts see Figure 5—figure supplement 1 (b) Upstream regulator analysis of RNA-seq data shows that the highest ranked potential regulator affected in the slow growing Myc fibroblasts is MYC. The activation z-scores are to infer the activation states of predicted upstream regulators. The overlap p-values were calculated from all the regulator-targeted differential expression genes using Fisher’s Exact Test. Two independent Myc fibroblasts lines were analysed to confirm the downregulation of Myc. Ingenuity pathway analysis performed on one of these is shown. DOI: http://dx.doi.org/10.7554/eLife.23382.013

Scatter plot comparing the median of FPKM values of gene transcripts in colon of wild-type (n = 4) and Myc (n = 4) mice.

Genes showing significant (q < 0.05) differential expression are marked in red (Myc) or green (other genes). The plot was generated using ggplot2 (version 2.2.1, RRID:SCR_014601). The median FPKM values of gene transcripts were plotted for the colon data since one of the wild-type samples for unknown reason had higher amounts of ribosomal structural protein transcripts. DOI: http://dx.doi.org/10.7554/eLife.23382.014 Measured by FPKM values, the cultured wild-type fibroblasts had higher Myc mRNA levels than normal tissues, whereas the cultured null fibroblasts had Myc levels that were comparable to or lower than those of normal wild-type tissues. The elevated Myc levels in cultured cells are caused by serum stimulation, as Myc mRNA levels are low in serum-starved fibroblasts and strongly induced by serum (Ref. [Dean et al., 1986] and our unpublished data). These results indicate that the 8q24 super-enhancer region is dispensable for normal tissue homeostasis under conditions where MYC activity is relatively low. However, the region is required for induction of MYC activity to levels that are high enough to drive the expression of MYC target genes above their basal levels during pathological growth.

The Myc super-enhancer region is required for tumorigenesis in mice

We have shown earlier that deletion of a 1.7 kb Myc-335 enhancer sequence located at the 8q24 super-enhancer region is required for intestinal tumorigenesis in mice (Sur et al., 2012b). As the super-enhancer region deleted in Myc mice carries risk also for other cancer types, including breast and bladder cancer, we tested the susceptibility of the Myc mice to carcinogen induced bladder and mammary tumorigenesis. The Myc mice were not resistant to N-Butyl-N(4-hydroxybutyl) nitrosamine (BBN) induced bladder tumors. Both wild-type (n = 8) and Myc (n = 8) mice developed urothelial changes ranging from hyperplasia to high grade invasive urothelial carcinoma after 5 months of BBN treatment. In contrast, comparison of median tumor-free survival times of wild-type and Myc mice exposed to mammary-tumor inducing dimethylbenz[a]anthracene/ medroxypregesterone (DMBA/MPA) regimen revealed that the Myc mice were partially resistant to mammary tumorigenesis (Figure 6a). The median tumor-free survival time for the wild-type and Myc mice was 88 and >120 days, respectively. Although we cannot pinpoint the specific regions that contribute to breast tumorigenesis by analysis of the Myc mice, our work is consistent with the presence of a breast cancer susceptibility locus in humans at a region syntenic to the deletion. The region is distinct from the colon cancer susceptibility locus that harbors Myc-335.
Figure 6.

Myc −2 to −540 kb genomic region is required for the growth of cancers in vivo and cancer cells in vitro.

(a) Tumor-free survival plots showing resistance of Myc mice to development of DMBA/MPA induced mammary tumors. p-value=0.0002 (Mantel-Cox Log-rank test). See Figure 6—source data 1 for details. (b) The Myc −2 to −540 kb deletion results in fewer polyps than the Myc-335 deletion alone. p-value=0.00019 (Students T-test, 2-tailed). Apc mice were of 4 months of age (n = 5) and Apc mice were 6 months old (n = 5) at the time of analysis. Filled circles correspond to individual mice and red color denotes the median. See Figure 6—source data 1 for details. Bar equals 5 mm. (c) Crispr-Cas9 mediated deletion of region corresponding to Myc in human GP5d colon cancer cells, results in a loss of the edited cells over time. Top panel shows the active enhancer elements in GP5d cells within this region as determined by ChIP-seq analysis of histone H3 lysine 27 acetylation (H3K27ac). The sites of sgRNAs (black lines) and genotyping primers (blue arrows) used are indicated (not to scale). Red arrows mark the enhancer regions used in this study. Bottom panel shows the PCR-genotyping of the MYC locus and the control IGH locus showing the specific loss of the cells with the edited MYC locus over time. GAPDH was used as internal control. The right panel in each set shows absence of any deletion in the non-transfected cells (day 2). 100 bp ladder DNA molecular weight marker is shown (M).

DOI: http://dx.doi.org/10.7554/eLife.23382.015

DOI: http://dx.doi.org/10.7554/eLife.23382.016

Myc −2 to −540 kb genomic region is required for the growth of cancers in vivo and cancer cells in vitro.

(a) Tumor-free survival plots showing resistance of Myc mice to development of DMBA/MPA induced mammary tumors. p-value=0.0002 (Mantel-Cox Log-rank test). See Figure 6—source data 1 for details. (b) The Myc −2 to −540 kb deletion results in fewer polyps than the Myc-335 deletion alone. p-value=0.00019 (Students T-test, 2-tailed). Apc mice were of 4 months of age (n = 5) and Apc mice were 6 months old (n = 5) at the time of analysis. Filled circles correspond to individual mice and red color denotes the median. See Figure 6—source data 1 for details. Bar equals 5 mm. (c) Crispr-Cas9 mediated deletion of region corresponding to Myc in human GP5d colon cancer cells, results in a loss of the edited cells over time. Top panel shows the active enhancer elements in GP5d cells within this region as determined by ChIP-seq analysis of histone H3 lysine 27 acetylation (H3K27ac). The sites of sgRNAs (black lines) and genotyping primers (blue arrows) used are indicated (not to scale). Red arrows mark the enhancer regions used in this study. Bottom panel shows the PCR-genotyping of the MYC locus and the control IGH locus showing the specific loss of the cells with the edited MYC locus over time. GAPDH was used as internal control. The right panel in each set shows absence of any deletion in the non-transfected cells (day 2). 100 bp ladder DNA molecular weight marker is shown (M). DOI: http://dx.doi.org/10.7554/eLife.23382.015

Survival time and intestinal polyp numbers for mice in Figure 6a-b.

DOI: http://dx.doi.org/10.7554/eLife.23382.016 To determine whether additional elements outside of the Myc-335 region are playing a role in tumorigenesis, we crossed the Myc mice with the Apc mouse that is susceptible to intestinal tumors. The Myc mice had fewer polyps than the Myc-335 mice in the Apc background. In this study the wild-type mice had on an average 56 polyps at around 4 months of age (n = 5) when they had to be euthanized for ethical reasons similar to what we reported previously. The Apc looked healthy and had on an average 2.4 polyps even at 6 months of age (n = 5) compared to an average of 14.33 polyps reported for the Apc null mice at 4 months of age (Figure 6b). Together with our earlier findings, these results indicate that loss of the 8q24 super-enhancer region makes mice resistant to both genetically and chemically induced tumors. We further tested the requirement of this region for the proliferation of cancer cell lines in cultures. We found that the corresponding region (hg19: chr8:128226490–128746456) was also required for GP5d colon cancer cell growth, as indicated by progressive loss of cells bearing a CRISPR/Cas9 induced deletion of the region during co-culture with unedited cells in the population (Figure 6c).

Discussion

The region around the MYC gene carries inherited risk towards multiple major forms of cancer. On aggregate, this region contributes more to inherited cancer than any other locus in the human genome. The risk alleles for different cancer types are located in multiple distinct linkage disequilibrium blocks, indicating that different variants contribute to different cancer types. Several of these regions containing risk variants have been implicated in regulation of MYC expression (Hallikas et al., 2006; Sur et al., 2012b; Herranz et al., 2014; Uslu et al., 2014), suggesting that a large number of enhancers within this region can drive tumorigenesis. Some of the identified elements have also been shown to have roles in normal development (Herranz et al., 2014; Uslu et al., 2014). To study the role of the 8q24 region more systematically, we have in this work deleted several individual enhancer elements, and also analyzed the effect of larger deletions on normal development and carcinogenesis in mice. Our analysis of mice lacking a 538 kb region upstream of the Myc gene suggests that enhancer elements within this region cooperatively enhance Myc expression. Deletion of individual enhancers in this region has only a weak (Sur et al., 2012b) or no effect on Myc expression in the mouse intestine in contrast to the deletion of the entire super-enhancer region, which leads to severe decrease in Myc expression in multiple tissues. MYC deficient mouse embryos die due to placental defect at E9.5. The embryos are also smaller in size than wild-type embryos (Davis et al., 1993). However, when Myc is deleted only in the epiblast, the embryos grow normally and survive until E11.5, when they die due to defects in hematopoiesis (Dubois et al., 2008). None of these defects are observed in mice homozygous for the deletion of super-enhancer region. The 8q24 super-enhancer region is thus dispensable for MYC function both in the placenta and during early hematopoiesis. In our mouse colony, the super-enhancer region deficient mice also do not display the size or weight differences reported for Myc heterozygous mice that have a 50% reduction in MYC activity (Trumpp et al., 2001). These results indicate that tissue-specific enhancers that reside outside of the deleted regions drive sufficient MYC expression in the tissues that contribute to the phenotypes observed in Myc and Myc mice. Consistently with this, several hematopoietic enhancers have been identified in the region 3' of the MYC ORF (Hnisz et al., 2013; Shi et al., 2013; Herranz et al., 2014). Myc heterozygous mice also display increased longevity and enhanced healthspan (Hofmann et al., 2015). Although the deletion of the super-enhancer region that contains tissue-specific enhancers regulating MYC expression is not equivalent to a heterozygous deletion of the Myc gene in the whole body, the Myc mice could be an interesting model for identification of the tissues that contribute to the longevity phenotype. Despite decreased levels of MYC in multiple adult tissues, the mice lacking the super-enhancer region are viable, fertile and display normal tissue morphology in all the tissues we investigated. They display no overt phenotype and do not have marked defects in cell proliferation. The mice are, however, resistant to intestinal tumorigenesis, and DMBA-induced mammary tumors, indicating that this region is important for tumorigenesis also in mice. Our data thus shows that despite the central role of this region in tumorigenesis (Sur et al., 2012b; Lovén et al., 2013), it is dispensable for normal tissue development and homeostasis under laboratory conditions. Whereas this result may appear very surprising, it is consistent with the original identification of this region using genome-wide association studies (GWAS). GWAS has a high power to identify common variants, and most variants that are common have only a limited effect on physiological functions. This is because a variant that has strong positive or negative effect is rapidly fixed or lost, respectively. Thus, GWAS are specifically biased to find variants that have a relatively large effect on disease, but a small effect on fitness. Most genes in mammals do not have haploinsufficient phenotypes. Such buffering could be due to mechanisms that maintain constant expression level irrespective of gene dose. However, a simpler buffering mechanism involves either expressing a gene at a very low level where it has no effect, or at a high level where it can contribute its functions even if its expression level is decreased due to transcriptional noise or loss-of-function of one allele. A similar two state mechanism where physiological transcription factor (TF) activity levels in the relevant cell types are either too low to drive any target genes (off state), or high enough to activate all important targets (on state) could also mechanistically explain why most heterozygous null mutations of TF genes have no apparent phenotype. Our analysis of the role of MYC in normal colon is consistent with such a simple buffering model (Figure 7). However, it should be noted that this buffering mechanism does not operate in all tissues and under all conditions. For example, Myc gene dose has effects on mouse size, longevity and hematopoiesis (Davis et al., 1993; Trumpp et al., 2001; Dubois et al., 2008; Hofmann et al., 2015). In addition, the level of expression of the Myc gene has quantitative effects on cell proliferation under pathological conditions such as activation of T-cells (Heinzel et al., 2017). These results indicate that in some situations, MYC is expressed at a level where cell growth responds linearly to small changes in MYC levels (Figure 7, middle panel). However, the lack of an overt phenotype in our model under normal physiological conditions in the absence of infection or tissue damage suggests that growth during normal tissue homeostasis in at least some adult tissues does not linearly respond to changes in MYC levels. The lack of an overt phenotype should not, however, be taken to mean that the mice have no phenotype at all. As the super-enhancer region contains several highly conserved DNA segments, and affects cell growth in culture, we expect that it will also affect responses to tissue damage or some other perturbation that we have not investigated here. Therefore, further studies are needed to determine the role of the super-enhancer region in various chronic and acute models of injury and infection.
Figure 7.

Model showing the activity of the Myc super-enhancer region during normal homeostasis (left) and cancer (right).

During normal tissue homeostasis (left), Myc enhancers are not strongly active, and MYC activity is relatively low. The MYC expression level is insufficient to recruit enough MAX proteins to MYC/MAX heterodimers to drive strong induction of the MYC target genes, which instead remain under the control of basal transcription factors (BTF). Under conditions of normal rapid proliferation as seen during embryonic development or during pathological insults in the adult, MYC is expressed at intermediate levels to elicit response from targets with high affinity binding sites (red). In cancer cells or cells grown in culture (right), upstream regulators such as Tcf7l2 and β-catenin activate the Myc super-enhancers, driving high levels of MYC expression. This leads to the formation of MYC/MAX heterodimers that strongly activate transcription of MYC target genes driving cancer cell growth. The high levels of MYC are also sufficient to induce target genes that harbor low affinity MYC binding sites (grey). The model is consistent with the model of Lorenzin et al (Lorenzin et al., 2016) who showed genes differ in their response to MYC levels due to differences in the MYC affinity of their promoters. Given that Myc super-enhancer region is tumor-specific, and induction of the MYC target genes are not required for normal homeostasis, it provides a promising target for antineoplastic therapies.

DOI: http://dx.doi.org/10.7554/eLife.23382.017

Model showing the activity of the Myc super-enhancer region during normal homeostasis (left) and cancer (right).

During normal tissue homeostasis (left), Myc enhancers are not strongly active, and MYC activity is relatively low. The MYC expression level is insufficient to recruit enough MAX proteins to MYC/MAX heterodimers to drive strong induction of the MYC target genes, which instead remain under the control of basal transcription factors (BTF). Under conditions of normal rapid proliferation as seen during embryonic development or during pathological insults in the adult, MYC is expressed at intermediate levels to elicit response from targets with high affinity binding sites (red). In cancer cells or cells grown in culture (right), upstream regulators such as Tcf7l2 and β-catenin activate the Myc super-enhancers, driving high levels of MYC expression. This leads to the formation of MYC/MAX heterodimers that strongly activate transcription of MYC target genes driving cancer cell growth. The high levels of MYC are also sufficient to induce target genes that harbor low affinity MYC binding sites (grey). The model is consistent with the model of Lorenzin et al (Lorenzin et al., 2016) who showed genes differ in their response to MYC levels due to differences in the MYC affinity of their promoters. Given that Myc super-enhancer region is tumor-specific, and induction of the MYC target genes are not required for normal homeostasis, it provides a promising target for antineoplastic therapies. DOI: http://dx.doi.org/10.7554/eLife.23382.017 Based on our data and the earlier literature we propose that under normal physiological conditions in the intestine, the Myc gene regulatory system is in the off state, and a basal level of expression of the MYC target genes is maintained by a MYC-independent mechanism. The target genes are thus only sensitive to an increase in MYC levels. Consistently, an 80% decrease of Myc mRNA expression does not lead to a proliferation defect, or major changes in expression of known MYC target genes. In contrast, in tumors the system is locked to an on state, where MYC targets are driven to a maximal level by MYC, and the targets are now only sensitive to a decrease in MYC activity (Figure 7). The requirement of MYC in tumor cells appears absolute. In transgenic animal models, overexpression of MYC leads to deregulated proliferation and tumor development in multiple tissues (Felsher and Bishop, 1999; Pelengaris et al., 1999; D'Cruz et al., 2001; Jain et al., 2002; Shachaf et al., 2004). Furthermore, inhibition of MYC almost invariably causes growth arrest of cancer cells both in culture and in vivo (Soucek et al., 2002, 2004; Hart et al., 2014). Despite the importance of MYC for cancer growth, it appears that the role of MYC in controlling growth during adult tissue homeostasis is limited. In the adult tissues, MYC is expressed in rapidly proliferating compartments of the body like the intestinal crypts and skin. Deletion of Myc in these compartments does not result in prominent proliferation defects (Wilson et al., 2004; Baena et al., 2005; Bettess et al., 2005; Muncan et al., 2006). Although there is still controversy regarding MYC requirement for the intestinal homeostasis, in the skin MYC is dispensable under normal adult proliferation and homeostasis in vivo (Oskarsson et al., 2006). It is however required for Ras mediated tumorigenesis and growth of fibroblasts and keratinocytes in vitro (Mateyak et al., 1997; Oskarsson et al., 2006). Taken together, these results suggest that MYC is required for pathological proliferation, but is less important and in many cases dispensable for normal homeostasis of tissues in the adult. Our results are consistent with these observations. Prior to our study it was not clear whether the MYC dependence of cancer cells in vivo and normal cells in culture is due to shared regulatory mechanisms. Our results have uncovered striking mechanistic similarities between growth of normal cells in culture, and growth of cancer cells in vivo by showing that MYC expression depend on the same genetic elements in cultured normal cells and in cancer cells. The similarity between tumor cells and cultured normal cells also suggest that many potential drugs that block cancer cell growth may have been inadvertently discarded due to their negative effects on growth of normal cells in culture, even when they might not have affected normal tissue homeostasis in vivo. Our results show that the MYC super-enhancer region that carries multi-cancer susceptibility in humans contributes to the formation of multiple tumor types also in mice. Despite its role in tumor formation, it is dispensable for normal development and homeostasis. Loss of the super-enhancer region leads to low MYC expression, but the lowered expression does not translate to changes in expression of MYC target genes in the intestine. Thus, the MYC/MAX/MNT system (Grandori et al., 2000) that drives cell growth and proliferation is robustly set to an off state during normal homeostasis, whereas in cancer, the system is locked to a pathological on state. This also explains how physiological growth control can be robust to small perturbations and transcriptional noise. Taken together, our results reveal an important difference between the transcriptional states of normal and cancer cells, and suggest that therapeutic interventions that decrease the activity of the Myc super-enhancer region would be well tolerated.

Materials and methods

Mouse strains

We generated cKO Myc-196 and cKO Myc-540 strains with loxP sites flanking the regions chr15:61445326–61447611 and chr15:61789274–61791107, respectively (Taconic). These mice were crossed to EIIa-cre mouse strain (Jackson Laboratory) to generate mice with enhancer deletions. Myc-CTCF mouse strain was generated by mutating the CTCF-binding site at chr15:61983375–61983647 TGGCCAGTAGAGGGCAC to TGGAACGTCTTGAATGC. In order to generate large deletions at the Myc locus (Myc and Myc) Myc-367 and Myc-540 were crossed to Myc-CTCF that were also heterozygous for the Rosa26-Cre (Taconic). The Myc-540, Myc-196 and Myc-CTCF carry one lox P site at the respective loci (chr15:61445326, chr15:61618287 and chr15:61983375). The loxP site on chr15:61983375 is located immediately 5' of the mutant CTCF binding site. We obtained compound heterozygotes carrying the chr15:61445326 or the chr15:61618287 loxP site together with the loxP site on chr15:61983375 and the Rosa26-Cre. The compound heterozygotes were screened by PCR for the interallelic recombination and the resultant deletion and duplication of the intervening sequence. Mice mosaic for the deletion and duplication were backcrossed to the C57Bl/6 mice in order to segregate the chromosomes carrying the deletion. The F1 heterozygotes were intercrossed to generate mice with homozygous large deletions. Myc-335 strain has been previously described (Sur et al., 2012b). All mice used in the study were on a C57Bl/6 genetic background. All mouse experiments were conducted in accordance with the local ethical guidelines, after approval of the protocols by the ethics committee of the Board of Agriculture, Experimental Animal Authority, Stockholm South, Sweden (Dnr S50/13, S11/15 and S16/15). The sequences of the different primer pairs used for genotypings are given in Supplementary file 2.

Mammary gland whole mount analysis

Inguinal mammary glands were removed from 8 week old virgin females and spread on glass slides. These were fixed for 4 hr in Carnoy’s fixative and subsequently stained O/N with Carmine Alum. The whole mounts were rinsed and dehydrated through increasing series of ethanol and cleared in xylene before mounting with the pertex mounting medium.

Quantitative PCR analysis

qPCR was performed as described previously (Sur et al., 2012b). Essentially, total RNA was isolated from whole tissue by homogenizing in RNA Bee reagent (ambios AMS Biotechnology) followed by RNA isolation using Qiagen’s RNA MinElute kit according to manufacturers' protocols. 0.5–1 µg of total RNA was reverse transcribed using high capacity reverse transcription kit in a 20 μl reaction (Applied Biosystems). Quantitative PCR in triplicates was performed using the SYBR select master mix (Applied Biosystems) on the LightCycler 480 instrument (Roche). For normalization, mouse β-actin transcripts were used as internal controls. Following primer pairs were used for quantitative PCR analysis. Myc-Fw: 5'-GGGGCTTTGCCTCCGAGCCT-3', Myc-Rev: 5'-TGAGGGGCATC GTCGTGGCT-3', β-actin-Fw: 5'CTGTCGAGTCGCGTCCACCCG-3', β-actin-Rev: 5'-CATGCCGGAGCCGTTGTCGAC-3'.

RNA-sequencing

NEBNext Ultra Directional RNA library Prep kit (NEB) was used for preparing the samples for RNA-seq together with the NEBNext Poly(A) mRNA magnetic isolation module (NEB) according to manufacturers protocol. In the case of tissues 1–2 µg and for cultured fibroblasts 200 ng of total RNA was used as starting material. For library preparation, adapters and index primers from NEBNext Multiplex Oligos for Illumina kit were used. The RNA-seq library was sequenced on a HiSeq2000 (Illumina). Sequencing reads were mapped to the mouse reference genome (NCBI37/mm9) using Tophat2 (version 2.0.13; RRID:SCR_013035) (Kim et al., 2013). Cuffdiff (version 2.2.1; RRID:SCR_001647) was used for differential gene expression analysis and for graphical representation, CummeRbund package (version 2.8.2; RRID:SCR_014568) (Trapnell et al., 2012) was used. The upstream regulator analysis was performed on all the significant differentially expressed genes (Cuffdiff q-value <0.05) using QIAGEN’s Ingenuity Pathway Analysis (IPA, QIAGEN Redwood city, www.qiagen.com/ingenuity; version 24718999, updated 2015-09-14; RRID:SCR_008653).

ChIP-seq

ChIP-seq was performed as described in (Sur et al., 2012b; Yan et al., 2013) with the following modifications: Adult 8–10 week old mice were euthanized and colon was removed, rinsed with cold PBS and cut into fine pieces. Tissue was crosslinked with 1.5% formaldehyde and cultured cells were crosslinked with 1% formaldehyde for 10 min at room temperature and quenched with 0.33M Glycine. Sequences were mapped to the mouse reference genome (NCBI37/mm9) and human reference genome (hg19) using Burrows-Wheeler Alignment tool (bwa) (version 0.6.2) (Li and Durbin, 2009) with default parameters. All antibodies used in ChIP-seq experiments were ChIP-grade. In each experiment a non-specific IgG was used as control. Following antibodies were used for ChIP-seq experiments: rabbit anti-H3 lysine 27 acetylation (H3K27ac) (abcam, ab4729: RRID:AB_2118291), mouse anti-H3 lysine four trimethylation (H3K4me3) (abcam, ab1012; RRID:AB_442796), rabbit anti-Rad21 (Santa Cruz, sc-98784; RRID:AB_2238151), goat anti-CTCF (Santa Cruz, sc-15914X; RRID:AB_2086899), rabbit anti-SMC1A (Bethyl Laboratories, A300-055A; RRID:AB_2192467), rabbit IgG (Santa Cruz, sc-2027; RRID:AB_737197), mouse IgG (Santa Cruz, sc-2025; RRID:AB_737182), goat IgG (Santa Cruz, sc-2028; RRID:AB_737167). ChIPseq data for Tcf7l2 was used from ENA accession number PRJEB3354 (Sur et al., 2012a) and for GP5d cells from ENA accession number PRJEB1429 (Yan et al., 2013a). For visualization, ChIP-seq read depth data were average smoothed across windows of 10 pixels (H3K27ac and H3K4me3) or five pixels (Tcf7l2) in UCSC Genome Browser; RRID:SCR_005780 or alternatively visualized in Integrative Genomics Viewer (IGV, version 2.3; RRID:SCR_011793).

Bisulfite sequencing

Genomic DNA was isolated using Qiagen’s Blood & Tissue Genomic DNA extraction kit. Around 1 µg of wild-type and 250 ng of Myc△2–540/△2-540 null fibroblast genomic DNA was sonicated to 300 bp fragments using Covaris S220 sonicator. Subsequent to end polishing and A base addition, cytosine methylated paired end adapters (Integrated DNA technologies) were ligated to the DNA fragments. The adapter sequences are as follows 5'-P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT After adapter ligation 300–600 bp fragments were size-selected on a 2% agarose gel. Bisulfite-conversion was carried out using ZYMO EZ DNA Methylation-Gold kit (cat. no. D5005). PCR amplification with 12 and 18 cycles was carried out to prepare libraries from the wild-type and Myc null mouse fibroblasts, respectively. The primer pair used for PCR amplification was as follows

PE PCR Primer P1:

5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC TTCCGATCT

PE PCR Primer P2:

5'-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACC GCTCTTCCGATCT The final library was size-selected for 250–300 bp fragments on a 2% agarose gel and 150 bp sequenced from both ends on two lanes of a HiSeq 4000 (Illumina). Raw sequencing reads were quality and adapter trimmed with cutadapt version 1.8.1 (RRID:SCR_011841) in Trim Galore version 0.4.0 (RRID:SCR_011847). Trimming of low-quality ends was done using Phred score cutoff 30. In addition, all reads were trimmed by 2 bp from their 3' end. Adapter trimming was performed using the first 13 bp of the standard Illumina paired-end adapters with stringency overlap two and error rate 0.1. Read alignment was performed against mouse genome mm9 with Bismark (version v0.14.3; RRID:SCR_005604) (Krueger and Andrews, 2011) and Bowtie 2 (version 2.2.4; RRID:SCR_005476) (Langmead and Salzberg, 2012). Duplicates were removed using the Bismark deduplicate function. Extraction of methylation calls was done with Bismark methylation extractor discarding first 10 bp of both reads and reading methylation calls of overlapping parts of the paired reads from the first read (--no_overlap parameter). Genomic sites with the coverage of at least 10 reads were considered and methylation ratios smoothed with loess method across 49 bp windows. All sequencing data is uploaded to European Nucleotide Archive (ENA, EMBL-EBI; RRID:SCR_006515) under accession number PRJEB11397 (Dave et al., 2016; http://www.ebi.ac.uk/ena/data/view/PRJEB11397).

Immunohistochemistry and flow cytometry

Five micron paraffin embedded tissue sections were processed for immuno-histochemistry as previously described (Sur et al., 2012b). Rabbit polyclonal anti-Myc (Santa Cruz, sc-764; RRID:AB_631276) (1:500), Rabbit monoclonal anti Ki-67 (abcam, ab16667; RRID:AB_302459) (1:200), Goat polyclonal anti-Vimentin (Santa Cruz, sc-7557; RRID:AB_793998) (1:500), biotinylated goat anti-Rabbit IgG (Vector Laboratories, BA1000; RRID:AB_2313606) and biotinylated rabbit anti-Goat IgG (Vector Laboratories, BA5000; RRID:AB_2336126) (1:350) antibodies were used. For flow cytometry, single cell suspensions of spleen and bone-marrow and cells from peripheral blood were stained with Fc-block (CD16/CD32 clone 93, Biolegend, 101302, RRID:AB_312801) and subsequently with CD19 (clone 1D3, BD Biosciences, RRID:AB_11154223), TER119 (clone TER119, Biolegend 116210, RRID:AB_313711), CD3ε (clone 145–2 C11, Biolegend 100308, RRID:AB_312673), NK1.1(clone PK136, Biolegend, 108716, RRID:AB_493590), GR1/LY6G (clone RB6-8C5, Biolegend, 108410, RRID:AB_313375), CD4 (clone RM4-5, BD Biosciences, 563747) and CD8a (clone 53–6.7, BD Biosciences, 563332). Dead cells were visualized using Propidium iodide. Samples were analyzed using a BD LSRFortessa instrument.

Isolation and culture of mouse primary fibroblasts

Fibroblasts were isolated from adult mice by dissecting the skin to ~1 mm3 pieces, and allowing the pieces to adhere to cell culture plates, followed by addition of DMEM medium supplemented with 10% FCS and antibiotics. The fibroblasts were allowed to migrate out from the explants, after which the cells were collected by trypsinization and passaged in the same media for 1–3 passages. For growth assays, 2 × 103 cells were plated per well in 96 well plates. Cells were trypsinized and counted using hemocytometer at respective time points.

Tumor induction

Mammary tumors

Six week-old female mice were implanted s.c. with medroxypregesterone acetate (MPA) pellets (50 mg with a 90 days release period from Innovative Research of America). Subsequently 100 µl of 10 mg/ml dimethylbenz[a]anthracene (DMBA)/oil solution (Sigma) was administered via gavage at 7, 8, 10, 11, 13 and 14 weeks of age. Mice were checked twice a week for development of palpable tumors. Detection of palpable mass in the mammary gland was taken as the end point for tumor-free survival analysis.

Bladder tumors

Ten week-old male mice were administered 0.1% N-Butyl-N-(4-hydroxybutyl) nitrosamine (BBN) (Sigma) in drinking water for five months. At the end of the treatment the mice were sacrificed and the bladders scored for tumor development.

Intestinal tumors

Apc mouse strain (Jackson Laboratory RRID:MGI:5438590) was used as a model for spontaneous development of intestinal tumors.

CRISPR-Cas9 mediated deletion of super-enhancer region in GP5d cell line

CRISPR-Cas9 mediated deletion of MYC super-enhancer region on chromosome 8q24 (GRCh37/hg19 chr8: 128226403–128746490) and Immunoglobulin Heavy (IGH) gene locus on chromosome 14q32.33 (GRCh37/hg19 chr14: 106527004–107035452) were carried out in GP5d (Sigma, 95090715; RRID:CVCL_1235, confirmed by STR profiling at ECACC) colon cancer cell line stably expressing Cas9 protein. A lentiviral plasmid containing Cas9 fused via a self-cleaving 2A peptide to a blasticidin resistance gene, was packaged into lentiviral particles using the packaging plasmids psPAX2 (a gift from Didier Trono, Addgene plasmid # 12260, RRID:SCR_002037) and pCMV-VSV-G (a gift from Robert Weinberg (Addgene plasmid # 8454, RRID:SCR_002037). The virus was used to transduce GP5d colon cancer cells. 48 hr after transduction, GP5d cells expressing Cas9 (GP5d-Cas9) were selected in 5 µg/ml Blasticidin (Thermo Fisher Scientific Inc., Cat. no. A1113903). The single guide RNA (sgRNA’s) were designed (http://www.broadinstitute.org/rnai/public/analysis-tools/sgrna-design) to span the entire MYC super-enhancer region and IGH locus (Figure 6), respectively (Eurofins MWG Operon). sgRNAs were cloned into an sgRNA Cloning Vector (Addgene Plasmid #41824, RRID:SCR_002037) using Gibson assembly master mix (NEBuilder HiFi DNA assembly Master Mix, Cat no. E2621S). GP5d-Cas9 (2 × 106) cells were transfected (using FuGENE HD Transfection Reagent, Cat.no E2312) with 10 µg of eight pooled equimolar sgRNA constructs. Post transfection half of the cultured cells were collected for PCR genotyping, while the other half was re-plated for culturing. Cells were collected at day 2, 4 and subsequently every fourth day till day 32. DNA from cells was extracted (using DNeasy Blood & Tissue Kit, Qiagen Cat. no. 69506) and genotyped with 300 ng of DNA at following conditions - Initial denaturation of 95°C for 5 min; denaturation of 98°C for 15 s, annealing at 60°C for 30 s, extension at 72°C for 30 s (30 cycles for MYC super-enhancer region and 35 cycles for IGH gene locus deletion genotyping); final extension at 72°C, 5 min. Each experiment was done in triplicate. The sequences of the different guide RNAs and primer pairs used for PCR genotyping of the deletions are given in Supplementary file 2. GP5d cells were cultured in DMEM supplemented with 10% FBS and antibiotics. The cell line was mycoplasma free. In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included. Thank you for submitting your article "Mice deficient of Myc super-enhancer region reveal differential control mechanism between normal and pathological growth" for consideration by eLife. Your article has been favorably evaluated by Sean Morrison (Senior Editor) and two reviewers, one of whom, Chi Van Dang, is a member of our Board of Reviewing Editors. The reviewers have significant concerns about your current manuscript, discussed the reviews with one another, and the Reviewing Editor has drafted this decision to help you prepare your responses to determine whether a formal revised submission will be invited. Summary: Dave et al. reports the effect of deleting 538kb enhancer (termed "super-enhancer) region upstream of murine Myc on development and tumorigenesis. This region contains susceptibility loci with several SNPs previously correlated with increased risk for human prostate and colorectal cancer. The authors had previously shown that alteration of the risk allele G of rs6983267 in a mouse model modifies risk for intestinal tumorigenesis, but did not affect viability. Multiple risk alleles have been identified in the enhancer (super-enhancer) region, and the authors addressed the consequence of deleting this region on normal mouse development. They document that deletion of a 538kb region reduced normal Myc expression by up to 80% and yet mutant mice were viable without overt phenotype. Importantly, tumorigenesis (e.g., DMBA-induced mammary tumors) is severely diminished in this mutant background, and cells isolated from these mice have slowed growth. Overall, this manuscript contains instructive observations about the regulation of Myc expression, physiology and pathophysiological expression of Myc for tumorigenesis, underscoring the role of deregulated MYC expression in human cancers. Essential revisions: 1) The authors construed from these observations that "the MYC/MAX/MNT system that drives cell growth and proliferation is robustly set to an off state in normal homeostasis, whereas in cancer, the system is locked into a pathological on state." This statement in the last paragraph of the Discussion section is not supported by the evidence, given that the authors have not fully studied normal cellular physiology. Myc expression under normal physiological conditions could vary according to signaling and hence the concept of an 'on versus off' state seems over-simplified. For example, Heinzel et al. (Nature Immunol 18:96-104 (2017); see reference 17 below) demonstrated that Myc expression dose effect is influenced by input signals into T cell activation. In this regard, the authors should document whether normal T cell activation is altered in the mutant Myc animals. 2) The Myc heterozygotes (Sedivy and coworkers: Hofmann et al. Cell 2015) have increased longevity. It stands to reason that the Myc super-enhancer mutant may also have increased longevity due to decreased Myc expression. In this regard, the manuscript could be further enriched by examining whether mTOR signaling is decreased in the super-enhancer Myc mutant tissues or cells. 3) The authors build upon their previous work in which they showed elegantly that a 1.7 kb region containing a SNP in a TCF binding site 335 kb upstream of the MYC TSS is associated with slightly higher levels of Myc, and that these slightly higher Myc levels considerably enhance tumorigenesis. The reduced susceptibility to tumorigenesis of the 2-540 deletion is an interesting observation, but it would be nice to include some sort of assurance that the effects are not mediated solely through the 335 region that has already been reported and characterized by the authors (and others) and shown confer resistance to tumor formation when deleted in Apc mice. Are DMBA/MPA induced mammary tumors influenced by the 335-region deletion or are separate segments of the 2-540 region involved? 4) The authors are a bit loose with the term super-enhancer (1, 2). The labeling and characterization of the 2-540 kb deleted region as a super-enhancer, especially under physiological conditions is quite questionable. All of the literature on Myc and its surrounding gene desert indicates that super-enhancer commissioning seems to be a pathological and not physiological event, often associated with translocations that juxtapose super-enhancers from far-distant regions, usually on other chromosomes (3-5). It seems to be a bit premature to define 0.5 megabases as a super-enhancer. This is quite large, even for a super-enhancer and the authors have performed no functional experiments or computational analysis to discriminate this region as a super-enhancer versus a collection of typical enhancers that each may act independently to mediate the actions of different signaling systems and factors (for example estrogen) (6). The only indication in human cells that there is a potential native super-enhancer in this region that may be commissioned in pancreatic cancer or colon cancer is that of Hnisz et al., but data in these same papers suggest that this region is not normally a super-enhancer. 5) The increased expression of Myc in splenic B-cells deleted of 2-540 suggests that this region does not act a purely as an enhancer, but rather that there must be tissue specific negative cis-region(s) interposed amongst the positive acting sequences. The authors should examine chromatin marks, DHS sites etc. as well as the 2-367 B-cells to see if they might learn anything about the nature of the B-cell repressive region. In any case, these results argue against this being a huge, monotonically positive acting super-enhancer. 6) Does the whole "super-enhancer" region act as a single unit or do different regions show a proclivity to act in different tissues? Do the 2-540 and 2-367 deletions behave similarly with respect to tumorigenesis and to carcinogens across different tissues? 7) The authors state that they see no effect of the 2-540 deletion on expression other in tumors and in splenic B-cells. The authors should study carefully the recent eLife paper by Lorenzin et al. (7) and then reexamine their own Figure 5. Lorenzin et al. report that maneuvers that decrease MYC lead to preferential decrease in expression of the most highly expressed genes that are most easily saturated with MYC. Note that in Figure 5A left-colon that the blue dots almost all fall below the diagonal of identity for the most highly expressed genes just as would be expected if Myc acts according to Lorenzin. Lorenzin et al. also report that as the promoters of the most highly expressed genes increases further, the excess MYC progressively backfills the promoters of more weakly expressed genes thus augmenting the output of middle level expressed genes. Note that in Figure 5A left spleen, that the green dots bulge above the diagonal in the middle region, again just as explained by Lorenzin et al. and in accord with the amplifier model of MYC action. Thus, it seems that low levels of Myc are not inert, but that the cellular systems are robust enough to handle the changes in Myc under these conditions. 8) The authors assert that there are no phenotypic consequences of lowering Myc. They cite the paper of Dubois et al. (8) that Myc expression is only essential in the placenta, but not in the epiblast (embryo proper) except when the embryos die a couple of days later at E11.5 from a failure of hematopoietic stem cells; when the embryos die all other tissues appeared normal for their stage of development-however almost half of gestation remained to be completed and there is nothing in the Dubois paper to indicate that growth and maturation of all remaining tissues proceeds normally through gestation and after birth. Many studies have found phenotypes associated with decreased levels of Myc. Trumpp et al. (9) constructed an allelic series that clearly showed that habitus size changes according to the amount of Myc. In light of this, the authors need to conduct some careful measurements of animal and organ weight, size and cell numbers to substantiate their claim that there is no phenotype. A superficial perusal of the thoracic and abdominal contents might miss subtle changes. What about limb length-limb size that has been reported to be influenced by Myc? 9) Very significantly, the authors' conclusions about Myc acting digitally off-on by weak versus strong expression to buffer its effects, is at odds with a large and significant literature that says that small changes in MYC are sometimes very physiologically significant apart from tumors, and that even very low levels of MYC may be important (for example fibroblasts may survive with low MYC, but they do not survive without MYC (see the work of Sedivy, etc.). It is also at odds with reports describing haploinsufficiency of Myc. Unlike normal fibroblasts, fibroblasts haploinsufficient for MYC cannot be immortalized by expression of hTERT (10). Mice haploinsufficient for Myc live longer and are smaller (9, 11). While Myc is dispensable for hepatocytes (12, 13), a bit of Myc seems to be required for colonic crypt cells (14). Less than two-fold differences in MYC expression (up or down) provoke super-competition in which the cells with more MYC kill and replace the cells with less MYC (in flies and in mice) (15, 16). Slight differential changes in Myc modify the temporal profile of the immune response (17). There are many more examples. Small differences in MYC seem to be associated with many, sometimes subtle, manifestations making it difficult to accept the digital interpretation proposed by the authors. 1) Pott S, Lieb JD: What are super-enhancers? Nature genetics 2015, 47:8-12. 2) Whyte WA, Orlando DA, Hnisz D, Abraham BJ, Lin CY, Kagey MH, Rahl PB, Lee TI, Young RA: Master transcription factors and mediator establish super-enhancers at key cell identity genes. Cell 2013, 153:307-19. 3) Hnisz D, Abraham BJ, Lee TI, Lau A, Saint-Andre V, Sigova AA, Hoke HA, Young RA: Super-enhancers in the control of cell identity and disease. Cell 2013, 155:934-47. 4) Hnisz D, Schuijers J, Lin CY, Weintraub AS, Abraham BJ, Lee TI, Bradner JE, Young RA: Convergence of developmental and oncogenic signaling pathways at transcriptional super-enhancers. Molecular cell 2015, 58:362-70. 5) Loven J, Hoke HA, Lin CY, Lau A, Orlando DA, Vakoc CR, Bradner JE, Lee TI, Young RA: Selective inhibition of tumor oncogenes by disruption of super-enhancers. Cell 2013, 153:320-34. 6) Wang C, Mayer JA, Mazumdar A, Fertuck K, Kim H, Brown M, Brown PH: Estrogen induces c-myc gene expression via an upstream enhancer activated by the estrogen receptor and the AP-1 transcription factor. Molecular endocrinology (Baltimore, Md) 2011, 25:1527-38. 7) Lorenzin F, Benary U, Baluapuri A, Walz S, Jung LA, von Eyss B, Kisker C, Wolf J, Eilers M, Wolf E: Different promoter affinities account for specificity in MYC-dependent gene regulation. eLife 2016, 5. 8) Dubois NC, Adolphe C, Ehninger A, Wang RA, Robertson EJ, Trumpp A: Placental rescue reveals a sole requirement for c-Myc in embryonic erythroblast survival and hematopoietic stem cell function. Development (Cambridge, England) 2008, 135:2455-65. 9) Trumpp A, Refaeli Y, Oskarsson T, Gasser S, Murphy M, Martin GR, Bishop JM: c-Myc regulates mammalian body size by controlling cell number but not cell size. Nature 2001, 414:768-73. 10) Guney I, Wu S, Sedivy JM: Reduced c-Myc signaling triggers telomere-independent senescence by regulating Bmi-1 and p16(INK4a). Proceedings of the National Academy of Sciences of the United States of America 2006, 103:3645-50. 11) Hofmann JW, Zhao X, De Cecco M, Peterson AL, Pagliaroli L, Manivannan J, Hubbard GB, Ikeno Y, Zhang Y, Feng B, Li X, Serre T, Qi W, Van Remmen H, Miller RA, Bath KG, de Cabo R, Xu H, Neretti N, Sedivy JM: Reduced expression of MYC increases longevity and enhances healthspan. Cell 2015, 160:477-88. 12) Sanders JA, Schorl C, Patel A, Sedivy JM, Gruppuso PA: Postnatal liver growth and regeneration are independent of c-myc in a mouse model of conditional hepatic c-myc deletion. BMC physiology 2012, 12:1. 13) Li F, Xiang Y, Potter J, Dinavahi R, Dang CV, Lee LA: Conditional deletion of c-myc does not impair liver regeneration. Cancer research 2006, 66:5608-12. 14) Muncan V, Sansom OJ, Tertoolen L, Phesse TJ, Begthel H, Sancho E, Cole AM, Gregorieff A, de Alboran IM, Clevers H, Clarke AR: Rapid loss of intestinal crypts upon conditional deletion of the Wnt/Tcf-4 target gene c-Myc. Molecular and cellular biology 2006, 26:8418-26. 15) Claveria C, Giovinazzo G, Sierra R, Torres M: Myc-driven endogenous cell competition in the early mammalian embryo. Nature 2013, 500:39-44. 16) Johnston LA: Socializing with MYC: cell competition in development and as a model for premalignant cancer. Cold Spring Harbor perspectives in medicine 2014, 4:a014274. 17) Heinzel S, Binh Giang T, Kan A, Marchingo JM, Lye BK, Corcoran LM, Hodgkin PD: A Myc-dependent division timer complements a cell-death timer to regulate T cell and B cell responses. Nature immunology 2017, 18:96-103. Essential revisions: 1) The authors construed from these observations that "the MYC/MAX/MNT system that drives cell growth and proliferation is robustly set to an off state in normal homeostasis, whereas in cancer, the system is locked into a pathological on state." This statement in the last paragraph of the Discussion section is not supported by the evidence, given that the authors have not fully studied normal cellular physiology. Myc expression under normal physiological conditions could vary according to signaling and hence the concept of an 'on versus off' state seems over-simplified. For example, Heinzel et al. (Nature Immunol 18:96-104 (2017); see reference 17 below) demonstrated that Myc expression dose effect is influenced by input signals into T cell activation. In this regard, the authors should document whether normal T cell activation is altered in the mutant Myc animals. We agree with the reviewer that Myc is important in immune cells, but would like to maintain a distinction between normal homeostasis and pathological states in the manuscript. We have included additional data in Figure 2—figure supplement 1 showing the lack of a genotype-dependent effect on T-cell number in these mice. We also do not expect T-cell activation to be strongly affected, as enhancers active in T-cells are on the other side of the Myc ORF (Herranz et al. 2014), and the mice are healthy and do not display an immunodeficient phenotype. We have now clarified this (subsection “Loss of the super-enhancer region leads to tissue-specific changes in Myc expression”, second paragraph). To further clarify the manuscript, we have also now made it clearer that T-cell activation occurs generally under pathological conditions and does not fit under our definition of "normal cellular homeostasis" (Discussion, sixth paragraph). As the distinction between normal conditions in laboratory mice, and pathological conditions is central to the manuscript, in our view it would still be very important to clarify this point. We have also now added a paragraph to the Discussion section to discuss the various pathological conditions where Myc is clearly involved, and now state that it will be important to assess the role of the 538 kb region in these processes in future studies. We feel that a detailed study of T-cell activation kinetics is beyond the scope of the current work. However, if such an experiment is essential for publication, we can run the experiment and provide the data. Given that our mouse facility is moving, it would delay publication approximately 6 months. 2) The Myc heterozygotes (Sedivy and coworkers: Hofmann et al. Cell 2015) have increased longevity. It stands to reason that the Myc super-enhancer mutant may also have increased longevity due to decreased Myc expression. In this regard, the manuscript could be further enriched by examining whether mTOR signaling is decreased in the super-enhancer Myc mutant tissues or cells. We agree that the finding of Myc contributing to longevity is interesting, and we are aware that Hoffman et al. showed the reduction in age related symptoms in Myc mice. However, the deletion of a super-enhancer region that contains tissue-specific enhancers regulating Myc expression in our model is not equivalent to a heterozygous deletion of the Myc gene in the whole mouse body. So we expect that the effect of the enhancer deletion on longevity, if any, to be tissue specific or minor. To detect an effect on longevity would require a large cohort of mice as well as ethical permits to age the mice, which we cannot obtain in Sweden (we have to sacrifice mice that are old or sick). The analysis would also take 2-3 years. Thus, analysis of longevity is not feasible within the scope of the present study. As the effects of the enhancer deletion are tissue-specific, molecular analysis in the absence of phenotypic data would not be informative. To address this point, we have added a sentence to the Discussion section citing the Hofmann et al. paper and pointing out that the mouse could be used as a model to study which tissues contribute to the longevity phenotype (Discussion, fourth paragraph). 3) The authors build upon their previous work in which they showed elegantly that a 1.7 kb region containing a SNP in a TCF binding site 335 kb upstream of the MYC TSS is associated with slightly higher levels of Myc, and that these slightly higher Myc levels considerably enhance tumorigenesis. The reduced susceptibility to tumorigenesis of the 2-540 deletion is an interesting observation, but it would be nice to include some sort of assurance that the effects are not mediated solely through the 335 region that has already been reported and characterized by the authors (and others) and shown confer resistance to tumor formation when deleted in APC We agree that it is important to analyze whether the effects of the large deletion are solely due to the Myc-335 region. We have now included additional discussion and data to show that this is not the case. The large region deleted in this mouse model contains several tissue-specific enhancers in addition to the Myc-335 (Tuupanen et al. 2009; Ahmadiyeh et al. 2010); this is clarified in the fourth paragraph of the Introduction. In addition, the breast cancer susceptibility locus in humans is distinct from the colon cancer susceptibility locus that harbors Myc-335, and there is thus no reason to expect that Myc-335 would contribute to breast cancer. This is now stated in the first paragraph of the subsection “The Myc super-enhancer region is required for tumorigenesis in mice”. Although we cannot rule out the possibility at this time that Myc-335 contributes to the DMBA/MPA induced mammary tumors, additional elements outside of the Myc-335 region are definitely also playing a role in tumor models. We have now included data to show that the 2-540 region deletion in an Apc background results in fewer polyps than the Myc-335 deletion alone (new Figure 6B). In this study the wild-type mice had on an average 56 polyps at around 4 months of age (n=5) when they had to be euthanized for ethical reasons similar to what we reported previously. The mice with the 2-540 deletion looked healthy and had on an average 2.4 polyps even at 6 months of age (n=5) compared to an average of 14.33 polyps we reported for the Myc-335 null mice at 4 months of age. These results are consistent with multiple Tcf7l2 ChIP-seq peaks that are observed in the colon within this region (Figure 2). This data is now shown in Figure 6B, and the results are discussed in the second paragraph of the subsection “The Myc super-enhancer region is required for tumorigenesis in mice”. 4) The authors are a bit loose with the term super-enhancer (1, 2). The labeling and characterization of the 2-540 kb deleted region as a super-enhancer, especially under physiological conditions is quite questionable. All of the literature on Myc and its surrounding gene desert indicates that super-enhancer commissioning seems to be a pathological and not physiological event, often associated with translocations that juxtapose super-enhancers from far-distant regions, usually on other chromosomes (3-5). It seems to be a bit premature to define 0.5 megabases as a super-enhancer. This is quite large, even for a super-enhancer and the authors have performed no functional experiments or computational analysis to discriminate this region as a super-enhancer versus a collection of typical enhancers that each may act independently to mediate the actions of different signaling systems and factors (for example estrogen) (6). The only indication in human cells that there is a potential native super-enhancer in this region that may be commissioned in pancreatic cancer or colon cancer is that of Hnisz et al., but data in these same papers suggest that this region is not normally a super-enhancer. We agree that the term super-enhancer is somewhat controversial, and that the precise boundaries of presumed regulatory regions vary in different cell types and under different conditions. The region deleted in this study contains several cancer susceptibility loci and some of these have been linked to the presence of tissue-specific enhancers active in cancer cells. As the reviewer points out, in most cases the enhancers or super-enhancers identified within this region appear to be very tumor specific (Ahmadiyeh et al. 2010; Hnisz et al. 2013; Loven et al. 2013). This suggests that they regulate Myc under pathological condition without affecting the proliferation/ homeostasis of normal cells. Our results confirm this idea. Since this region contains several tissue-specific and cancer-specific regulatory elements that fall both under the definition of enhancers and super-enhancers we have referred to the deleted region as the "super-enhancer region" (not "super-enhancer"). We have now clarified this definition in the Introduction (last paragraph). 5) The increased expression of Myc in splenic B-cells deleted of 2-540 suggests that this region does not act a purely as an enhancer, but rather that there must be tissue specific negative cis-region(s) interposed amongst the positive acting sequences. The authors should examine chromatin marks, DHS sites etc. as well as the 2-367 B-cells to see if they might learn anything about the nature of the B-cell repressive region. In any case, these results argue against this being a huge, monotonically positive acting super-enhancer. We agree that increased Myc expression in the splenic B-cells can suggest the presence of a negative cis-region. However, a more likely possibility is that the deletion of 538 kb brings an enhancer outside of this region closer to the Myc promoter. This is because a known B-cell specific enhancer at -556 has been described as the target for EBNA2 mediated large-scale directional reorganization of Myc promoter-enhancer interactions (Wood et al. 2016). We have now discussed this issue (subsection “Loss of the super-enhancer region leads to tissue-specific changes in Myc expression”, third paragraph and in legend for Figure 2—figure supplement 1), and included chromatin analysis of wild-type mouse B-cells in the revised version that show the enhancers in the region that is retained in the deletion (new Figure 2—figure supplement 1). 6) Does the whole "super-enhancer" region act as a single unit or do different regions show a proclivity to act in different tissues? Do the 2-540 and 2-367 deletions behave similarly with respect to tumorigenesis and to carcinogens across different tissues? Several studies have shown that this region contains enhancers that act in a tissue-specific manner and that the different cancer susceptibilities span distinct segments of this region. The data presented in this manuscript also shows that the active enhancer marks span different regions in different tissues/cells (see colon vs. fibroblast ChIP-seq data). We do not think that the whole super-enhancer acts as a single unit, rather specific sub-regions regulate MYC in a tissue-specific manner. We have now clarified this in the revised version (Introduction, last paragraph). 7) The authors state that they see no effect of the 2-540 deletion on expression other in tumors and in splenic B-cells. The authors should study carefully the recent eLife paper by Lorenzin et al. (7) and then reexamine their own We agree that in cultured cells Myc is active. Lorenzin et al. nicely showed that due to differences in the MYC affinity to promoters, genes differ in their response to MYC levels. We can clarify that the more detailed model proposed by Lorenzin et al. and our model are not mutually exclusive. The `off-state´ of Myc under resting physiological conditions in our model is lower than that found in cultured cells by Lorenzin et al. That is why we see little effect on target gene expression due to further downregulation of Myc. To address this point we compared wild-type and 2-540 null FPKM values for gene sets from Lorenzin et al. paper in our colon and spleen RNA-seq data. We did not find differences in either the high-affinity binding or the low-affinity binding gene sets. We also plotted the median FPKM values of gene transcripts for the colon data since one of the wild-type samples for unknown reason had higher amounts of ribosomal structural protein transcripts. This is now included as new Figure 5—figure supplement 1. In addition, we have added an intermediate state to the model, and also discuss the responses of low affinity and high affinity targets (Discussion, sixth paragraph). 8) The authors assert that there are no phenotypic consequences of lowering Myc. They cite the paper of Dubois et al. (8) that Myc expression is only essential in the placenta, but not in the epiblast (embryo proper) except when the embryos die a couple of days later at E11.5 from a failure of hematopoietic stem cells; when the embryos die all other tissues appeared normal for their stage of development-however almost half of gestation remained to be completed and there is nothing in the Dubois paper to indicate that growth and maturation of all remaining tissues proceeds normally through gestation and after birth. Many studies have found phenotypes associated with decreased levels of Myc. Trumpp et al. (9) constructed an allelic series that clearly showed that habitus size changes according to the amount of Myc. In light of this, the authors need to conduct some careful measurements of animal and organ weight, size and cell numbers to substantiate their claim that there is no phenotype. A superficial perusal of the thoracic and abdominal contents might miss subtle changes. What about limb length-limb size that has been reported to be influenced by Myc? We agree that Trumpp et al. correlated a reduced body size and weight with decreased Myc levels. However the paper by Duboiset al. found no effect on the size of embryos lacking Myc thus attributing the effect on the weight/ body size to the placental requirement of Myc. We agree with the reviewer that in the study by Dubois et al. nearly half of the gestation stage is still remaining and could result in smaller weight or size. Heterozygous mice in the study by Trumpp et al. had on an average a reduction of 18-22% in body mass and were visibly distinguishable from the wild-type littermates. We have now clarified that we cannot see visible size differences of 2-540 null mice, and do not detect a significant weight difference in our mouse colony based on 17 wild-type and 15 null mice (Discussion, third paragraph). We have also now explained that since we are deleting very tissue specific enhancers as opposed to the Myc gene deletion, we do not expect striking difference on the body weight or size. Detection of any more subtle changes in body weight or organ size would require a large cohort of mice and even if such effects were found, they would not materially affect the main point of the manuscript. Regarding the tissues we focused on prostate, intestine, spleen, mammary gland and bladder based on the cancer susceptibility loci identified within this region. Histological examination of these tissues does not show morphological defects. We have found that the total number of spleen cells are reduced which could be due to the decreased number of B-cells shown in the manuscript. We have now included this data in the revised version (legend to Figure 2—figure supplement 1). We have also now added an explicit sentence to the Discussion stating that we do not claim that the mice have "no phenotype", but rather that there is "no overt phenotype" that affects the viability or fertility of the mice under laboratory conditions (Discussion, sixth paragraph). 9) Very significantly, the authors' conclusions about Myc acting digitally off-on by weak versus strong expression to buffer its effects, is at odds with a large and significant literature that says that small changes in MYC are sometimes very physiologically significant apart from tumors, and that even very low levels of MYC may be important (for example fibroblasts may survive with low MYC, but they do not survive without MYC (see the work of Sedivy, etc.). It is also at odds with reports describing haploinsufficiency of Myc. Unlike normal fibroblasts, fibroblasts haploinsufficient for MYC cannot be immortalized by expression of hTERT (10). Mice haploinsufficient for Myc live longer and are smaller (9, 11). While Myc is dispensable for hepatocytes (12, 13), a bit of Myc seems to be required for colonic crypt cells (14). Less than two-fold differences in MYC expression (up or down) provoke super-competition in which the cells with more MYC kill and replace the cells with less MYC (in flies and in mice) (15, 16). Slight differential changes in Myc modify the temporal profile of the immune response (17). There are many more examples. Small differences in MYC seem to be associated with many, sometimes subtle, manifestations making it difficult to accept the digital interpretation proposed by the authors. We agree with the reviewer that Myc is required for several aspects of the embryonic development in mice, and in the adult hematopoietic system (e.g. (Wilson et al. 2004)) and in cultured cells. Myc heterozygous mice are also smaller, from birth to adulthood, presumably due to the effect on placenta or embryonic development. We have now included more discussion of these phenotypes in the revised version (Discussion, third paragraph). However, several studies have documented that loss of Myc appears to have little effect on normal tissue homeostasis of most adult tissues in vivo. In the skin, loss of Myc under normal conditions is well tolerated in vivo while keratinocytes with a Myc deletion exhibit reduced proliferation in vitro (Oskarsson et al. 2006). In the case of the intestine where Myc is expressed in the proliferating crypts, there are conflicting reports. Although Muncan et al. (2006) showed the loss of Myc null crypts in their study, a parallel study (Bettess et al. 2005) showed that the proliferation and maintenance of the adult crypts was not dependent on Myc expression. To add to the confusion, in Sansom et al. (2007) some of the authors of the Muncan et al. paper cite their own work as evidence of "remarkably little effect of [Myc] gene deletion on intestinal proliferation". Thus, it appears that the matter is controversial. We have not detected prominent defects associated with the 2-540 null genotype in the intestine. We think this is not surprising given that proliferation in vivo can occur in the absence / reduced levels of Myc (discussed above) and that we have a tissue-specific effect on the Myc regulation. In addition, in our model we do not see any prominent Myc-associated phenotypes that have been previously reported e.g. in the haematopoietic system which is consistent with the fact that enhancers regulating the hematological malignancies or normal immune cell function have been identified around 1 Mb downstream of Myc gene and not included in our deletions (Herranz et al. 2014). We have now addressed the literature on Myc by citing the relevant references, and pointing out that the results are in some cases conflicting, but overall it is clear that Myc is critical in tumors, and required for growth of cultured cells and during some developmental processes (Discussion, third and sixth paragraphs). In our mice, we do not see major effects, which could theoretically be due to the remaining Myc levels, but more likely caused by the tissue-specific role of the region that was deleted. This is now stated in the aforementioned paragraph. We have also modified the model to cite the previous papers and to clarify that Myc levels also matter, and that the "on" and "off" states as depicted in the original model do not explain some developmental phenotypes or quantitative regulation of immune cell responses (as in Heinzel et al). We have added an "intermediate Myc level" panel to the model to address this, and to clarify that the two extreme states are relevant to "cancer", and to "normal physiological conditions in adult tissue homeostasis in the absence of tissue damage or infection" (Discussion, sixth paragraph and Figure 7).
  67 in total

1.  The common colorectal cancer predisposition SNP rs6983267 at chromosome 8q24 confers potential to enhanced Wnt signaling.

Authors:  Sari Tuupanen; Mikko Turunen; Rainer Lehtonen; Outi Hallikas; Sakari Vanharanta; Teemu Kivioja; Mikael Björklund; Gonghong Wei; Jian Yan; Iina Niittymäki; Jukka-Pekka Mecklin; Heikki Järvinen; Ari Ristimäki; Mariachiara Di-Bernardo; Phil East; Luis Carvajal-Carmona; Richard S Houlston; Ian Tomlinson; Kimmo Palin; Esko Ukkonen; Auli Karhu; Jussi Taipale; Lauri A Aaltonen
Journal:  Nat Genet       Date:  2009-06-28       Impact factor: 38.330

2.  Epstein-Barr virus oncoprotein super-enhancers control B cell growth.

Authors:  Hufeng Zhou; Stefanie C S Schmidt; Sizun Jiang; Bradford Willox; Katharina Bernhardt; Jun Liang; Eric C Johannsen; Peter Kharchenko; Benjamin E Gewurz; Elliott Kieff; Bo Zhao
Journal:  Cell Host Microbe       Date:  2015-01-29       Impact factor: 21.023

3.  Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks.

Authors:  Cole Trapnell; Adam Roberts; Loyal Goff; Geo Pertea; Daehwan Kim; David R Kelley; Harold Pimentel; Steven L Salzberg; John L Rinn; Lior Pachter
Journal:  Nat Protoc       Date:  2012-03-01       Impact factor: 13.491

Review 4.  MYC in oncogenesis and as a target for cancer therapies.

Authors:  Ami Albihn; John Inge Johnsen; Marie Arsenian Henriksson
Journal:  Adv Cancer Res       Date:  2010       Impact factor: 6.242

5.  c-MYC induces mammary tumorigenesis by means of a preferred pathway involving spontaneous Kras2 mutations.

Authors:  C M D'Cruz; E J Gunther; R B Boxer; J L Hartman; L Sintasath; S E Moody; J D Cox; S I Ha; G K Belka; A Golant; R D Cardiff; L A Chodosh
Journal:  Nat Med       Date:  2001-02       Impact factor: 53.440

6.  Toward simpler and faster genome-wide mutagenesis in mice.

Authors:  Sen Wu; Guoxin Ying; Qiang Wu; Mario R Capecchi
Journal:  Nat Genet       Date:  2007-06-17       Impact factor: 38.330

7.  Mice lacking a Myc enhancer that includes human SNP rs6983267 are resistant to intestinal tumors.

Authors:  Inderpreet Kaur Sur; Outi Hallikas; Anna Vähärautio; Jian Yan; Mikko Turunen; Martin Enge; Minna Taipale; Auli Karhu; Lauri A Aaltonen; Jussi Taipale
Journal:  Science       Date:  2012-11-01       Impact factor: 47.728

8.  Cell-type independent MYC target genes reveal a primordial signature involved in biomass accumulation.

Authors:  Hongkai Ji; George Wu; Xiangcan Zhan; Alexandra Nolan; Cheryl Koh; Angelo De Marzo; Hoang Mai Doan; Jinshui Fan; Christopher Cheadle; Mohammad Fallahi; John L Cleveland; Chi V Dang; Karen I Zeller
Journal:  PLoS One       Date:  2011-10-19       Impact factor: 3.240

9.  Fast and accurate short read alignment with Burrows-Wheeler transform.

Authors:  Heng Li; Richard Durbin
Journal:  Bioinformatics       Date:  2009-05-18       Impact factor: 6.937

10.  Identification of a new prostate cancer susceptibility locus on chromosome 8q24.

Authors:  Meredith Yeager; Nilanjan Chatterjee; Julia Ciampa; Kevin B Jacobs; Jesus Gonzalez-Bosquet; Richard B Hayes; Peter Kraft; Sholom Wacholder; Nick Orr; Sonja Berndt; Kai Yu; Amy Hutchinson; Zhaoming Wang; Laufey Amundadottir; Heather Spencer Feigelson; Michael J Thun; W Ryan Diver; Demetrius Albanes; Jarmo Virtamo; Stephanie Weinstein; Fredrick R Schumacher; Geraldine Cancel-Tassin; Olivier Cussenot; Antoine Valeri; Gerald L Andriole; E David Crawford; Christopher A Haiman; Brian Henderson; Laurence Kolonel; Loic Le Marchand; Afshan Siddiq; Elio Riboli; Timothy J Key; Rudolf Kaaks; William Isaacs; Sarah Isaacs; Kathleen E Wiley; Henrik Gronberg; Fredrik Wiklund; Pär Stattin; Jianfeng Xu; S Lilly Zheng; Jielin Sun; Lars J Vatten; Kristian Hveem; Merethe Kumle; Margaret Tucker; Daniela S Gerhard; Robert N Hoover; Joseph F Fraumeni; David J Hunter; Gilles Thomas; Stephen J Chanock
Journal:  Nat Genet       Date:  2009-09-20       Impact factor: 38.330

View more
  24 in total

1.  Using Gene Expression Profiling to Move Beyond MYC/BCL2 Rearrangements in High-Grade Lymphoma.

Authors:  Wing C Chan
Journal:  J Clin Oncol       Date:  2018-12-03       Impact factor: 44.544

Review 2.  Dissecting Tissue-Specific Super-Enhancers by Integrating Genome-Wide Analyses and CRISPR/Cas9 Genome Editing.

Authors:  Kyung Hyun Yoo; Lothar Hennighausen; Ha Youn Shin
Journal:  J Mammary Gland Biol Neoplasia       Date:  2018-10-06       Impact factor: 2.673

3.  Controlling gene activation by enhancers through a drug-inducible topological insulator.

Authors:  Taro Tsujimura; Osamu Takase; Masahiro Yoshikawa; Etsuko Sano; Matsuhiko Hayashi; Kazuto Hoshi; Tsuyoshi Takato; Atsushi Toyoda; Hideyuki Okano; Keiichi Hishikawa
Journal:  Elife       Date:  2020-05-05       Impact factor: 8.140

4.  Super enhancers - new analyses and perspectives on the low hanging fruit.

Authors:  Feda H Hamdan; Steven A Johnsen
Journal:  Transcription       Date:  2017-11-03

Review 5.  The MYC Enhancer-ome: Long-Range Transcriptional Regulation of MYC in Cancer.

Authors:  Olga Lancho; Daniel Herranz
Journal:  Trends Cancer       Date:  2018-11-02

Review 6.  Programmable RNA-Guided Large DNA Transgenesis by CRISPR/Cas9 and Site-Specific Integrase Bxb1.

Authors:  Vishnu Hosur; Benjamin E Low; Michael V Wiles
Journal:  Front Bioeng Biotechnol       Date:  2022-07-05

7.  Cell Specificity of Human Regulatory Annotations and Their Genetic Effects on Gene Expression.

Authors:  Arushi Varshney; Hadley VanRenterghem; Peter Orchard; Alan P Boyle; Michael L Stitzel; Duygu Ucar; Stephen C J Parker
Journal:  Genetics       Date:  2018-12-28       Impact factor: 4.562

Review 8.  Enhancer rewiring in tumors: an opportunity for therapeutic intervention.

Authors:  Laia Richart; François-Clément Bidard; Raphaël Margueron
Journal:  Oncogene       Date:  2021-05-01       Impact factor: 9.867

9.  Mutational inactivation of Apc in the intestinal epithelia compromises cellular organisation.

Authors:  Helena Rannikmae; Samantha Peel; Simon Barry; Takao Senda; Marc de la Roche
Journal:  J Cell Sci       Date:  2021-01-27       Impact factor: 5.285

Review 10.  Super-enhancer-mediated core regulatory circuitry in human cancer.

Authors:  Yuan Jiang; Yan-Yi Jiang; De-Chen Lin
Journal:  Comput Struct Biotechnol J       Date:  2021-05-05       Impact factor: 7.271

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.