Literature DB >> 28569150

Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system.

Hye-Rim Pyeon1, Hee-Ju Nah1, Seung-Hoon Kang1, Si-Sun Choi1, Eung-Soo Kim2.   

Abstract

BACKGROUND: Heterologous expression of biosynthetic gene clusters of natural microbial products has become an essential strategy for titer improvement and pathway engineering of various potentially-valuable natural products. A Streptomyces artificial chromosomal conjugation vector, pSBAC, was previously successfully applied for precise cloning and tandem integration of a large polyketide tautomycetin (TMC) biosynthetic gene cluster (Nah et al. in Microb Cell Fact 14(1):1, 2015), implying that this strategy could be employed to develop a custom overexpression scheme of natural product pathway clusters present in actinomycetes.
RESULTS: To validate the pSBAC system as a generally-applicable heterologous overexpression system for a large-sized polyketide biosynthetic gene cluster in Streptomyces, another model polyketide compound, the pikromycin biosynthetic gene cluster, was preciously cloned and heterologously expressed using the pSBAC system. A unique HindIII restriction site was precisely inserted at one of the border regions of the pikromycin biosynthetic gene cluster within the chromosome of Streptomyces venezuelae, followed by site-specific recombination of pSBAC into the flanking region of the pikromycin gene cluster. Unlike the previous cloning process, one HindIII site integration step was skipped through pSBAC modification. pPik001, a pSBAC containing the pikromycin biosynthetic gene cluster, was directly introduced into two heterologous hosts, Streptomyces lividans and Streptomyces coelicolor, resulting in the production of 10-deoxymethynolide, a major pikromycin derivative. When two entire pikromycin biosynthetic gene clusters were tandemly introduced into the S. lividans chromosome, overproduction of 10-deoxymethynolide and the presence of pikromycin, which was previously not detected, were both confirmed. Moreover, comparative qRT-PCR results confirmed that the transcription of pikromycin biosynthetic genes was significantly upregulated in S. lividans containing tandem clusters of pikromycin biosynthetic gene clusters.
CONCLUSIONS: The 60 kb pikromycin biosynthetic gene cluster was isolated in a single integration pSBAC vector. Introduction of the pikromycin biosynthetic gene cluster into the pikromycin non-producing strains resulted in higher pikromycin production. The utility of the pSBAC system as a precise cloning tool for large-sized biosynthetic gene clusters was verified through heterologous expression of the pikromycin biosynthetic gene cluster. Moreover, this pSBAC-driven heterologous expression strategy was confirmed to be an ideal approach for production of low and inconsistent natural products such as pikromycin in S. venezuelae, implying that this strategy could be employed for development of a custom overexpression scheme of natural product biosynthetic gene clusters in actinomycetes.

Entities:  

Keywords:  Heterologous expression; Pikromycin biosynthetic gene cluster; Streptomyces artificial chromosome

Mesh:

Substances:

Year:  2017        PMID: 28569150      PMCID: PMC5452415          DOI: 10.1186/s12934-017-0708-7

Source DB:  PubMed          Journal:  Microb Cell Fact        ISSN: 1475-2859            Impact factor:   5.328


Background

Microbial natural products including secondary metabolites produced by actinomycetes have been a major resource for new drug discovery and development because of their superior structural diversity and complexity [1]. Although identification of entire biosynthetic gene clusters has become relatively straightforward because of genome mining and next generation sequencing, some of the biosynthetic genes are derived from non-culturable organisms or from microorganisms that are not amenable to genetic manipulation and are therefore not easily expressed for target compound identification [2]. To overcome such intrinsic limitations and achieve functional expression of uncharacterized potentially-valuable natural product biosynthetic pathways, relatively well-characterized heterologous host expression strategies have been pursued. The cosmid/fosmid library system has been used extensively for several decades to enable heterologous expression of natural product biosynthetic gene clusters of actinomycetes [3-8]. Recently, several sophisticated heterologous expression approaches have been introduced, including the linear plus linear homologous recombination (LLHR) system [9], transformation-associated recombination (TAR) system [10] and Streptomyces bacterial artificial chromosome (pSBAC) system [11]. Specifically, Yamanaka et al. designed the TAR cloning vector, pCAP01, which consists of a yeast element, an Escherichia coli element, and an actinobacterial element. The marinopyrrole biosynthetic gene cluster (30 kb) and taromycin A biosynthetic gene cluster (67 kb) were captured by a TAR system using yeast recombination activity, then functionally expressed in Streptomyces coelicolor [10]. Although a TAR system might be suitable for cloning and expression of a large-sized cryptic gene cluster screened from actinomycetes genome mining, TAR cloning must be conducted in yeast before intergeneric conjugation into Streptomyces. Additionally, Yin et al. [12] cloned a large-sized salinomycin biosynthetic gene cluster by linear plus linear homologous recombination (LLHR) using the Red/ET system and successfully expressed it in S. coelicolor. However, because the efficiency of this system is low for a large cluster (>60 kb), the cluster should be divided for serial assembly. In addition, both TAR and LLHR systems were mediated by homologous recombination, so undesired recombination could appear. We previously successfully demonstrated that the pSBAC system is as an efficient heterologous expression system with site-specific restriction site insertion, recombinant pSBAC plasmid rescue, and E. coliStreptomyces intergeneric conjugation. Using this pSBAC system, we isolated a large-sized TMC biosynthetic gene cluster (80 kb) from Streptomyces sp. CK4412 and expressed it in both homologous and heterologous hosts [13]. Since the pSBAC cloning approach uses the plasmid rescue method, undesired recombination does not appear and overexpression of the target gene cluster is possible through simple antibiotic marker substitution. In this study, another large-sized polyketide pikromycin biosynthetic gene cluster, which was discovered in early 1950s and examined by many researchers for identification of the mechanism of polyketide elongation and their structural changes [14-16], was cloned and directly expressed in two different heterologous hosts using the pSBAC system. Moreover, tandem integration of the pikromycin cluster-containing pSBAC in Streptomyces lividans resulted in significantly enhanced productivities of both 10-deoxymethynolide and pikromycin, implying that this pSBAC system might be an efficient strategy for functional overexpression of the entire biosynthetic gene cluster of any potentially-valuable low-titer metabolite in actinomycetes.

Results

Isolation of pikromycin biosynthetic gene cluster using the pSBAC system

There were only two examples of pSBAC-driven heterologous expression systems in Streptomyces, meridamycin (95 kb) and TMC (80 kb) biosynthetic gene clusters [11, 13]. While the entire meridamycin gene cluster was captured in a single pSBAC clone via straightforward restriction enzyme digestion because of the presence of unique restriction enzyme MfeI sites in border regions of the meridamycin biosynthetic gene cluster, unique XbaI restriction sites were precisely inserted at both border regions of the TMC biosynthetic gene cluster within the chromosome of Streptomyces sp. CK4412. Since the pikromycin biosynthetic gene cluster does not possess a unique restriction enzyme site in the borders like the TMC gene cluster, a unique restriction enzyme site was first inserted at the borders of the pikromycin gene cluster on the S. venezuelae ATCC 15439 chromosome. At one side of the pikromycin biosynthetic gene cluster near pikRII, a HindIII restriction enzyme site was inserted into 150 bp upstream region from pikRII using PCR targeted gene insertion [17]. To accomplish this, pMSCpik311 containing an apramycin resistance gene, oriT and a HindIII restriction enzyme site was constructed in E. coli based on pSCpik311, the pikromycin border-containing cosmid. The modified cosmid was introduced into S. venezuelae ATCC 15439 by conjugation, followed by target sequence-specific recombination at the border of the pikromycin gene cluster (Fig. 1). The resulting ex-conjugants were selected with the antibiotic selection marker, and insertion of HindIII in the correct site was confirmed by PCR analysis and sequencing (Additional file 1: Figure S1). For the other side of the cluster, a HindIII restriction enzyme site in the multiple cloning site of pSBAC was used as a restriction enzyme site for plasmid rescue method in the vicinity of pikD. To integrate a pSBAC vector into the recombinant S. venezuelae ATCC 15439 chromosome, a gene cassette containing a segment of pikD and the kanamycin resistance gene was cloned into a pSA (pSBAC ΔattP-int ΦBT1) using the HindIII and EcoRI restriction enzyme sites. The resulting construct was named pSAPDK, then directly introduced into S. venezuelae ATCC15439. pSAPDK vector was integrated into the border near pikD through homologous recombination, and integration of pSAPDK was confirmed by PCR analysis (Additional file 1: Figure S1). HindIII-digested total chromosomal DNA fractions were self-ligated, after which they were transformed into E. coli cells. Transformed strains were selected using apramycin and kanamycin antibiotics and then confirmed by PCR, enzyme mapping, and sequencing (Additional file 2: Figure S2). Finally, the DNA fragment containing attP-int ФBT1 was re-introduced into the rescued recombinant pSBAC vector and named pPik001 (Fig. 1).
Fig. 1

a Map of pSBAC. Essential components of the vector are indicated. Ori2 and oriV, replication origins; sopA-C, partitioning system; apr , apramycin resistance gene; oriT, origin of transfer; attP-int ΦBT1, integration system; unique restriction enzyme recognition sites, EcoRI, BamHI and HindIII. b Composition of pikromycin biosynthetic gene cluster. pikAI-V, polyketide synthesis; desI-VIII, desosamine sugar synthesis; pikC, hydroxylation; pikD, regulation; pikRI-II, resistance. c Schematic description of pPik001 construction. One of HindIII recognition sites was introduced into the 150 bp upstream of pikRII and another HindIII recognition site was integrated next to pikD in pSAPDK. The pikromycin biosynthetic gene cluster was isolated by HindIII digestion of the modified chromosomal DNA and its self-ligation, then named pPik. After construction of pPik, a DNA fragment containing attP-int ΦBT1 was inserted into the AvrII recognition site of pPik to generate pPik001

a Map of pSBAC. Essential components of the vector are indicated. Ori2 and oriV, replication origins; sopA-C, partitioning system; apr , apramycin resistance gene; oriT, origin of transfer; attP-int ΦBT1, integration system; unique restriction enzyme recognition sites, EcoRI, BamHI and HindIII. b Composition of pikromycin biosynthetic gene cluster. pikAI-V, polyketide synthesis; desI-VIII, desosamine sugar synthesis; pikC, hydroxylation; pikD, regulation; pikRI-II, resistance. c Schematic description of pPik001 construction. One of HindIII recognition sites was introduced into the 150 bp upstream of pikRII and another HindIII recognition site was integrated next to pikD in pSAPDK. The pikromycin biosynthetic gene cluster was isolated by HindIII digestion of the modified chromosomal DNA and its self-ligation, then named pPik. After construction of pPik, a DNA fragment containing attP-int ΦBT1 was inserted into the AvrII recognition site of pPik to generate pPik001

Heterologous expression of pikromycin biosynthetic gene cluster in Streptomyces strains

To confirm expression of the pikromycin biosynthetic gene cluster in pPik001, it was introduced into both S. lividans and S. coelicolor strains through conjugation, which generated S. lividans Pik101 and S. coelicolor Pik201, respectively. The constructed strains were cultured along with wild-type S. venezuelae ATCC 15439. Although pikromycin was not detected from wild-type or heterologous hosts, highly noticeable peaks showing identical retention times and spectra were detected in all three cultures (Fig. 3a, data not shown for S. coelicolor Pik201). The collected fraction of the peak was analyzed with high resolution LC/MS and confirmed to be 10-deoxymethynolide, a major pikromycin derivative released from module 5 in pikromycin biosynthetic gene cluster. The results of LC/MS also confirmed expression of the pikromycin biosynthetic gene cluster and that the yields of 10-deoxymethynolide in S. lividans Pik101 and S. coelicolor Pik201 were 346.8 and 396.2 mg/L, respectively. When the production yield of the heterologous hosts was compared with the wild-type, S. lividans Pik101 and S. coelicolor Pik201 exhibited 1.6-fold and 1.8-fold increases, respectively (Fig. 2), revealing that the pSBAC-driven heterologous expression of an entire pikromycin biosynthetic gene cluster resulted in enhanced production in both S. lividans and S. coelicolor.
Fig. 3

a HPLC profiles of S. venezuelae, S. lividans Pik102, S. lividans Pik101 and S. lividans: open circle, 10-deoxymethynolide; closed circle, pikromycin. b The production yield of pikromycin and 10-deoxymethynolide in S. venezuelae, S. lividans Pik101 and S. lividans Pik102. c The production yield of pikromycin and 10-deoxymethynolide in S. lividans Pik101 and S. lividans Pik102 for 4 days; open circle, S. lividans Pik101; closed circle, S. lividans Pik102

Fig. 2

Comparison of 10-deoxymethynolide production in S. venezuelae, S. lividans wild type, S. lividans Pik101, S. coelicolor wild type and S. coelicolor Pik201

Comparison of 10-deoxymethynolide production in S. venezuelae, S. lividans wild type, S. lividans Pik101, S. coelicolor wild type and S. coelicolor Pik201

Heterologous tandem integration of entire pikromycin cluster

To further stimulate pikromycin productivity, an additional copy of the pikromycin cluster was introduced into S. lividans Pik101 containing a single-copy of pikromycin. To introduce the second copy of the pikromycin gene cluster, the apramycin resistance gene in pPik001 was substituted with a hygromycin resistance gene and named pPik003. Next, pPik003 was introduced into S. lividans Pik101 through conjugation, after which the exconjugant was selected using both hygromycin and apramycin. Four exconjugants were randomly chosen to confirm the tandem integration by PCR amplification of attP-int primer sets. In all four selected colonies, the pPik003 was integrated into adjacent region of the pPik001 by homologous recombination. The resulting strain was named S. lividans Pik102. Although pikromycin was not detected in both S. venezuelae and S. lividans Pik101 as stated above, pikromycin production was observed in S. lividans Pik102 with the pikromycin yield of 333.7 mg/L (Fig. 3a). Moreover, the total production of pikromycin and 10-deoxymethynolide in S. lividans Pik102 (604.7 mg/L) showed a 2.1-fold increase compared to the production of only 10-deoxymethynolide in the parental wild-type strain (280 mg/L) (Fig. 3b). Additionally, the yield of S. lividans Pik102 was 1.2-fold higher than that of S. lividans Pik101. Production of the compounds in S. lividans Pik102 remained high until day 6 of culture, whereas production in S. lividans Pik101 gradually decreased from day 4 of culture (Fig. 3c). Comparative qRT-PCR results also confirmed that transcription of four biosynthetic genes (pikAI, pikC, desIII and desVI), as well as the pathway-specific regulatory gene pikD, was significantly stimulated in S. lividans Pik102 (Fig. 4). These findings imply that the presence of an additional copy of the entire pikromycin biosynthetic gene cluster was responsible for the increased transcription of pikromycin biosynthetic genes.
Fig. 4

Transcript analysis of pikromycin gene cluster expression. Circle, sample was taken on day 3; square, sample was taken on day 5; open circle and square, S. lividans Pik101; closed circle and square, S. lividans Pik102

a HPLC profiles of S. venezuelae, S. lividans Pik102, S. lividans Pik101 and S. lividans: open circle, 10-deoxymethynolide; closed circle, pikromycin. b The production yield of pikromycin and 10-deoxymethynolide in S. venezuelae, S. lividans Pik101 and S. lividans Pik102. c The production yield of pikromycin and 10-deoxymethynolide in S. lividans Pik101 and S. lividans Pik102 for 4 days; open circle, S. lividans Pik101; closed circle, S. lividans Pik102 Transcript analysis of pikromycin gene cluster expression. Circle, sample was taken on day 3; square, sample was taken on day 5; open circle and square, S. lividans Pik101; closed circle and square, S. lividans Pik102

Discussion

The E. coliStreptomyces shuttle vector, pSBAC, is an efficient tool that is capable of accepting and stably maintaining a large-sized natural product biosynthetic gene cluster [11]. Although we previously demonstrated an efficient strategy for giant plasmid rescue and tandem overexpression of a large-sized TMC biosynthetic gene cluster both in homologous and heterologous hosts [13], another example of a natural product biosynthetic gene cluster with different restriction enzyme site cloning was needed to be accepted as a general heterologous expression system in Streptomyces. Therefore, a pikromycin biosynthetic gene cluster was isolated using the pSBAC system as another example. The pikromycin biosynthetic gene cluster has some problems in that diverse derivatives were seen in a production culture, production varied in flasks and pikromycin production yield was quite low, making it difficult to detect. Because the pikromycin biosynthetic gene cluster was expressed in heterologous hosts, the production yield of 10-deoxymethynolide, one of pikromycin derivatives, was 1.6- and 1.8-fold of that of the parental wild-type host in S. lividans Pik101 and S. coelicolor Pik201, respectively. Moreover, pikromycin was detected in S. lividans Pik102, which has two copies of pikromycin biosynthetic gene cluster. These results suggest that a bottleneck exists in the pikromycin biosynthetic pathway that could be solved by introducing additional pikromycin biosynthetic genes. Expression of the pikromycin biosynthetic gene cluster was also confirmed through real-time RT-PCR at the transcriptional level. As expected, the level of transcripts of pikromycin biosynthetic genes in S. lividans Pik102 was higher than that in S. lividans Pik101 on both day 3 and 5. Although a significant gap in expression levels between S. lividans Pik101 and S. lividans Pik102 was shown, the compound yield in S. lividans Pik102 did not differ significantly from that of S. lividans Pik101. These findings suggest that the pikromycin gene cluster was amply transcribed, but that another bottleneck may exist in pikromycin production, such as a shortage of building blocks. In conclusion, the Streptomyces pSBAC-driven precise cloning and tandem integration approach described here can be applied to the versatile overexpression of large secondary metabolite gene clusters in actinomycetes, including novel cryptic clusters identified by genome mining.

Conclusions

Although actinomycetes have provided abundant sources for the development of new pharmaceuticals, their widespread application for this purpose is hindered by low productivity and difficult cultivation. Because many cryptic pathways have been found through genome mining, heterologous expression was suggested as a useful method for production of new pharmaceuticals. Development of an essential tool that can isolate, maintain, and express a large-sized gene cluster has emerged as a major point of interest. We previously demonstrated that the pSBAC system was an attractive genetic system for the efficient heterologous overexpression of a target cluster in Streptomyces species. However, the process for isolation of a biosynthetic gene cluster still requires a series of conjugation and selection steps. Here, we isolated the pikromycin biosynthetic gene cluster as a model pathway using the pSBAC system and simplified the process by eliminating one conjugation step using a HindIII restriction enzyme site in multiple cloning sites of pSBAC for plasmid rescue. Introduction of two copies of the pikromycin biosynthetic gene cluster into S. lividans was confirmed to stimulate the production of both 10-deoxymethynolide and pikromycin. Overall, the results of this study showed natural microbial products that are usually not produced or produced in very low amounts could be generated via overexpression of a biosynthetic gene cluster. This study confirms that the pSBAC system is a generally-applicable technology for the precise cloning and functional overexpression of the large-sized biosynthetic gene cluster of any potentially-valuable low-titer metabolites in actinomycetes.

Methods

Bacterial strains and culture media

The bacterial strains and plasmids used in this study were summarized in Table 1. E. coli strains were cultured in Luria–Bertani (LB) broth or on Luria–Bertani agar supplemented with appropriate antibiotics at 37 °C. For production of pikromycin and its derivatives, the original host, S. venezuelae, was grown in SGGP media for 1 day, then cultured for 3 days in SCM media at 30 °C [15]. Additionally, the model strains S. lividans and S. coelicolor were grown in TSB media for 2 days, then cultured for 5 days in R5 media at 30 °C [18]. Conjugation was carried out on modified ISP4 medium.
Table 1

Bacterial strains and plasmids used in this study

Strain/plasmidRelevant characteristicsSource/references
Plasmid
 pSBAC aacIII(IV), oriT, attP-int ΦBT1, backbone of pCC1BAC[11]
 pSAPDKModified pSBAC with deleted attP-int ΦBT1 and inserted Kan R and pikD fragmentThis work
 pPikpSAPDK with 60 kb DNA insert containing whole pik gene clusterThis work
 pPik001pPik with attP-int ΦBT1 This work
 pPik003pPik101, which replaced Hyg R with Apr R This work
E. coli
 EPI300F-mcrA-D (mrr-hsdRMS-mcrBC) trfA host for cloning and amplification of various BAC vectors and constructs derived from itEpicenter
 S17-1 E. coli host for transferring various plasmids into Streptomyces via conjugation
 ET12567/pUZ8002 E. coli host for transferring various plasmids into Streptomyces via conjugation
Streptomyces venezuelae
 ATCC 15439Original pikromycin-producing strain[15]
 15439-HindIIIBACATCC 15439 with pSAPDK and HindIII recognition sequences in a flanking region of pikromycin biosynthetic gene clusterThis work
Streptomyces lividans
 TK21Non pikromycin-producing strain
 Pik101TK21 with pPik001This work
 Pik102Pik101 with pPik003This work
Streptomyces coelicolor
 M145Non pikromycin-producing strain
 Pik201M145 with pPik001This work
Bacterial strains and plasmids used in this study

Insertion of unique HindIII recognition sequence into a flanking region of the pikromycin biosynthetic gene cluster

To isolate the pikromycin biosynthetic gene cluster, a unique HindIII recognition sequence was inserted into a flanking region of the pikromycin biosynthetic gene cluster using a PCR-targeted gene disruption system [17]. An apramycin resistance gene (aac(3)IV)/oriT cassette was used to insert a HindIII recognition sequence into a flanking region near pikRII. This cassette was amplified from pIJ773 using the primers containing the HindIII recognition sequence and a homologous sequence with a flanking region near pikRII at the 5′- and 3′-ends, respectively. The cassette was then introduced into E. coli BW25113/pIJ790 containing pSCPik311, resulting in pSCPik311::aac(3)IV/oriT, pMSCPik311. Insertion of the HindIII recognition sequence was confirmed by PCR amplification and sequencing (Macrogen, Korea). The mutated cosmid, pMSCPik311, was subsequently introduced into E. coli ET12567/pUZ8002 and then was directly conjugated with S. venezuelae ATCC 15439. Conjugation experiments were then performed as previously described [11].

Isolation of entire pikromycin biosynthetic gene cluster into pSBAC

To isolate the entire pikromycin biosynthetic gene cluster from the chromosome by HindIII digestion and ligation, attP-int ΦBT1 was removed from pSBAC by AvrII digestion and self-ligation, and the modified vector was named pSA. To integrate pSA into the vicinity of pikD by homologous recombination and select the correct colonies, a cassette containing a 1879-bp DNA fragment including a portion of pikD and a kanamycin resistance gene was constructed by 3-way PCR amplification using primers containing the restriction enzyme sites, HindIII and EcoRI, respectively. The amplified PCR product was ligated into a T&A cloning vector (RBC), after which the ligated vector was sequenced to confirm its integrity (Macrogen, Korea). The cassette was then digested using HindIII and EcoRI, after which it was cloned into EcoRI–HindIII-digested pSA to generate pSAPDK. Conjugation was subsequently performed to integrate pSAPDK into the chromosomal DNA in S. venezuelae via homologous recombination. Next, the desired mutants were selected on apramycin- and kanamycin-containing ISP4 agar, verified using PCR and named S. venezuelae HindBAC. This strain was cultured in TSB media for 1 day at 30 °C, after which its genomic DNA was prepared using a Wizard® genomic DNA purification kit (Promega). Genomic DNA was then digested by restriction enzyme HindIII, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa). After desalting, the ligation mixture was used for electroporation of E. coli EPI300. Recombinants were selected on apramycin- and kanamycin-containing LB medium, after which plasmids were isolated by alkali denaturation and screened by PCR using PikRI-AI, PikAII, PikD and PikD-kan check primers in pikromycin cluster to identify pPik. The attP-int ΦBT1 was digested by AvrII from the attP-int ΦBT1-containing vector constructed in a previous study and then cloned into pPik to generate pPik001.

Extraction and HPLC quantification of 10-deoxymethynolide

Each 50 mL culture medium was centrifuged at 6000×g for 15 min. Pikromycin and its derivatives were extracted from the supernatant with two volumes of ethyl acetate and concentrated using a rotary evaporator, after which the final extracts were dissolved in methanol. Analytical HPLC analysis was conducted using an Agilent C18 5-μm column with 80% acetonitrile in 5 mM ammonium acetate buffer containing 0.05% acetic acid at a flow rate of 1 mL/min. Detection was performed at 220 nm [19].

Replacement of apramycin-resistant gene by other antibiotic resistance genes and introduction into pik-containing strain

To introduce the additional pikromycin cluster into S. lividans Pik101, the apramycin-resistant gene of pPik001 was replaced by a hygromycin-resistant gene using a Quick and Easy BAC modification kit (GeneBridges), after which it was denoted pPik003. Next, pPik001 was introduced into Red/ET plasmid-containing E. coli EPI300, after which BAC modification was performed in accordance with the manufacturer’s guide using the hygromycin-resistant gene containing the apr -homologous arm constructed by PCR. Transformants were selected on hygromycin containing LB medium and confirmed by PCR. After pPik003 was transformed into E. coli S17-1, it was introduced into S. lividans Pik101 by conjugation.

Isolation of total RNA and gene expression analysis by qRT-PCR

For RNA preparation, S. lividans TK21, S. lividans Pik101 and S. lividans Pik102 were grown for 6 days in R5 medium, during which time samples were collected on day 3 and 5. Mycelia were harvested by centrifugation and stored in a −80 °C deep freezer after washing twice with distilled water. RNA preparation and qRT-PCR were then carried out as previously reported [20] using the primers shown in Table 2.
Table 2

Primer list used in this study

OligonucleotidePrimer sequence (5′–3′)Purpose
Homo arm-aprR cassette
 FTACCCGGCGGAGGCGTACCACCAGCAGTATCTGGACAAGAAATTCCGGGGATCCGTCGACCConstruction of pMSCPik311
 RAGCGGCGCAGCCTCATGTAACGGGCCTGAGAGTGGCAGAAGCTTGCATTGTAGGCTGGAGCTGCCTC
AprR cassette check
 FTACGGCGAGATCACCACGACCheck for insertion of apr R cassette
 RGCGAGGATCGAGACGCGTGA
PikD-kan
 FACAACACCAAGCTTGCCCGCCTConstruction of pSAPDK
 RACTGCAAGCTAGGCCCACCGATGAAGGACA
 FTCGGTGGGCCTTAGCTTGCAGTGGGCTTACA
 RTTGGTCGGTGAATTCGAACCCCAGA
PikD-kan check
 FAGGCCCTGTTCGACGACCGAConfirmation of pPik001
 RTGCCTCGTCCTGCAGTTCATTCA
PikRI-AI
 FCCCCTTCGAATTTCCGCCGCConfirmation of pPik001
 RCCGCCAGGAGTTCCCAGAAC
PikAII
 FACCGGTCTCAACTTCCGCGAConfirmation of pPik001
 RTCCAGGAGGGACAGGGTCAGC
PikD
 FTCGCGGCACGGCATGGAGTACATGCAConfirmation of pPik001
 RTCAGGCCGTGACGGACTTGTCCT
PikAI RNA
 FGACTGGGACCGCTTCTACCTqRT-PCR
 RTACGAGACCGAGGAGGATCT
DesIII RNA
 FGCTCTTTCTGGACCGCATAGqRT-PCR
 RCGGTCATTTCGAAGCAGATT
DesVI RNA
 FCATCTGGAGCACTTCACCAAqRT-PCR
 RCTCGGTCGTCTTCAGGTAGC
PikC RNA
 FGCTATCTCTCCCGGCTCATCqRT-PCR
 RGATTGACCGTGGTCTCGTG
PikD RNA
 FGGACGCTCTTACTCGTCTCCqRT-PCR
 RCGGAGTAACTGGCAGAGGAC
HrdB RNA
 FGCGGTGGAGAAGTTCGACTAqRT-PCR
 RCACATGGTCGAGGTCATCAA
Primer list used in this study
  18 in total

1.  Streptocollin, a Type IV Lanthipeptide Produced by Streptomyces collinus Tü 365.

Authors:  Dumitrita Iftime; Martin Jasyk; Andreas Kulik; Johannes F Imhoff; Evi Stegmann; Wolfgang Wohlleben; Roderich D Süssmuth; Tilmann Weber
Journal:  Chembiochem       Date:  2015-11-06       Impact factor: 3.164

Review 2.  Polyketide synthases and nonribosomal peptide synthetases: the emerging view from bacterial genomics.

Authors:  Stefano Donadio; Paolo Monciardini; Margherita Sosio
Journal:  Nat Prod Rep       Date:  2007-05-10       Impact factor: 13.423

3.  Expression of biosynthetic gene clusters in heterologous hosts for natural product production and combinatorial biosynthesis.

Authors:  Ute Galm; Ben Shen
Journal:  Expert Opin Drug Discov       Date:  2006-10       Impact factor: 6.098

4.  Production of hybrid anthracycline antibiotics by heterologous expression of Streptomyces nogalater nogalamycin biosynthesis genes.

Authors:  K Ylihonko; J Hakala; T Kunnari; P Mäntsälä
Journal:  Microbiology       Date:  1996-08       Impact factor: 2.777

5.  Iteration as programmed event during polyketide assembly; molecular analysis of the aureothin biosynthesis gene cluster.

Authors:  Jing He; Christian Hertweck
Journal:  Chem Biol       Date:  2003-12

6.  PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin.

Authors:  Bertolt Gust; Greg L Challis; Kay Fowler; Tobias Kieser; Keith F Chater
Journal:  Proc Natl Acad Sci U S A       Date:  2003-01-31       Impact factor: 11.205

7.  Flavin-linked oxidase catalyzes pyrrolizine formation of dichloropyrrole-containing polyketide extender unit in chlorizidine A.

Authors:  Simone M Mantovani; Bradley S Moore
Journal:  J Am Chem Soc       Date:  2013-11-21       Impact factor: 15.419

8.  Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system.

Authors:  Hee-Ju Nah; Min-Woo Woo; Si-Sun Choi; Eung-Soo Kim
Journal:  Microb Cell Fact       Date:  2015-09-16       Impact factor: 5.328

9.  Structure of a modular polyketide synthase.

Authors:  Somnath Dutta; Jonathan R Whicher; Douglas A Hansen; Wendi A Hale; Joseph A Chemler; Grady R Congdon; Alison R H Narayan; Kristina Håkansson; David H Sherman; Janet L Smith; Georgios Skiniotis
Journal:  Nature       Date:  2014-06-18       Impact factor: 49.962

10.  Direct cloning and heterologous expression of the salinomycin biosynthetic gene cluster from Streptomyces albus DSM41398 in Streptomyces coelicolor A3(2).

Authors:  Jia Yin; Michael Hoffmann; Xiaoying Bian; Qiang Tu; Fu Yan; Liqiu Xia; Xuezhi Ding; A Francis Stewart; Rolf Müller; Jun Fu; Youming Zhang
Journal:  Sci Rep       Date:  2015-10-13       Impact factor: 4.379

View more
  8 in total

Review 1.  Heterologous expression-facilitated natural products' discovery in actinomycetes.

Authors:  Min Xu; Gerard D Wright
Journal:  J Ind Microbiol Biotechnol       Date:  2018-11-16       Impact factor: 3.346

Review 2.  Engineering actinomycetes for biosynthesis of macrolactone polyketides.

Authors:  Dipesh Dhakal; Jae Kyung Sohng; Ramesh Prasad Pandey
Journal:  Microb Cell Fact       Date:  2019-08-13       Impact factor: 5.328

Review 3.  Streptomyces as Microbial Chassis for Heterologous Protein Expression.

Authors:  Soonkyu Hwang; Yongjae Lee; Ji Hun Kim; Gahyeon Kim; Hyeseong Kim; Woori Kim; Suhyung Cho; Bernhard O Palsson; Byung-Kwan Cho
Journal:  Front Bioeng Biotechnol       Date:  2021-12-21

Review 4.  WblA, a global regulator of antibiotic biosynthesis in Streptomyces.

Authors:  Hee-Ju Nah; Jihee Park; Sisun Choi; Eung-Soo Kim
Journal:  J Ind Microbiol Biotechnol       Date:  2021-06-04       Impact factor: 4.258

5.  Genetic and Biochemical Characterization of Halogenation and Drug Transportation Genes Encoded in the Albofungin Biosynthetic Gene Cluster.

Authors:  Zhe-Chong Wang; I-Wen Lo; Kuan-Hung Lin; An Ning Cheng; Saeid Malek Zadeh; Yen-Hua Huang; Tsung-Lin Li
Journal:  Appl Environ Microbiol       Date:  2022-08-24       Impact factor: 5.005

6.  BAC cloning and heterologous expression of a giant biosynthetic gene cluster encoding antifungal neotetrafibricin in streptomyces rubrisoli.

Authors:  Heung-Soon Park; Ji-Hee Park; Hye-Jin Kim; Seung-Hoon Kang; Si-Sun Choi; Eung-Soo Kim
Journal:  Front Bioeng Biotechnol       Date:  2022-08-15

Review 7.  The Quest for Novel Antimicrobial Compounds: Emerging Trends in Research, Development, and Technologies.

Authors:  Pavan K Mantravadi; Karunakaran A Kalesh; Renwick C J Dobson; André O Hudson; Anutthaman Parthasarathy
Journal:  Antibiotics (Basel)       Date:  2019-01-24

Review 8.  Recent Advances in Strategies for the Cloning of Natural Product Biosynthetic Gene Clusters.

Authors:  Wenfang Wang; Guosong Zheng; Yinhua Lu
Journal:  Front Bioeng Biotechnol       Date:  2021-07-13
  8 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.