A novel zoonotic Anaplasma species is prevalent in small ruminants: potential public health implications.

BACKGROUND: Tick-borne diseases currently represent an important issue for global health. A number of emerging tick-transmitted microbes continue to be discovered, and some of these are already identified as the cause of human infections. Over the past two decades, Anaplasma phagocytophilum is considered to be mainly responsible for human anaplasmosis. However, a novel zoonotic pathogen provisionally named "Anaplasma capra" has recently been identified in China. In this study, we did an active surveillance of A. capra in goats and sheep in different geographical regions of China.
METHODS: The presence of A. capra was determined by nested PCR in 547 blood samples collected from goats and sheep from 24 counties distributed in 12 provinces in China. The molecular characterization of A. capra isolates in sheep and goats was achieved based on four conventional genetic markers (16S rRNA, gltA, groEL and msp4 genes).
RESULTS: Anaplasma capra was identified in 75 of 547 animals, with an overall prevalence of 13.7%. The infection rates in the survey sites ranged from 0 to 78.6%, and were significantly different (P < 0.01). Phylogenetic analysis revealed that the isolates obtained from goats, sheep, Ixodes persulcatus ticks and humans create a separate clade within the genus Anaplasma and distinct from other recognized Anaplasma species. These findings indicated that these A. capra isolates possess the same molecular characteristics, suggesting that this organism could be a substantial health threat to both animals and humans.
CONCLUSIONS: Anaplasma capra is an emerging tick-transmitted zoonotic pathogen. This novel Anaplasna species is widespread across China with an overall prevalence of 13.7% in goats and sheep with isolates indistinguishable from those found in humans. These findings warrant increased public health awareness for human anaplasmosis.

Background

Tick-borne diseases are currently becoming an important threat for public health worldwide [1]. With the development of molecular techniques, an increasing number of novel species and genetic variants of tick-borne pathogens are being detected in ticks and/or animals, some of which have been recognized as human pathogens [2]. The majority of emerging tick-borne infections was discovered during the last 20 years [3]. To date, 33 emerging pathogens associated with tick vectors have been identified in China, including the species in the complex Borrelia burgdorferi (sensu lato) (s.l.), spotted fever group rickettsiae, Anaplasma, Babesia and severe fever with thrombocytopenia syndrome virus (SFTSV) [2]. The identification of novel tick-borne pathogens will facilitate development of ecological and public health measures to control and manage these health threats.

In 2015, a new tick-transmitted Anaplasma species provisionally named “Anaplasma capra” was identified in goats and ticks in northern China [4]. This organism was considered to be an emerging human pathogen and is phylogenetically distinct from other established Anaplasma species [4]. Twenty-eight human cases caused by A. capra have been reported in Heilongjiang Province in northeast China, and the pathogen was isolated from three patients [4]. The disease caused by A. capra presents non-specific symptoms with fever, headache, malaise, rash, eschar and chills [4]; these common signs would be very difficult to distinguish clinically from other tick-borne illnesses. Although A. capra was first recognized in goats (Capra aegagrus hircus) in northeastern China, the 16S rRNA sequences of A. capra have previously been detected in goats from south and southwest China [5, 6], in deer and also serows from Japan [7, 8], implying that A. capra may be widely distributed in China and elsewhere. The objective of this study was to determine the occurrence, prevalence and molecular characterization of A. capra in goats and sheep in different geographic regions of China.

Methods

Study sites and collection of specimens

From 2011 to 2015, samples were collected between March and September, to provide a total of 547 EDTA-anticoagulated blood samples from asymptomatic sheep and goats in rural villages from 24 counties in 12 provinces of China. Two to three flocks were selected for sampling in each county. DNA was extracted from 300 μl of whole blood using the Gentra Puregene Blood kit (Qiagen, Beijing, China) according to the manufacturer’s instructions.

PCR reactions

DNA samples were tested for the presence of A. capra by nested PCR targeting the citrate synthase gene (gltA) as previously described [4, 8]. Anaplasma genus-specific primers were used for first round reaction, and primers specific for A. capra were used for nested reactions, which generated a product of 594 bp. In order to further characterize the A. capra strains isolated in the study, we amplified the partial sequences of the 16S rRNA gene (1,261 bp), the heat-shock protein gene (groEL, 874 bp), and the major surface protein 4 gene (msp4, 656 bp) from positive samples. The oligonucleotide primer sequences used in this study are shown in Table 1. PCR reactions were performed in an automatic thermocycler (Bio-Rad, Hercules, USA) as previously described [4, 8]. The DNA extracted from sheep infected with A. capra (GenBank accession no. KX417324) was used as the positive control, and sterile water was used as the negative control. Amplified fragments were subjected to electrophoresis on 1.0% agarose gel, staining with ethidium bromide (0.5 μg/ml), and visualized by UV transillumination.

Table 1

Primers and PCR amplification conditions

Target gene	Primer name	Primer sequence (5'-3')	Annealing temperature (°C)	Amplicon size (bp)	Reference
gltA	Outer-f	GCGATTTTAGAGTGYGGAGATTG	55	1031	[4]
	Outer-r	TACAATACCGGAGTAAAAGTCAA
	Inner-f	TCATCTCCTGTTGCACGGTGCCC	60	594	[8]
	Inner-r	CTCTGAATGAACATGCCCACCCT
16S rRNA	Forward	GCAAGTCGAACGGACCAAATCTGT	58	1261	[8]
	Reverse	CCACGATTACTAGCGATTCCGACTTC
groEL	Forward	TGAAGAGCATCAAACCCGAAG	55	874	[8]
	Reverse	CTGCTCGTGATGCTATCGG
msp4	Forward	GGGTTCTGATATGGCATCTTC	53	656	This study
	Reverse	GGGAAATGTCCTTATAGGATTCG

DNA sequencing and phylogenetic analysis

PCR products were purified with the TaKaRa Agarose Gel DNA purification Kit Ver. 2.0 (TaKaRa, Dalian, China), cloned into pGEM-T Easy vector (Promega, Madison, WI, USA) and transformed into Escherichia coli JM109 competent cells (TaKaRa, Dalian, China). Two recombinant clones were randomly selected for sequencing (Sangon Biotech, Shanghai, China). The obtained sequences were analyzed by a BLASTn search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) in GenBank and by using the Clustal W method in the MegAlign software (DNAStar, Madison, WI). Phylogenetic trees were constructed based on the sequence distance method using the neighbor-joining (NJ) algorithm with the Kimura two-parameter model. Bootstrap values were determined by using 1,000 replications [9].

Statistical analysis

Statistical analysis was conducted using a Chi-square test in Predictive for Analytics Software Statistics 18 (PASW, SPSS Inc., Chicago, IL, USA). P-values of 0.05 or less were considered statistically significant.

Nucleotide sequence accession numbers

The sequences obtained in this study were deposited in the GenBank database under accession numbers as follows: KX417195–KX417207 for 16S rRNA, KX417308–KX417340 for gltA, KX417341–KX417356 for groEL and KX417357–KX417370 for msp4.

Results

Anaplasma capra was identified in 75 of 547 animals, with an overall prevalence of 13.7% (Table 2). This organism was detected in 11 out of 24 study sites. The infection rates in the survey sites ranged from 0 to 78.6% (Table 2), and it varied considerably between the sampling locations. The infection rate of A. capra was slightly higher in sheep (16.3%) than in goats (12.3%) but the difference was not significant (χ  = 1.669, df = 1, P > 0.05).

Table 2

Detection of A. capra by PCR based on gltA gene in sheep and goats from China, 2011–2015

Location		Species	No. tested	Positive (%)
Province	County
Chongqing	Wanzhou	Goat	24	4 (16.7)
	Jiangjin	Goat	30	2 (6.7)
Guangxi	Pingxiang	Goat	11	1 (9.1)
	Jingxi	Goat	19	0 (0)
Guizhou	Dushan	Goat	17	2 (11.8)
	Rongjiang	Goat	25	8 (32.0)
Hebei	Wangdu	Sheep	19	0 (0)
Hainan	Haikou	Goat	28	0 (0)
Sichuan	Hejiang	Goat	32	0 (0)
	Panzhihua	Goat	32	4 (12.5)
Shanxi	Lvliang	Sheep	50	0 (0)
Guangdong	Qingyuan	Goat	30	0 (0)
	Zhaoqing	Goat	33	1 (3.0)
Yunnan	Ruili	Goat	4	0 (0)
	Fuyuan	Goat	7	0 (0)
	Yanshan	Goat	15	0 (0)
Liaoning	Haicheng	Sheep	23	8 (34.8)
	Huanren	Goat	16	11 (68.8)
	Fengcheng	Goat	14	11 (78.6)
Inner Mongolia	Eerguna	Goat	20	0 (0)
	Manzhouli	Sheep	15	0 (0)
	Xinbaerhuzuoqi	Sheep	20	0 (0)
	Aershan	Sheep	18	0 (0)
Hubei	Suizhou	Sheep	45	23 (51.1)
Total			547	75 (13.7)

The molecular characterization of A. capra isolates in sheep and goats was analyzed based on gltA, 16S rRNA, groEL and msp4 genes. Thirty-three gltA sequences (594 bp, 23 from goats and 10 from sheep) of A. capra representative of different geographical locations were obtained in this study, and they provided two sequence variants that have 99.6–100% identity to the type strain HLJ-14 of A. capra detected in humans, goats and Ixodes persulcatus (GenBank KM206274) [4]. The 16S rRNA gene sequences (1,261 bp, 6 from goats and 7 from sheep) obtained from the gltA gene positive samples were 99.9–100% identical to each other and to strain HLJ-14 of A. capra (GenBank KM206273). Moreover, both the groEL (874 bp, 8 from goats and 8 from sheep) and msp4 (656 bp, 8 from goats and 6 from sheep) gene sequences showed 100% similarity to the corresponding sequences of A. capra (GenBank KM206275 and KM206277). Phylogenetic analysis of 16S rRNA sequences showed that the isolates identified in this study were closely related to and clustered within the same clade with A. capra strain HLJ-14, but distinct from remaining recognized Anaplasma species (Fig. 1a), suggesting the novelty of this Anaplasma species. Similar phylogenetic organizations were inferred from the sequence analysis of gltA, groEL and msp4 genes (Fig. 1b-d).

Fig. 1

Phylogenetic analysis of “Anaplasma capra” and other members in the genus Anaplasma based on the 16S rRNA (a), gltA (b), groEL (c), and msp4 (d) genes. Bootstraps analysis was performed with 1,000 replicates. Sequences obtained from this study are underlined. Ehrlichia chaffeensis and Rickettsia rickettsii were used as outgroups

Discussion

Anaplasma spp. are important tick-borne bacteria of veterinary and public health significance [10]. The genus Anaplasma encompasses six recognized species that infect various mammals and specific host cell types, such as monocytes, neutrophils, erythrocytes and platelets depending on the host species [11]. The order Rickettsiales was reorganized in 2001, and Ehrlichia equi, Ehrlichia phagocytphilia and the agent of human granulocytic ehrlichiosis were unified and named as Anaplasma phagocytophilum [11]. Anaplasma phagocytophilum has been known for almost a century to cause tick-borne fever (TBF) in ruminants, and more recently, it has been associated with human granulocytic anaplasmosis (HGA) [12]. In 2010, an Anaplasma ovis variant was detected in a patient in Cyprus [13]. Aside from the aforementioned species, no other causative agent of human anaplasmosis has been reported. However, the virulence of a novel Anaplasma species of genus Anaplasma, with the provisionally name A. capra, have recently been confirmed in China [4]. This species was first identified in goats, and shortly thereafter was recognized to be a new causative agent of human anaplasmosis [4]. In the present study, we did an active surveillance of A. capra in small ruminants in China, and 13.7% of 547 sheep and goats were naturally infected with this novel Anaplasma species. The prevalence of A. capra in goats and sheep differed among geographic regions, and it was identified in 11 of 24 investigated counties within 12 provinces in China. The findings of present study suggested that A. capra is widely distributed in China, and sheep and goats are the competent reservoir hosts for A. capra. The knowledge of the presence of A. capra in sheep and goats provides information for assessing the public health risks for human anaplasmosis.

Phylogenetic analysis of A. capra based on four conventional genetic markers (16S rRNA, gltA, groEL and msp4 genes) strongly supported that the isolates obtained from goats, sheep, Ixodes persulcatus ticks and humans create a separate clade within the genus Anaplasma, suggesting that these A. capra strains possess the same molecular characteristics. In a previous report, a novel Anaplasma species closely related to A. capra has also been identified in Haemaphysalis qinghaiensis ticks in northwestern China [8]. The 16S rRNA gene of those isolates exhibit the highest sequence similarity with A. capra (similarity of 99.8–99.9%), but the gltA and groEL genes were relatively less identical to A. capra (88.6–88.7% for gltA and 90.6–91.0% for groEL). This organism has also been detected previously in deer (Anaplasma sp. NS104, GenBank AB454075) and in free living serows (Anaplasma sp. Kamoshika17, GenBank AB509223) in Japan [7]. Apparently, the Anaplasma species identified in those domestic and wild animals, ticks and humans should be a single species according to the criteria for classification of bacteria (at least 99% 16S rRNA gene homology) [14]. These findings indicated that A. capra may have high degree of genetic diversity and host tropisms, as have been confirmed in A. phagocytophilum [15]. There are at least two genotypes/genospecies of A. capra circulate in nature, one genotype contains strains isolated from goats, sheep, I. persulcatus and humans, while the other from deer, serows and H. qinghaiensis. Further studies should be conducted to clarify if these two A. capra genotypes have variation in pathogenicity.

It is well known that the members in the genus Anaplasma are transmitted transtadially rather than transovarially (from adult ticks to eggs) by ticks [10]. Anaplasma capra has been identified in I. persulcatus and H. longicornis ticks in China [4, 16]. However, pathogen detection in arthropods is not sufficient to validate its vector competence. Thus, their competency as vectors for A. capra remains to be proven, and wide tick surveillance should be conducted to determine the distribution and potential tick vectors of A. capra. To date, there is very little information of the natural cycles of A. capra, and the reservoir host is essential to keep Anaplasma organisms in nature [15]. As already mentioned, A. capra has been detected in goats, deer and serows [5-7], suggesting that this pathogen may affect a wide range of mammals, especially small ruminants. However, it is unclear at present whether A. capra can infect other mammalian species, and more research is needed to evaluate the full range of reservoir hosts for A. capra.

In addition, there is also significant difference in several biological features between A. capra and other well-recognized Anaplasma species. Anaplasma species organisms usually infect bone marrow-derived cells in blood, however, A. capra may infect endothelial cells in vivo [4, 17]. Therefore, microscopic examination of peripheral blood smears is not sensitive enough for diagnosis of A. capra infection in animals and humans. The symptoms caused by Anaplasma spp. are usually mild and nonspecific and can easily be confused with other infections [18]. These diseases would be generally neglected. However, increasing numbers of anaplasmosis cases of undetermined cause have been reported in mainland China and the USA [2, 19]. Clinicians and veterinary practitioners should pay more attention to this new emerging infectious disease in areas where anaplasmosis can occur.

Conclusions

An active surveillance of A. capra was conducted in domestic small ruminants in China. Our survey showed that this novel Anaplasna species is widespread across China with an overall prevalence of 13.7% in goats and sheep. The A. capra isolates identified from animals, ticks and patients possess the same molecular characteristics, suggesting that this organism could be a substantial health threat to both animals and human beings.