Literature DB >> 31196180

Molecular detection and identification of tick-borne bacteria and protozoans in goats and wild Siberian roe deer (Capreolus pygargus) from Heilongjiang Province, northeastern China.

Haoning Wang1, Jifei Yang2, Muhammad Uzair Mukhtar3, Zhijie Liu3, Minghai Zhang1, Xiaolong Wang4,5.   

Abstract

BACKGROUND: Small ruminants are important hosts for various tick species and tick-associated organisms, many of which are zoonotic. The aim of the present study was to determine the presence of tick-borne protozoans and bacteria of public health and veterinary significance in goats and wild Siberian roe deer (Capreolus pygargus) from Heilongjiang Province, northeastern China.
METHODS: The occurrence of piroplasms, Anaplasma phagocytophilum, A. bovis, A. marginale, A. capra, A. ovis, Ehrlichia spp. and spotted fever group rickettsiae was molecularly investigated and analyzed in 134 goats and 9 free ranging C. pygargus living in close proximity.
RESULTS: Piroplasm DNA was detected in 16 (11.9%) goats and 5 C. pygargus. Sequence analysis of 18S rRNA sequences identified 3 Theileria species (T. luwenshuni, T. capreoli and T. cervi). Four Anaplasma species (A. ovis, A. phagocytophilum, A. bovis and A. capra) were identified in goats and C. pygargus. Anaplasma ovis and A. bovis were detected in 11 (8.2%) and 6 (4.5%) goats, respectively; A. phagocytophilum, A. bovis and A. capra were found in 3, 7 and 3 C. pygargus, respectively. Sequence analysis of 16S rRNA sequences revealed the presence of 5 different genetic variants of A. bovis in goats and C. pygargus, while the analysis of 16S rRNA and gltA sequence data showed that A. capra isolates identified from C. pygargus were closely related to the genotype identified from sheep and Haemaphysalis qinghaiensis, but differed with the genotype from humans. Anaplasma/Theileria mixed infection was observed in 2 (1.5%) goats and 5 C. pygargus, and co-existence involving potential zoonotic organisms (A. phagocytophilum and A. capra) was found in 2 C. pygargus. All samples were negative for A. marginale, Ehrlichia spp. and SFG rickettsiae.
CONCLUSIONS: These findings report the tick-borne pathogens in goats and C. pygargus, and a greater diversity of these pathogens were observed in wild animals. Three Theileria (T. luwenshuni, T. capreoli and T. cervi) and four Anaplasma species (A. ovis, A. phagocytophilum, A. bovis and A. capra) with veterinary and medical significance were identified in small domestic and wild ruminants. The contact between wild and domestic animals may increase the potential risk of spread and transmission of tick-borne diseases.

Entities:  

Keywords:  Anaplasma; China; Goats; Siberian roe deer; Theileria; Tick-borne pathogen; Zoonosis

Mesh:

Substances:

Year:  2019        PMID: 31196180      PMCID: PMC6567649          DOI: 10.1186/s13071-019-3553-1

Source DB:  PubMed          Journal:  Parasit Vectors        ISSN: 1756-3305            Impact factor:   3.876


Background

Small ruminants are known to harbor various ticks that act as vectors and reservoirs of tick-borne pathogens of veterinary and/or medical importance. They play an important role, not only in the life-cycle of ticks, but also in the natural maintenance and transmission of these pathogens [1]. Tick-borne diseases affect domestic and wild ruminants, especially sheep, goats, cattle and deer [2]. In the past two decades, an increasing number of tick-borne pathogens have been identified in domestic animals and a variety of wild cervids, some of which have been confirmed as causes of human infection, such as Anaplasma phagocytophilum, Anaplasma capra, Babesia divergens, Babesia venatorum, Ehrlichia canis, etc. [3-6]. This fact is of great concern in terms of tick-borne disease control, since animals are usually asymptomatic carriers that may serve as reservoirs of the infection. With advances in molecular techniques, a number of well-known and potential novel tick-borne bacteria and protozoans have been identified in unexpected hosts and geographical locations [7]. In China, Theileria annulata is the causative agent of bovine theileriosis and has been identified in sika deer [8]; Theileria uilenbergi causes ovine theileriosis and has been detected in red deer and sika deer [9]; and Babesia motasi infects sheep and goats and has been reported in sika deer [8]. This information warrants further investigation of tick-borne pathogens in both domestic and wild animals simultaneously. Siberian roe deer (Capreolus pygargus) is a commonly encountered wild animal and distributed mainly in Xinjiang and northeastern China [10]. The aim of this study was to determine the occurrence of the tick-borne bacteria and protozoans in goats and free-ranging C. pygargus from Heilongjiang Province, northeastern China.

Methods

Study sites and collection of specimens

In the present study, EDTA-anticoagulated blood samples were collected from 134 asymptomatic goats and 9 free-ranging C. pygargus from September 2017 to August 2018 in forest farms in Hebei Forestry Bureau, Mudanjiang city and Chaihe Forestry Bureau from Heilongjiang Province, northeastern China. The forest farms are local administrative units which have changed their role from timber production to forest and wildlife conservation over the last two decades. They never serve as large scale husbandry units, while backyard livestock breeding by its employees is common. Those domestic animals graze freely and share a common habitat with wild ungulates, which can frequently be found feeding very close to the local settlements. The samples were collected from rescued C. pygargus during the course of daily routine patrol by local wildlife disease monitoring stations. The goats were sampled in the herds close to the sites where C. pygargus included in this study were found. Sample collection and animal handling complied with the Animal Ethics Procedures and Guidelines and was approved by the Animal Ethics Committee of Northeast Forestry University. Genomic DNA was extracted from 200 μl of whole blood using a QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) according to the instructions of the manufacturer.

PCR reactions

The extracted DNA was screened for the presence of piroplasms, Anaplasma, Ehrlichia and spotted fever group (SFG) rickettsiae by PCR. The PCR primers and cycling conditions used in this study are listed in Table 1. Briefly, nested PCRs were employed for the detection of piroplasms, A. phagocytophilum, A. bovis, and A. capra based on 18S rRNA, 16S rRNA and gltA genes, respectively. Anaplasma ovis, A. marginale, Ehrlichia spp. and SFG rickettsiae were detected by conventional PCR based on msp4 gene, 16S rRNA and ompA genes, respectively. PCR reactions were conducted in an automatic thermocycler (Bio-Rad, Hercules, CA, USA) in a total volume of 25 μl, including 2 μl of DNA sample as previously described [11]. The DNAs extracted from the whole blood of animals infected with T. annulata, A. phagocytophilum, A. bovis, A. marginale and A. ovis, and the DNAs from ticks positive for E. chaffeensis and SFG rickettsiae that had been verified by sequencing, were used as the positive control for corresponding PCR reactions; sterile water was used as the blank control for each run. Amplified fragments were electrophoresed on a 1.0% agarose gel containing 10 μl of GoldView (SolarBio, Beijing, China) and visualized under UV transillumination.
Table 1

Primers and PCR amplification conditions

PathogenTarget genePrimer namePrimer sequence (5′–3′)Annealing T (°C)Amplicon size (bp)References
Piroplasm18S rRNAPiro1-SCTTGACGGTAGGGTATTGGC55~ 1410 [24, 25]
Piro3-ASCCTTCCTTTAAGTGATAAGGTTCAC
PIRO-A1CGCAAATTACCCAATCCTGACA55~ 430
PIRO-BTTAAATACGAATGCCCCCAAC
A. phagocytophilum 16S rRNAEE1CCTGGCTCAGAACGAACGCTGGCGGC55~ 1430[26, 27]
EE2AGTCACTGACCCAACCTTAAATGGCTG
SSAP2fGCTGAATGTGGGGATAATTTAT60641
SSAP2rATGGCTGCTTCCTTTCGGTTA
A. bovis 16S rRNAEE1TCCTGGCTCAGAACGAACGCTGGCGGC55~ 1430[26, 27]
EE2AGTCACTGACCCAACCTTAAATGGCTG
AB1fCTCGTAGCTTGCTATGAGAAC60551
AB1rTCTCCCGGACTCCAGTCTG
A. marginale msp4 AmargMSP4FwCTGAAGGGGGAGTAATGGG60344[28]
AmargMSP4RevGGTAATAGCTGCCAGAGATTCC
A. ovis msp4 MSP45GGGAGCTCCTATGAATTACAGAGAATTGTTTAC55869[29]
MSP43CCGGATCCTTAGCTGAACAGAATCTTGC
A. capra gltA Outer-fGCGATTTTAGAGTGYGGAGATTG551031[6]
Outer-rTACAATACCGGAGTAAAAGTCAA
Inner-fTCATCTCCTGTTGCACGGTGCCC60594[22]
Inner-rCTCTGAATGAACATGCCCACCCT
16S rRNAForwardGCAAGTCGAACGGACCAAATCTGT581261[30]
ReverseCCACGATTACTAGCGATTCCGACTTC
Ehrlichia spp.16S rRNAECCAGAACGAACGCTGGCGGCAAGC60450[26]
ECBCGTATTACCGCGGCTGCTGGCA
SFG rickettsiae OmpA Rr190.70ATGGCGAATATTTCTCCAAAA55632[31]
Rr190.701GTTCCGTTAATGGCAGCATCT

Abbreviation: T, temperature

Primers and PCR amplification conditions Abbreviation: T, temperature

DNA sequencing and phylogenetic analysis

The DNA fragments were purified with a AxyPrepTM DNA Gel Extraction Kit (Axygen, Union City, CA, USA), cloned into pGEM-T Easy vector (Promega, Madison, WI, USA) and transformed for sequencing using BigDye Terminator Mix (GenScript, Nanjing, China). The nucleotide sequences obtained in this study were compared with previously published sequences deposited in GenBank by a BLASTn search or by using the ClustalW multiple alignment algorithm in the MegAlign program of the Lasergene 7.1 software package (DNAStar, Madison, WI, USA). The phylogenetic trees were inferred by using the neighbor-joining (NJ) method with the Kimura two-parameter model, and the bootstrap test was replicated 1000 times [12].

Nucleotide sequence accession numbers

The representative sequences of the identified pathogens in this study were deposited in the GenBank database and assigned accession numbers as follows: MH085202, MH085203 and MK271372 for 18S rRNA gene sequences of T. capreoli, T. cervi and T. luwenshuni, respectively; MH085195–MH085196 and MK271373–MK271375 for 16S rRNA gene sequences of A. bovis; MH085197 and MH085198 for 16S rRNA gene sequences of A. phagocytophilum and A. capra, respectively; MK271379 for the msp4 gene sequence of A. ovis; and MH094751 for the gltA gene sequence of A. capra.

Results

Sixteen (11.9%) of 134 goats and 5 (55.6%) of 9 free-ranging C. pygargus tested positive for piroplasms by nested PCR, which amplifies an approximately 430 bp band of the 18S rRNA gene of Theileria/Babesia spp. All amplicons were sequenced, and BLAST analysis revealed that the obtained sequences belonged to three different Theileria species; Babesia was not identified in any of these amplicon sequences. Sequence analysis revealed that the 18S rRNA sequences detected from goats were 100% identical to each other and to the isolates GNhl4 (MG799814), SX01 (MG930123) and PZG5 (LC326009) of T. luwenshuni identified in Haemaphysalis longicornis and goats from China and Myanmar. The 18S rRNA sequences of Theileria detected from C. pygargus were classified into two groups. Two 18S rRNA sequences were 100% identical to the Theileria sp. 3185/02 (GenBank: DQ866842) identified in roe deer (Capreolus capreolus) from Spain and the isolate TCCRO1 of T. capreoli (GenBank: KY359359) identified in grey wolf (Canis lupus) from Croatia [13]. Three sequences were 100% identical to the isolates Am4 (GenBank: MG041373) and 13WYs1a (GenBank: KP407020) of T. cervi isolated from Ixodes persulcatus and sika deer (Cervus nippon) in Russia and China, respectively. To further characterize these three Theileria species, the first-round PCR amplicons from positive samples (~ 1410 bp) were sequenced. Sequence and phylogenetic analysis revealed that Theileria sp. (PB23-2, GenBank: MK271372) identified from goats was closely related to T. luwenshuni identified from sheep and goats (GenBank: KC769996, JX469512, JX469518 and KC854408) in China; Theileria sp. (Pb17c, GenBank: MH085202) identified from C. pygargus was clustered together with T. capreoli isolates from roe deer (GenBank: AY726011 and DQ866842) in Spain, Reeves’ muntjac (GenBank: KJ451470) and white-lipped deer (GenBank: JX134576) in China and sika deer in Japan (GenBank: AB012189); Theileria sp. (Pb22a, GenBank: MH085203) from C. pygargus was closely related to T. cervi identified from sika deer in China and Japan (GenBank: HQ184411, KT959224, AB602882, AB602887, AB012196 and AB012199) (Fig. 1).
Fig. 1

Phylogenetic analysis of the Theileria species identified in this study based on the 18S rRNA gene. Babesia bovis was used as outgroup. Boldface indicates the sequences obtained in this study. The phylogenetic trees were inferred by using the neighbor-joining (NJ) method with the Kimura two-parameter model, and the bootstrap test was replicated 1000 times. There was a total of 1367 positions in the final dataset

Phylogenetic analysis of the Theileria species identified in this study based on the 18S rRNA gene. Babesia bovis was used as outgroup. Boldface indicates the sequences obtained in this study. The phylogenetic trees were inferred by using the neighbor-joining (NJ) method with the Kimura two-parameter model, and the bootstrap test was replicated 1000 times. There was a total of 1367 positions in the final dataset Four Anaplasma species were detected in goats and C. pygargus, including A. ovis, A. bovis, A. phagocytophilum and A. capra. Anaplasma ovis was detected in 11 (8.2%) of 134 goats. The msp4 sequences (MK271379) detected in goats were 100% identical to the A. ovis isolates from sheep (GenBank: MF071307 and AY702924) in China and Italy. Anaplasma bovis infection was found in 6 (4.5%) goats and 7 (77.8%) C. pygargus. The 16S rRNA sequences (551 bp) amplified from goats and C. pygargus provided five sequence variants that had 98.8–99.8% identity. These A. bovis variants (Ab27-2, Ab35-1 and Ap45-3 from goats, MK271373–MK271375; Ab18a and Ab21b from C. pygargus, MH085195 and MH085196) were 99.3–100% identical to the A. bovis isolate b2-25a (GenBank: MF066914) from sheep in China. Anaplasma phagocytophilum was detected in three (33.3%) C. pygargus. The 16S rRNA sequences of A. phagocytophilum (641 bp) obtained from this study (Ap23a, MH085197) were 100% identical to each other and to isolate ApGOv1 derived from sheep (GenBank: KM285230) in Tunisia, GS29 from cattle (GenBank: GU223365) in Turkey, and Ac30B from sika deer (GenBank: AB588976) in Japan. Three C. pygargus (33.3%) were positive for A. capra. These A. capra isolates were molecularly characterized based on 16S rRNA and gltA genes. The 16S rRNA gene sequences (Ac19f, MH085198) were 99.8% identical to the A. capra isolate S63a identified from sheep (MF066918), Anaplasma sp. Kamoshika17 from Japanese serows (GenBank: AB509223), Anaplasma sp. NS104 from deer (GenBank: AB454075), M141a from H. qinghaiensis ticks (GenBank: KX673825), and 99.7% identical to the isolate HLJ-14 of A. capra (GenBank: KM206273) isolated in humans (GenBank: KM206274). The gltA sequences (Ac19a, MH094751) were 98.5–98.7% identical to A. capra isolates from sheep and H. qinghaiensis ticks (GenBank: MF071308, MF071309, KX685885 and KX685886), but they had a low sequence identity (87.6%) to the corresponding sequence of A. capra HLJ-14 from humans (GenBank: KM206274). Phylogenetic analyses revealed that the isolate identified in C. pygargus was clustered into the A. capra clade based on 16S rRNA gene, distinct from other well-recognized Anaplasma species (Fig. 2). However, based on the gltA gene, the isolate was closely related to A. capra strains from sheep and H. qinghaiensis, but separated clearly from the human isolate HLJ-14 (Fig. 3).
Fig. 2

Phylogenetic analysis of the Anaplasma capra based on the 16S rRNA gene. Ehrlichia chaffeensis was used as outgroup. Boldface indicates the sequences obtained in this study. The phylogenetic trees were inferred by using the neighbor-joining (NJ) method with the Kimura two-parameter model, and the bootstrap test was replicated 1000 times. There was a total of 1219 positions in the final dataset

Fig. 3

Phylogenetic analysis of the Anaplasma capra based on the gltA gene. Rickettsia rickettsii was used as outgroup. Boldface indicates the sequences obtained in this study. The phylogenetic trees were inferred by using the neighbor-joining (NJ) method with the Kimura two-parameter model, and the bootstrap test was replicated 1000 times. There was a total of 563 positions in the final dataset

Phylogenetic analysis of the Anaplasma capra based on the 16S rRNA gene. Ehrlichia chaffeensis was used as outgroup. Boldface indicates the sequences obtained in this study. The phylogenetic trees were inferred by using the neighbor-joining (NJ) method with the Kimura two-parameter model, and the bootstrap test was replicated 1000 times. There was a total of 1219 positions in the final dataset Phylogenetic analysis of the Anaplasma capra based on the gltA gene. Rickettsia rickettsii was used as outgroup. Boldface indicates the sequences obtained in this study. The phylogenetic trees were inferred by using the neighbor-joining (NJ) method with the Kimura two-parameter model, and the bootstrap test was replicated 1000 times. There was a total of 563 positions in the final dataset Co-infection with Anaplasma and Theileria was observed in 2 goats and 5 C. pygargus. Co-infection that involved potential zoonotic organisms (A. phagocytophilum and A. capra) was found in 2 C. pygargus. Moreover, all animals included in this study tested negative for A. marginale, Ehrlichia spp. and SFG rickettsiae.

Discussion

The occurrence of tick-borne pathogens has been well documented in various domestic and wild ruminants in many countries. In addition to their veterinary importance, many tick-borne pathogens are known to have zoonotic potential. In the present study, the presence of tick-borne bacteria and protozoans was investigated in domestic and wild small ruminants; three Theileria (T. luwenshuni, T. capreoli and T. cervi) and four Anaplasma species (A. ovis, A. phagocytophilum, A. bovis and A. capra) were identified in goats and free-ranging C. pygargus. Protozoan parasites of the genus Theileria are obligatory intracellular parasites that infect leukocytes and erythrocytes of both wild and domestic animals. Aside from highly pathogenic Theileria species, such as T. parva and T. annulata, others are described as low pathogenic [13]. Asymptomatic infections by different Theileria species have so far been identified in a variety of wild and domestic animals [1, 14–17]. In this study, T. luwenshuni was identified in goats, and T. capreoli and T. cervi in C. pygargus in Heilongjiang Province, northeastern China. Theileria luwenshuni is a new Theileria species highly pathogenic for small domestic ruminants (goats and sheep); it is widely distributed in China and causes substantial economic losses for the livestock industry [18]. Theileria capreoli and T. cervi have been frequently reported in cervid species. Theileria capreoli was first described in roe deer, and recorded subsequently in red deer, fallow deer, roe deer and Chinese water deer [16, 19]. Theileria cervi is a non-pathogenic species that has been reported in brown brocket deer, white-tailed deer, sika deer, axis deer, marsh deer, elk, pampas deer and mule deer [14, 15, 20]. Our findings suggest that C. pygargus may serve as a reservoir of T. capreoli and T. cervi in northeastern China. The genus Anaplasma encompasses a group of obligate intracellular bacteria that are causative agents of anaplasmosis with veterinary and public health significance [5]. They have different cellular tropism, vectors, pathogenicity and host range. In this study, A. ovis and A. bovis were identified in goats, and A. phagocytophilum and A. bovis in free-ranging C. pygargus. Anaplasma ovis, A. phagocytophilum and A. bovis are frequently detected tick-borne pathogens in small ruminants around the world; however, the infection of A. phagocytophilum was not found in goats included in this study. Aside from A. ovis, A. phagocytophilum and A. bovis have the broadest host range. Our results suggested that the C. pygargus may serve as reservoir hosts for A. phagocytophilum and A. bovis. Considering the fact that A. phagocytophilum and A. bovis can affect a variety of domestic and wild animals, the risk of cross-infection is high in areas where wild and domestic animals share a common habitat. Apart from those well-known Anaplasma species, a novel Anaplasma species named A. capra has been recently described in goats and identified subsequently as a human pathogen in Heilongjiang Province in northeastern China [6]. The molecular investigations of A. capra in small domestic ruminants and several tick species revealed that this pathogen is widely distributed in China, subdivided into two genotypes [11, 21, 22]. In this study, A. capra was identified in C. pygargus in Heilongjiang Province, where the human isolate HLJ-14 was described [6]. Phylogenetic analysis showed that the isolates from C. pygargus were closely related to A. capra genotype identified from sheep and H. qinghaiensis, but differ with the genotype from human, suggesting the high degree of genetic diversity of this agent. Moreover, since 16S rRNA sequences of A. capra have been previously detected in Japanese serows (AB509223) and deer (Anaplasma sp. NS104, AB454075) from Japan [23], the finding of this agent in C. pygargus was not surprising. These findings, together with previous reports, suggest that A. capra could be efficiently maintained in nature through enzootic cycles between ticks and wild cervids, and the A. capra genotype identified in C. pygargus is distinct from the human genotype. In summary, several tick-borne pathogens were identified in small domestic and wild ruminants from northeastern China; three (T. luwenshuni, A. ovis and A. bovis) were identified in goats and five (T. capreoli, T. cervi, A. phagocytophilum, A. bovis and A. capra) in free-ranging C. pygargus. These findings suggest a greater diversity of tick-borne pathogens in wild animals than that in domestic animals. Furthermore, the infection of A. marginale, Ehrlichia spp. and SFG rickettsiae was not found in those animals included this study. Goats and C. pygargus serve as reservoirs for tick-borne protozoans and bacteria with a broad host range, such as A. phagocytophilum, A. bovis and A. capra, posing a potential threat to domestic and other wild animals as well as humans.

Conclusions

This study describes the occurrence of tick-borne bacteria and protozoans in goats and C. pygargus from northeastern China. Three Theileria (T. luwenshuni, T. capreoli and T. cervi) and four Anaplasma species (A. ovis, A. phagocytophilum, A. bovis and A. capra) with veterinary and medical significance were identified in small domestic and wild ruminants. The identification of these causative agents in domestic and wild animals provides useful information for the control and management of tick-borne diseases.
  31 in total

1.  MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0.

Authors:  Koichiro Tamura; Joel Dudley; Masatoshi Nei; Sudhir Kumar
Journal:  Mol Biol Evol       Date:  2007-05-07       Impact factor: 16.240

2.  High prevalence of Theileria sp. in wild Chinese Water Deer (Hydropotes inermis argyropus) in South Korea.

Authors:  Jae-Ik Han; Hye-Jin Jang; Sook-Jin Lee; Ki-Jeong Na
Journal:  Vet Parasitol       Date:  2009-06-06       Impact factor: 2.738

3.  Sequence analysis of the msp4 gene of Anaplasma ovis strains.

Authors:  José de la Fuente; Mark W Atkinson; Victoria Naranjo; Isabel G Fernández de Mera; Atilio J Mangold; Kimberly A Keating; Katherine M Kocan
Journal:  Vet Microbiol       Date:  2006-10-18       Impact factor: 3.293

4.  Detection of Theileria and Babesia in brown brocket deer (Mazama gouazoubira) and marsh deer (Blastocerus dichotomus) in the State of Minas Gerais, Brazil.

Authors:  Júlia A G da Silveira; Elida M L Rabelo; Múcio F B Ribeiro
Journal:  Vet Parasitol       Date:  2010-10-30       Impact factor: 2.738

5.  Molecular detection and characterization of piroplasms infecting cervids and chamois in Northern Spain.

Authors:  J García-Sanmartín; O Aurtenetxe; M Barral; I Marco; S Lavin; A L García-Pérez; A Hurtado
Journal:  Parasitology       Date:  2006-11-01       Impact factor: 3.234

6.  A molecular survey of Piroplasmida and Hepatozoon isolated from domestic and wild animals in Burgos (northern Spain).

Authors:  Consuelo Gimenez; Nieves Casado; Angel Criado-Fornelio; Florencio Alvarez de Miguel; Gerardo Dominguez-Peñafiel
Journal:  Vet Parasitol       Date:  2009-02-26       Impact factor: 2.738

7.  Detection and differentiation of Theileria luwenshuni and T. uilenbergi infection in small ruminants by PCR.

Authors:  H Yin; Z Liu; G Guan; A Liu; M Ma; Q Ren; J Luo
Journal:  Transbound Emerg Dis       Date:  2008-08       Impact factor: 5.005

8.  Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan.

Authors:  Makoto Kawahara; Yasuko Rikihisa; Quan Lin; Emiko Isogai; Kenji Tahara; Asao Itagaki; Yoshimichi Hiramitsu; Tomoko Tajima
Journal:  Appl Environ Microbiol       Date:  2006-02       Impact factor: 4.792

9.  Phylogenetic analysis of Theileria sp. from sika deer, Cervus nippon, in Japan.

Authors:  Hisashi Inokuma; Masayoshi Tsuji; Sam-Ju Kim; Takako Fujimoto; Miwa Nagata; Eiji Hosoi; Satoru Arai; Chiaki Ishihara; Masaru Okuda
Journal:  Vet Parasitol       Date:  2004-04-15       Impact factor: 2.738

10.  Phylogenetic analysis of the 16S rRNA gene of Anaplasma species detected from Japanese serows (Capricornis crispus).

Authors:  Makoto Sato; Ikuo Nishizawa; Masatoshi Fujihara; Takashi Nishimura; Kazuei Matsubara; Ryô Harasawa
Journal:  J Vet Med Sci       Date:  2009-12       Impact factor: 1.267

View more
  7 in total

1.  The detection and phylogenetic analysis of Anaplasma phagocytophilum-like 1, A. ovis and A. capra in sheep: A. capra divides into two genogroups.

Authors:  Kursat Altay; Ufuk Erol; Omer Faruk Sahin; Ayperi Aytmirzakizi; Ethem Mutlu Temizel; Mehmet Fatih Aydin; Nazir Dumanli; Munir Aktas
Journal:  Vet Res Commun       Date:  2022-09-28       Impact factor: 2.816

2.  Molecular Survey of Vector-Borne Pathogens in Ticks, Sheep Keds, and Domestic Animals from Ngawa, Southwest China.

Authors:  Miao Lu; Junhua Tian; Hongqing Zhao; Hai Jiang; Xincheng Qin; Wen Wang; Kun Li
Journal:  Pathogens       Date:  2022-05-22

3.  The Common Occurrence of Theileria ovis in Tibetan Sheep and the First Report of Theileria sinensis in Yaks from Southern Qinghai, China.

Authors:  Ye Wang; Bo Wang; Qingxun Zhang; Ying Li; Ziwen Yang; Shuyi Han; Guohui Yuan; Shuangling Wang; Hongxuan He
Journal:  Acta Parasitol       Date:  2021-04-11       Impact factor: 1.440

4.  Identification of Anaplasma spp. in Tian Shan wapiti deer (Cervus elaphus songaricus) in Xinjiang, China.

Authors:  Tao Li; Yanyan Cui; Jinxiu Xiao; Yuxi Jiang; Changshen Ning; Meng Qi; Dayong Tao
Journal:  Int J Parasitol Parasites Wildl       Date:  2021-02-14       Impact factor: 2.674

5.  Molecular Detection and Identification of Babesia spp., Theileria spp., and Anaplasma spp. in Sheep From Border Regions, Northwestern China.

Authors:  Yongchang Li; Eloiza May Galon; Qingyong Guo; Mohamed Abdo Rizk; Paul Franck Adjou Moumouni; Mingming Liu; Jixu Li; Shengwei Ji; Bayin Chahan; Xuenan Xuan
Journal:  Front Vet Sci       Date:  2020-09-16

6.  Molecular detection of Anaplasma spp., Babesia spp. and Theileria spp. in yaks (Bos grunniens) and Tibetan sheep (Ovis aries) on the Qinghai-Tibetan Plateau, China.

Authors:  Yongcai He; Wangkai Chen; Ping Ma; Yaoping Wei; Ruishan Li; Zhihong Chen; Shuyu Tian; Tongsheng Qi; Jinfang Yang; Yali Sun; Jixu Li; Ming Kang; Ying Li
Journal:  Parasit Vectors       Date:  2021-12-23       Impact factor: 3.876

7.  Novel Protozoans in Austria Revealed through the Use of Dogs as Sentinels for Ticks and Tick-Borne Pathogens.

Authors:  Michiel Wijnveld; Anna-Margarita Schötta; Theresa Stelzer; Georg Duscher; Michael Leschnik; Hannes Stockinger; Per-Eric Lindgren; Gerold Stanek
Journal:  Microorganisms       Date:  2021-06-28
  7 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.