| Literature DB >> 28529509 |
Yingxin Dai1, Yanan Wang1, Qian Liu1, Qianqian Gao1, Huiying Lu1, Hongwei Meng1, Juanxiu Qin1, Mo Hu2, Min Li1.
Abstract
The ESAT-6 secretion system (ESS) has been reported to contribute to the virulence and pathogenicity of several Staphylococcus aureus strains such as USA300 and Newman. However, the role of the ESS in community-associated S. aureus (CA-SA) lineage ST398 in China is not well understood. By comparing the ess locus of ST398 with the published S. aureus sequence in the NCBI database, we found one gene in the ess locus encoding a novel WXG superfamily protein that is highly conserved only in ST398. LC-MS/MS and Western blot analysis revealed that this protein is a novel secreted protein controlled by the ST398 ESS, and we named the protein EsxX. Although EsxX was not under the control of the accessory gene regulator like many other virulence factors and had no influence on several phenotypes of ST398, such as growth, hemolysis, and biofilm formation, it showed important impacts on immune evasion and virulence in ST398. An esxX deletion mutant led to significantly reduced resistance to neutrophil killing and decreased virulence in murine skin and blood infection models, indicating its essential contribution to the evasion of innate host defense and virulence to support the pathogenesis of ST398 infections. The function of this novel secreted protein EsxX might help us better understand the role of the ESS in the virulence and epidemic success of the CA-SA lineage ST398.Entities:
Keywords: ESAT-6 secretion system; EsxX; community-associated Staphylococcus aureus; immune evasion; secreted protein; virulence
Year: 2017 PMID: 28529509 PMCID: PMC5418362 DOI: 10.3389/fmicb.2017.00819
Source DB: PubMed Journal: Front Microbiol ISSN: 1664-302X Impact factor: 5.640
Bacterial strains and plasmids used in this study.
| Strains/plasmids | Relevant genotype and property | Source |
|---|---|---|
| RN4220 | derived from NCTC8325-4;r-m+ | |
| RJ-ST398 | CA-SA clinical isolate | |
| RJ-ST398Δ | RJ-ST398 | |
| RJ-ST398Δ | RJ-ST398 | This study |
| RJ-ST398Δ | RJ-ST398 | This study |
| RJ-ST398Δ | RJ-ST398 | This study |
| RJ-ST398Δ | RJ-ST398 | |
| DH5α | Invitrogen | |
| BL21 | Amersham Biosciences | |
| pKOR1 | cmR and ampR, temperature-sensitive vector for allelic replacement via lambda recombination and | |
| pKOR1Δ | Vector for allelic replacement of | This study |
| pOS1 | ||
| pOS1 | pOS1 with insertion of | This study |
Oligonucleotides used in this study.
| Oligonucleotide | Sequence |
|---|---|
| esxX-att1 | ggggacaagtttgtacaaaaaagcaggctgatggtatgagtaaacttaagga |
| esxX-rev1 | tttatactcctttactcttttat |
| esxX-rev2 | aagagtaaaggagtataaaaaggagatttaaaatgaataat |
| esxX-att2 | gggg accactttgtacaagaaagctgggtggtaaaagggcaattgaagg |
| EsxX- Sma1-F | gagcccgggatggggaataaaataaaaatgtcag |
| EsxX-BamH1-flag-R | gagggatccttacttatcgtcgtcatccttgtaatcaaatacattgcttaacgtttt |
| gyrB-F | caaatgatcacagcatttggtacag |
| gyrB-R | cggcatcagtcataatgacgat |
| esxX-F | caactggtacggcaatcggt |
| esxX-R | tgacttgccaccaacaatctt |
| EsxX-EcoR1-F | gaggaattcatggggaataaaataaaaatgtcag |
| EsxX-BamH1-R | Gagggatccttaaaatacattgcttaacgtttt |