Fuqing Wu1, Ri-Qi Su1,2, Ying-Cheng Lai2,3,4, Xiao Wang1. 1. School of Biological and Health Systems Engineering, Arizona State University, Tempe, United States. 2. School of Electrical, Computer and Energy Engineering, Arizona State University, Tempe, United States. 3. Institute for Complex Systems and Mathematical Biology, King's College, University of Aberdeen, Aberdeen, United Kingdom. 4. Department of Physics, Arizona State University, Tempe, United States.
Abstract
The process of cell fate determination has been depicted intuitively as cells travelling and resting on a rugged landscape, which has been probed by various theoretical studies. However, few studies have experimentally demonstrated how underlying gene regulatory networks shape the landscape and hence orchestrate cellular decision-making in the presence of both signal and noise. Here we tested different topologies and verified a synthetic gene circuit with mutual inhibition and auto-activations to be quadrastable, which enables direct study of quadruple cell fate determination on an engineered landscape. We show that cells indeed gravitate towards local minima and signal inductions dictate cell fates through modulating the shape of the multistable landscape. Experiments, guided by model predictions, reveal that sequential inductions generate distinct cell fates by changing landscape in sequence and hence navigating cells to different final states. This work provides a synthetic biology framework to approach cell fate determination and suggests a landscape-based explanation of fixed induction sequences for targeted differentiation.
The process of cell fate determination has been depicted intuitively as cells travelling and resting on a rugged landscape, which has been probed by various theoretical studies. However, few studies have experimentally demonstrated how underlying gene regulatory networks shape the landscape and hence orchestrate cellular decision-making in the presence of both signal and noise. Here we tested different topologies and verified a synthetic gene circuit with mutual inhibition and auto-activations to be quadrastable, which enables direct study of quadruple cell fate determination on an engineered landscape. We show that cells indeed gravitate towards local minima and signal inductions dictate cell fates through modulating the shape of the multistable landscape. Experiments, guided by model predictions, reveal that sequential inductions generate distinct cell fates by changing landscape in sequence and hence navigating cells to different final states. This work provides a synthetic biology framework to approach cell fate determination and suggests a landscape-based explanation of fixed induction sequences for targeted differentiation.
Entities:
Keywords:
E. coli; Waddington landscape; cell fate programming; computational biology; quadrastability; sequential induction; synthetic gene network; systems biology
Multistability is a mechanism that cells use to achieve a discrete number of mutually exclusive states in response to environmental inputs, such as the lysis/lysogeny switch of phage lambda (Arkin et al, 1998; Oppenheim et al., 2005) and sporulation/competence in Bacillus subtilis (Süel et al., 2006; Schultz et al., 2009). In multicellular organisms, multistable switches are also common in the cellular decision-making including the regulation of cell-cycle oscillator during cell mitosis (Pomerening et al., 2003), Epithelial-to-Mesenchymal transition and cancer metastasis (Jolly et al., 2016; Lee et al., 2014a), and the well-known cell differentiation process, which is a manifestation of cellular state determination in a multistable system (Laurent and Kellershohn, 1999; Guantes and Poyatos, 2008). However, loss of multistability can drive cells to acquire metastatic characteristics and stabilize highly proliferative, pathogenic cellular states in cancer (Lee et al., 2014b).C.H. Waddington hypothesized the ‘epigenetic landscape’ to explain canalization and fate determination mechanism during cell differentiation (Waddington, 1957). In this hypothesis, differentiation is depicted as a marble rolling down a landscape with multiple bifurcating valleys and eventually settles at one of the local minima, corresponding to terminally differentiated cells. More recent theoretical studies further proposed the local minima to be modeled as steady states or attractors of dynamical systems, which can be mathematically described using differential equations (Zhang and Wolynes, 2014; Li and Wang, 2013a). As such, cell differentiation can be interpreted as a state transition process on a multistable dynamic system. A myriad of theoretical analysis have investigated the functioning of such systems and quantified the Waddington landscape and developmental paths through computation of the probability landscape for the underlying gene regulatory networks (Li and Wang, 2013a; Wang et al., 2011; Li and Wang, 2013b; Ferrell, 2012; Bhattacharya et al., 2011; Macarthur et al., 2009; Huang et al., 2007). Recent studies also revealed that the potential landscape and the corresponding curl flux are crucial for determining the robustness and global dynamics of non-equilibrium biological networks (Wang, 2015; Xu et al., 2014; Wang et al., 2008). Furthermore, the multiple stable steady states have been predicted beyond the bistable switches with or without epigenetic effects, which is reflected in slow timescales (Wang, 2015; Xu et al., 2014; Li and Wang, 2013b; Feng and Wang, 2012; Wang et al., 2011; Feng et al., 2011). Experimental researches, however, mostly focus on bistable switches, involving transitions between only two states. And demonstrations, from a combination of experiments and computational modeling, for the existence and operation of such a landscape in a higher dimensional multistable system are still lacking. Moreover, it remains unknown how gene regulatory networks (GRNs), gene expression noise, and signal induction together shape the attractor landscape and determine a cell’s developmental trajectory to its final fates (Schmiedel et al., 2015; Tanouchi et al., 2015; Prindle et al., 2014; Chalancon et al., 2012; Murphy et al., 2010; Balázsi et al., 2011; Kramer and Fussenegger, 2005; Bennett et al., 2008; Maamar et al., 2007).Complex contextual connections of GRNs have impeded experimentally establishing the shape and function of the cell fate landscape. Rationally designed and tunable synthetic multistable gene networks in E. coli, however, could form well-characterized attractor landscapes to enable close experimental investigations of general principles of GRN regulated cellular state transitions. Since the functioning of these principles only requires the most fundamental aspects of gene expression regulation, they would also be applicable for cell differentiation regulations in mammalian cells. Here, we combine mathematical theory, numerical simulations, and synthetic biology to probe all possible sub-networks of mutually inhibitory network with positive autoregulations (MINPA, Figure 1A), which has been hypothesized to have multistability potentials (Guantes and Poyatos, 2008; Huang et al., 2007). Moreover, MINPA and its sub-networks are recurring motifs enriched in GRNs regulating hematopoietic development (Gata1-Pu.1, [Graf and Enver, 2009]), trophectoderm differentiation (Oct3/4-Cdx2, [Niwa et al., 2005]), endoderm formation (Gata6-Nanog, [Bessonnard et al., 2014; Li and Wang, 2013a]), and bone, cartilage, and fat differentiation (RUNX2-SOX9-PPAR-γ, [MacArthur et al., 2008; Rabajante and Babierra, 2015]).
Figure 1.
Conceptual and experimental design of MINPA and its sub-networks.
(A) Abstract diagram of MINPA topology, where X and Y mutually inhibit (T-bars) each other and auto-activate (arrowheads) itself. Four inducers to regulate the four color-coded regulatory edges are also listed. (B) Molecular implementation of the MINPA network. Para/lac (purple arrow) is activated by AraC (yellow) and repressed by LacI (light green), while Plux/tet (cyan arrow) is activated by LuxR (blue) and repressed by TetR (red). Arabinose and AHL (oval) can induce AraC and LuxR activation, respectively. IPTG and aTc (hexagon) can respectively relieve LacI and TetR inhibition. GFP and mCherry serve as the readout of Para/lac and Plux/tet, respectively. Therefore, TetR and AraC collectively form the node X in (A), color-coded as purple rectangle. Similarly, LuxR and LacI collectively form the node Y in (A), color-coded as cyan rectangle. Genes, promoters and regulations are color-coded corresponding to the topology in (A). (C) List of MINPA and its 14 sub-networks. Numbering of indices is converted from topologies’ binary name (see Figure 1—figure supplement 1E for more details). T represents ‘topology’. R represents ‘repression’, and A represents ‘autoactivation’. Superscript is used to describe the number of such types of edges. Topologies with shaded background were later constructed and analyzed experimentally. (D–E) Dynamic responses for Para/lac (D) and Plux/tet (E) through induction with Arabinose (Ara) and IPTG, and AHL and aTc, respectively. Presented data was the mean value of three replicates. mCherry and GFP serves as the readout of the two promoters.
DOI:
http://dx.doi.org/10.7554/eLife.23702.003
(A) Abstract diagrams and molecular implementation of the eight MINPA sub-network topologies, including tunable positive feedbacks (T6 and T9), mutual inhibition (T5), dual-positive feedbacks (T10), and their combinations (T7, T11, T13, and T14). Genes, promoters, and regulations are color-coded corresponding to the topology on the left side. (B–C) Biological devices for testing promoter Para/lac (B) and Plux/tet (C), respectively. Fluorescence was measured by flow cytometry at 12 hr and 24 hr (not shown) after adding the inducers. All the data points were averaged from three repeated experiments. Grey arrows represent constitutive promoters (BBa_K176009). (D) Principle components and optimal Hill functions fitted for hybrid promoter Para/lac and Plux/tet. (E) List of MINPA and its 14 sub-networks, which are named, and color-coded, as binary numbers based on the existence of regulatory edges. (F) Topological hierarchy of the 15 motifs. (G) Probability of multistability (tristability and quadrastability) for the nine experimentally constructed networks. SSS: stable steady states. The range for activation/repression strength is [0.3, 0.8], and the probability was calculated from the number of parameter sets giving rise to multistability over 2000-repeated computational simulations. (H) Histograms for parameter combination that have multistability in sub-networks of T10, T13, T14 and T15 (MINPA). For each sub-network, the network activation and inhibition strength Sa, Su, St and Sl are randomly selected from given ranges and the number of corresponding SSS is recorded. We repeat this procedure for all sub-networks for 2000 times and calculate the probabilities of bistability (blue lines), tristability (black lines) and quadrastability (red lines). (I) Scatter plots for all parameter combinations that have multistability in MINPA. We generate parameters using the same approach as (H) and select the parameter combinations that can generate three or four SSS in MINPA.
DOI:
http://dx.doi.org/10.7554/eLife.23702.004
Conceptual and experimental design of MINPA and its sub-networks.
(A) Abstract diagram of MINPA topology, where X and Y mutually inhibit (T-bars) each other and auto-activate (arrowheads) itself. Four inducers to regulate the four color-coded regulatory edges are also listed. (B) Molecular implementation of the MINPA network. Para/lac (purple arrow) is activated by AraC (yellow) and repressed by LacI (light green), while Plux/tet (cyan arrow) is activated by LuxR (blue) and repressed by TetR (red). Arabinose and AHL (oval) can induce AraC and LuxR activation, respectively. IPTG and aTc (hexagon) can respectively relieve LacI and TetR inhibition. GFP and mCherry serve as the readout of Para/lac and Plux/tet, respectively. Therefore, TetR and AraC collectively form the node X in (A), color-coded as purple rectangle. Similarly, LuxR and LacI collectively form the node Y in (A), color-coded as cyan rectangle. Genes, promoters and regulations are color-coded corresponding to the topology in (A). (C) List of MINPA and its 14 sub-networks. Numbering of indices is converted from topologies’ binary name (see Figure 1—figure supplement 1E for more details). T represents ‘topology’. R represents ‘repression’, and A represents ‘autoactivation’. Superscript is used to describe the number of such types of edges. Topologies with shaded background were later constructed and analyzed experimentally. (D–E) Dynamic responses for Para/lac (D) and Plux/tet (E) through induction with Arabinose (Ara) and IPTG, and AHL and aTc, respectively. Presented data was the mean value of three replicates. mCherry and GFP serves as the readout of the two promoters.
Figure 1—figure supplement 1.
Experimental design, topological hierarchy and multistability probability analysis of MINPA sub-networks.
(A) Abstract diagrams and molecular implementation of the eight MINPA sub-network topologies, including tunable positive feedbacks (T6 and T9), mutual inhibition (T5), dual-positive feedbacks (T10), and their combinations (T7, T11, T13, and T14). Genes, promoters, and regulations are color-coded corresponding to the topology on the left side. (B–C) Biological devices for testing promoter Para/lac (B) and Plux/tet (C), respectively. Fluorescence was measured by flow cytometry at 12 hr and 24 hr (not shown) after adding the inducers. All the data points were averaged from three repeated experiments. Grey arrows represent constitutive promoters (BBa_K176009). (D) Principle components and optimal Hill functions fitted for hybrid promoter Para/lac and Plux/tet. (E) List of MINPA and its 14 sub-networks, which are named, and color-coded, as binary numbers based on the existence of regulatory edges. (F) Topological hierarchy of the 15 motifs. (G) Probability of multistability (tristability and quadrastability) for the nine experimentally constructed networks. SSS: stable steady states. The range for activation/repression strength is [0.3, 0.8], and the probability was calculated from the number of parameter sets giving rise to multistability over 2000-repeated computational simulations. (H) Histograms for parameter combination that have multistability in sub-networks of T10, T13, T14 and T15 (MINPA). For each sub-network, the network activation and inhibition strength Sa, Su, St and Sl are randomly selected from given ranges and the number of corresponding SSS is recorded. We repeat this procedure for all sub-networks for 2000 times and calculate the probabilities of bistability (blue lines), tristability (black lines) and quadrastability (red lines). (I) Scatter plots for all parameter combinations that have multistability in MINPA. We generate parameters using the same approach as (H) and select the parameter combinations that can generate three or four SSS in MINPA.
DOI:
http://dx.doi.org/10.7554/eLife.23702.004
DOI:
http://dx.doi.org/10.7554/eLife.23702.003
Experimental design, topological hierarchy and multistability probability analysis of MINPA sub-networks.
(A) Abstract diagrams and molecular implementation of the eight MINPA sub-network topologies, including tunable positive feedbacks (T6 and T9), mutual inhibition (T5), dual-positive feedbacks (T10), and their combinations (T7, T11, T13, and T14). Genes, promoters, and regulations are color-coded corresponding to the topology on the left side. (B–C) Biological devices for testing promoter Para/lac (B) and Plux/tet (C), respectively. Fluorescence was measured by flow cytometry at 12 hr and 24 hr (not shown) after adding the inducers. All the data points were averaged from three repeated experiments. Grey arrows represent constitutive promoters (BBa_K176009). (D) Principle components and optimal Hill functions fitted for hybrid promoter Para/lac and Plux/tet. (E) List of MINPA and its 14 sub-networks, which are named, and color-coded, as binary numbers based on the existence of regulatory edges. (F) Topological hierarchy of the 15 motifs. (G) Probability of multistability (tristability and quadrastability) for the nine experimentally constructed networks. SSS: stable steady states. The range for activation/repression strength is [0.3, 0.8], and the probability was calculated from the number of parameter sets giving rise to multistability over 2000-repeated computational simulations. (H) Histograms for parameter combination that have multistability in sub-networks of T10, T13, T14 and T15 (MINPA). For each sub-network, the network activation and inhibition strength Sa, Su, St and Sl are randomly selected from given ranges and the number of corresponding SSS is recorded. We repeat this procedure for all sub-networks for 2000 times and calculate the probabilities of bistability (blue lines), tristability (black lines) and quadrastability (red lines). (I) Scatter plots for all parameter combinations that have multistability in MINPA. We generate parameters using the same approach as (H) and select the parameter combinations that can generate three or four SSS in MINPA.DOI:
http://dx.doi.org/10.7554/eLife.23702.004
Results
MINPA circuit construction and multistability analysis
Engineered circuits of MINPA (Figure 1B) and its sub-networks (Figure 1—figure supplement 1A) are designed to use two hybrid promoters, Para/lac and Plux/tet, which are characterized experimentally to show small leakage and high nonlinearity (Figure 1D–E and Figure 1—figure supplement 1B–D). For MINPA topology, hybrid promoter Para/lac drives AraC and TetR expression, representing the node X in Figure 1A, whereas Plux/tet controls LuxR and LacI transcription, representing the node Y. AraC and LuxR activate Para/lac and Plux/tet in the presence of Arabinose and AHL (3oxo-C6-HSL) respectively, forming positive autoregulations. IPTG inhibits the repressive effect of LacI on TetR expression, while aTc counteracts TetR repression on LacI. Hence, the two nodes form the topology presented in the conceptual design shown in Figure 1A. Green fluorescent protein (GFP) and mCherry serve as the corresponding readouts of Plux/tet and Para/lac activities in living cells (Figure 1B).Topologies of MINPA and all its subnetworks can be divided into four layers, from one- to four-dimensional networks based on the number of regulatory edges (Figure 1C and Figure 1—figure supplement 1E–F) and further categorized into nine groups based on the configurations of activation and inhibition. By computationally searching a large parameter range for each of the nontrivial networks (Faucon et al., 2014), we found that networks with two auto-activations, including A2, RA2, R2A2, have high probability of tristability or quadrastability (Figure 1—figure supplement 1G), defined as having three or four stable steady sates (SSS) under a common induction condition. However, MINPA has broader parameter distributions than the other two (Figure 1—figure supplement 1H–I), which suggests it is more resistant to parameter change and thus likely to achieve multistability in experimental settings.
Systematical multistability evaluation of MINPA and its sub-networks
In order to experimentally evaluate dynamic properties of these networks, we constructed nine circuits including tunable positive feedbacks (T6 and T9), mutual inhibition (T5), dual-positive feedbacks (T10), and their combinations (T7, T11, T13, T14 and T15). One-dimensional networks (T1, T4, T2 and T8) and trivial two-dimensional networks (T3 and T12) are excluded for their low multistability probability. All motifs were constructed using the same set of components (Figure 1).Probing a circuit’s multistability typically requires thorough hysteresis experiments covering wide ranges of doses for all inducers (Acar et al., 2005; Angeli et al., 2004; Gardner et al., 2000), which becomes infeasible for nine complex networks with four inducers. To improve the efficiency of probing multistability and tunability, we designed a ‘sequential induction’ method to accelerate exploration of unknown high dimensional bifurcation spaces (see Appendix text for details), instead of conventional ‘back and forth’ hysteresis on one parameter dimension. The main concept relies on the fact that multistable gene networks could exhibit discontinuous jump from one state to another in response to changing parameter (inducer) combinations. Taking the classic ‘toggle switch’ as an example (Gardner et al., 2000), the circuit can be tuned by two external inducers and its two-parameter bifurcation diagram has a stretched S shape (Figure 2A). Initialized at an arbitrary state A, the cells could reach State C in the bistable region directly when induced with both inducers simultaneously. If the cells are first induced by Inducer I to go to state B, they will also reach State C after Inducer II is added. However, if the same dose of Inducer II is applied first, cells will cross the bifurcation plane to state D on the low-Response surface and then reach state E with addition of Inducer I (Figure 2A). State C and E are two different steady states with the same induction dosages, illustrating hysteresis and verifying multistability.
Figure 2.
Sequential induction of MINPA and its sub-networks.
(A) Schematic illustration of rationale for sequential induction. This two-parameter bifurcation diagram of a bistable toggle-switch depicts all steady state values of response (Z-axis) with combinations of inducer I and II (X and Y axes). Arrows illustrate order and direction of inductions and consequent steady state value changes. Solid lines on the X-Y plane are the boundaries of bistability. Dashed lines on the X-Y plane are projections of solid white arrowheads. (B) Arabinose (Ara) and IPTG were sequentially (left and middle columns) or simultaneously (right column) applied to induce T9, T13, T11, and T15. T: topology. The concentration of Arabinose and IPTG is 2.5*10−5m/v, and 5*10−5 M, respectively. To indicate the effects of inducers, we used the same color for applied inducers and its regulated connections, which were also shown in bold lines. The other non-regulated connections are represented by thin lines. (C) AHL and aTc were sequentially (left and middle) or simultaneously (right) applied to induce T6, T7, T14, and T15. The concentration of AHL and aTc is 1*10−4 M, and 200 ng/ml, respectively. (D) Ara and AHL were sequentially (left and middle) or simultaneously (right) applied to induce T10, T14, T11, and T15. The concentration of Arabinose and AHL is 2.5*10−5m/v, and 1*10−8 M, respectively. Samples were treated with the first inducer till OD600 is about 0.15 and then the second inducer was added. Cells were grown for another 24 hr before measured by flow cytometry. The experiments were performed in triplicate and repeated two times, and representative results are presented. The inducers are color-coded as visual assistance to indicate which edge of inset diagram it regulates.
DOI:
http://dx.doi.org/10.7554/eLife.23702.005
(A) Abstract diagram and molecular implementation of the toggle switch circuit. TetR (R) and LacI (I) mutually inhibit each other through binding to Ptet and Plac promoter, respectively. IPTG and aTc (hexagon) can respectively relieve LacI and TetR inhibition. GFP serves as the readout of Ptet. (B) Time course results of the sequential induction. The y-axis represents forward scatter (FSC-A), and the x-axis indicates GFP fluorescence. IPTG and aTc were sequentially (left and middle columns) or simultaneously (right column) applied to induce the toggle circuit. The first inducer was added to the media for 5 hr, and then the second inducer was added. Fluorescence was measured by flow cytometry at 0 hr, 5 hr, 12 hr, and 24 hr after the second inducer was added into the cultures. The concentration of IPTG and aTc is 8*10−5 M, and 100 ng/ml, respectively. Experiments were repeated for at least three times, and representative results were shown.
DOI:
http://dx.doi.org/10.7554/eLife.23702.006
(A) Arabinose (Ara) and IPTG were sequentially (left and middle columns) or simultaneously (right column) applied to induce T15. The first inducer was applied for 5 hr, and then the second inducer was added into the culture. Fluorescence was measured by flow cytometry at 0 hr, 12 hr, and 24 hr after the second inducer was added into the culture. The concentration of Ara and IPTG is 2.5*10−5m/v, and 5*10−5 M, respectively. (B) AHL and aTc were sequentially (left and middle) or simultaneously (right) applied to induce T15. The first inducer was applied for 6.5 hr, and then the second inducer was added into the culture. The concentration of AHL and aTc is 1*10−4 M, and 200 ng/ml, respectively. (C) Ara and AHL were sequentially (left and middle) or simultaneously (right) applied to induce T15. The first inducer was applied for 5 hr, and then the second inducer was added into the culture. The concentration of Arabinose and AHL is 2.5*10−5m/v, and 1*10−8 M, respectively. (D) IPTG and aTc were sequentially (left and middle) or simultaneously (right) applied to induce T15. The first inducer was applied for 6.5 hr, and then the second inducer was added into the culture. The concentration of IPTG and aTc is 1*10−4 M, and 200 ng/ml, respectively. Fluorescence was measured by flow cytometry at 0 hr, 12 hr, and 24 hr after the second inducer was added into the culture. The inducers are color-coded as visual assistance to indicate which edge of inset diagram it regulates.
DOI:
http://dx.doi.org/10.7554/eLife.23702.007
Left: IPTG was first applied to induce the circuits, and then aTc was added; Middle: aTc was first applied to induce the circuits, and then IPTG was added; Right: IPTG and aTc were added simultaneously into the medium. The concentration of IPTG and aTc is 1*10−4 M and 200 ng/ml, respectively. Samples were treated with the first inducer for 6.5 hr and then the second inducer was added. Fluorescence was measured at 24 hr by flow cytometry.
DOI:
http://dx.doi.org/10.7554/eLife.23702.008
Sequential induction of MINPA and its sub-networks.
(A) Schematic illustration of rationale for sequential induction. This two-parameter bifurcation diagram of a bistable toggle-switch depicts all steady state values of response (Z-axis) with combinations of inducer I and II (X and Y axes). Arrows illustrate order and direction of inductions and consequent steady state value changes. Solid lines on the X-Y plane are the boundaries of bistability. Dashed lines on the X-Y plane are projections of solid white arrowheads. (B) Arabinose (Ara) and IPTG were sequentially (left and middle columns) or simultaneously (right column) applied to induce T9, T13, T11, and T15. T: topology. The concentration of Arabinose and IPTGis 2.5*10−5m/v, and 5*10−5 M, respectively. To indicate the effects of inducers, we used the same color for applied inducers and its regulated connections, which were also shown in bold lines. The other non-regulated connections are represented by thin lines. (C) AHL and aTc were sequentially (left and middle) or simultaneously (right) applied to induce T6, T7, T14, and T15. The concentration of AHL and aTcis 1*10−4 M, and 200 ng/ml, respectively. (D) Ara and AHL were sequentially (left and middle) or simultaneously (right) applied to induce T10, T14, T11, and T15. The concentration of Arabinose and AHL is 2.5*10−5m/v, and 1*10−8 M, respectively. Samples were treated with the first inducer till OD600 is about 0.15 and then the second inducer was added. Cells were grown for another 24 hr before measured by flow cytometry. The experiments were performed in triplicate and repeated two times, and representative results are presented. The inducers are color-coded as visual assistance to indicate which edge of inset diagram it regulates.DOI:
http://dx.doi.org/10.7554/eLife.23702.005
Experimental design and validation of sequential induction strategy in a synthetic toggle switch circuit.
(A) Abstract diagram and molecular implementation of the toggle switch circuit. TetR (R) and LacI (I) mutually inhibit each other through binding to Ptet and Plac promoter, respectively. IPTG and aTc (hexagon) can respectively relieve LacI and TetR inhibition. GFP serves as the readout of Ptet. (B) Time course results of the sequential induction. The y-axis represents forward scatter (FSC-A), and the x-axis indicates GFP fluorescence. IPTG and aTc were sequentially (left and middle columns) or simultaneously (right column) applied to induce the toggle circuit. The first inducer was added to the media for 5 hr, and then the second inducer was added. Fluorescence was measured by flow cytometry at 0 hr, 5 hr, 12 hr, and 24 hr after the second inducer was added into the cultures. The concentration of IPTG and aTc is 8*10−5 M, and 100 ng/ml, respectively. Experiments were repeated for at least three times, and representative results were shown.DOI:
http://dx.doi.org/10.7554/eLife.23702.006
Time course results of sequential induction for the MINPA (T15) circuit.
(A) Arabinose (Ara) and IPTG were sequentially (left and middle columns) or simultaneously (right column) applied to induce T15. The first inducer was applied for 5 hr, and then the second inducer was added into the culture. Fluorescence was measured by flow cytometry at 0 hr, 12 hr, and 24 hr after the second inducer was added into the culture. The concentration of Ara and IPTGis 2.5*10−5m/v, and 5*10−5 M, respectively. (B) AHL and aTc were sequentially (left and middle) or simultaneously (right) applied to induce T15. The first inducer was applied for 6.5 hr, and then the second inducer was added into the culture. The concentration of AHL and aTcis 1*10−4 M, and 200 ng/ml, respectively. (C) Ara and AHL were sequentially (left and middle) or simultaneously (right) applied to induce T15. The first inducer was applied for 5 hr, and then the second inducer was added into the culture. The concentration of Arabinose and AHL is 2.5*10−5m/v, and 1*10−8 M, respectively. (D) IPTG and aTc were sequentially (left and middle) or simultaneously (right) applied to induce T15. The first inducer was applied for 6.5 hr, and then the second inducer was added into the culture. The concentration of IPTG and aTcis 1*10−4 M, and 200 ng/ml, respectively. Fluorescence was measured by flow cytometry at 0 hr, 12 hr, and 24 hr after the second inducer was added into the culture. The inducers are color-coded as visual assistance to indicate which edge of inset diagram it regulates.DOI:
http://dx.doi.org/10.7554/eLife.23702.007
Sequential induction for circuits T5, T7, T13, and T15 with inducers IPTG and aTc.
Left: IPTG was first applied to induce the circuits, and then aTc was added; Middle: aTc was first applied to induce the circuits, and then IPTG was added; Right: IPTG and aTc were added simultaneously into the medium. The concentration of IPTG and aTcis 1*10−4 M and 200 ng/ml, respectively. Samples were treated with the first inducer for 6.5 hr and then the second inducer was added. Fluorescence was measured at 24 hr by flow cytometry.DOI:
http://dx.doi.org/10.7554/eLife.23702.008To test our theoretical analysis, a synthetic toggle switch circuit was constructed (Figure 2—figure supplement 1A). Following experimental design principles (see Appendix text for details), we designed a protocol to show the sequential induction effects. We first employed IPTG to induce the circuit for 5 hr, and then aTc was added. Time course results showed that cells stayed at low-GFP state till 24 hr (Figure 2—figure supplement 1B). However, cells induced with aTc first, and then IPTG mainly stayed at high-GFP state, another stable steady state under this condition. Simultaneous aTc and IPTG induction produced similar cell distributions. These results show that sequential induction can be used as a strategy to quickly explore a multistable potential landscape for complex non-equilibrium systems.
Figure 2—figure supplement 1.
Experimental design and validation of sequential induction strategy in a synthetic toggle switch circuit.
(A) Abstract diagram and molecular implementation of the toggle switch circuit. TetR (R) and LacI (I) mutually inhibit each other through binding to Ptet and Plac promoter, respectively. IPTG and aTc (hexagon) can respectively relieve LacI and TetR inhibition. GFP serves as the readout of Ptet. (B) Time course results of the sequential induction. The y-axis represents forward scatter (FSC-A), and the x-axis indicates GFP fluorescence. IPTG and aTc were sequentially (left and middle columns) or simultaneously (right column) applied to induce the toggle circuit. The first inducer was added to the media for 5 hr, and then the second inducer was added. Fluorescence was measured by flow cytometry at 0 hr, 5 hr, 12 hr, and 24 hr after the second inducer was added into the cultures. The concentration of IPTG and aTc is 8*10−5 M, and 100 ng/ml, respectively. Experiments were repeated for at least three times, and representative results were shown.
DOI:
http://dx.doi.org/10.7554/eLife.23702.006
Without knowing the exact bifurcation range beforehand, such ordered sequential inductions could help quickly explore the irregular bifurcation space to reveal multistability for systems with complicated bifurcations, which is typically caused by interfering parameters. Similar sequential induction techniques have been shown to enable access of otherwise hard-to-reach cell death states in breast cancer cells (Lee et al., 2012). This strategy has also been widely employed in directed differentiation of stem cells to specific lineages (Paşca et al., 2015; Pagliuca et al., 2014; Kroon et al., 2008) and reprogramming somatic cells to induced pluripotent stem cells (Liu et al., 2013). Although specific inducer concentrations are required to observe the effects of this strategy in synthetic circuits, sequential induction with pre-selected inducer combinations can help perform a coarse-grained exploration from different directions in the parameter space. Furthermore, stochastic gene expression of the circuits also contributes to cellular population distribution thus leads to pronounced sequential induction effects, given experimentally feasible amount of time, when the system is entering its multistable region from different directions. Therefore, distinct final states, or even different population distributions, under sequential induction strongly suggests the existence of nonlinear dynamics, including multistability (see Appendix text for details).Using the sequential induction approach, we tested the nine circuits using flow cytometry. Cells were first induced by inducer I, inducer II was then added into the media for another 24 hr. Depending on the network configuration, four different dual-inducer combinations were used. For example, Arabinose and IPTG were applied sequentially and simultaneously to T9, T13, T11 and T15, respectively (Figure 2B). It can be seen only T15 exhibits significant expression difference between three induction patterns, while the others show little change (Figure 2B and Figure 2—figure supplement 2A). It should be noted that T15 also exhibits tri-modality of fluorescence expression, suggesting multistability given the presence of gene expression noise, which is partially consistent with our computational predictions. Similarly, AHL and aTc were applied to T6, T7, T14, and T15, respectively (Figure 2C and Figure 2—figure supplement 2B). Results show that only T15 exhibits significant fluorescence pattern change with different inductions, whereas T6 and T7 exhibit minor uniform shifts of expression. T14, although exhibiting bimodality, only shows a ratio change of two populations between three inductions and no sign of bifurcation. Sequential induction by Arabinose and AHL combinations has little effect on T10, T14 and T11, but T15 displays three notable populations for AHL-then-Arabinose induction (Figure 2D and Figure 2—figure supplement 2C). IPTG and aTc were also tested on T5, T7, T13 and T15, but no notable dynamics were observed (Figure 2—figure supplement 2D and Figure 2—figure supplement 3). Taken together, T15, the full MINPA topology, shows the most variety and complexity in population heterogeneity under sequential inductions, suggesting this circuit has the highest potential to generate complex multistability within our induction range and hence enable us to approach the Waddington landscape.
Figure 2—figure supplement 2.
Time course results of sequential induction for the MINPA (T15) circuit.
(A) Arabinose (Ara) and IPTG were sequentially (left and middle columns) or simultaneously (right column) applied to induce T15. The first inducer was applied for 5 hr, and then the second inducer was added into the culture. Fluorescence was measured by flow cytometry at 0 hr, 12 hr, and 24 hr after the second inducer was added into the culture. The concentration of Ara and IPTG is 2.5*10−5m/v, and 5*10−5 M, respectively. (B) AHL and aTc were sequentially (left and middle) or simultaneously (right) applied to induce T15. The first inducer was applied for 6.5 hr, and then the second inducer was added into the culture. The concentration of AHL and aTc is 1*10−4 M, and 200 ng/ml, respectively. (C) Ara and AHL were sequentially (left and middle) or simultaneously (right) applied to induce T15. The first inducer was applied for 5 hr, and then the second inducer was added into the culture. The concentration of Arabinose and AHL is 2.5*10−5m/v, and 1*10−8 M, respectively. (D) IPTG and aTc were sequentially (left and middle) or simultaneously (right) applied to induce T15. The first inducer was applied for 6.5 hr, and then the second inducer was added into the culture. The concentration of IPTG and aTc is 1*10−4 M, and 200 ng/ml, respectively. Fluorescence was measured by flow cytometry at 0 hr, 12 hr, and 24 hr after the second inducer was added into the culture. The inducers are color-coded as visual assistance to indicate which edge of inset diagram it regulates.
DOI:
http://dx.doi.org/10.7554/eLife.23702.007
Figure 2—figure supplement 3.
Sequential induction for circuits T5, T7, T13, and T15 with inducers IPTG and aTc.
Left: IPTG was first applied to induce the circuits, and then aTc was added; Middle: aTc was first applied to induce the circuits, and then IPTG was added; Right: IPTG and aTc were added simultaneously into the medium. The concentration of IPTG and aTc is 1*10−4 M and 200 ng/ml, respectively. Samples were treated with the first inducer for 6.5 hr and then the second inducer was added. Fluorescence was measured at 24 hr by flow cytometry.
DOI:
http://dx.doi.org/10.7554/eLife.23702.008
Bifurcation and hysteresis verification of multistability
Next, operating principles and full tunability of T15 (MINPA) were further examined by using four inducers (Arabinose, AHL, aTc, and IPTG) to fine tune the strength of regulations and perturb the system (Figure 3A). Uninduced cells showed low GFP and low mCherry expression (low-low state, LL). In the presence of AHL and aTc, high GFP and low mCherry (GFP state) is observed; low GFP and high mCherry (mCherry state) emerged with induction of Arabinose; and high GFP and high mCherry (high-high state, HH) was achieved when induced with Arabinose and AHL. These results verify that our engineered MINPA circuit is functioning as designed and fully controllable with four distinct states reachable through appropriate inductions, respectively.
Figure 3.
Bifurcation analysis and hysteresis of MINPA.
(A) Engineered MINPA is tunable to reach four individual states: low-low, GFP, mCherry, and high-high, under no induction, 1*10−4 M AHL and 100 ng/ml aTc, 2.5*10−5 (m/v) Arabinose, 1*10−4 M AHL and 2.5*10−3 (m/v) Arabinose, and respectively. To indicate the effects of inducers, we used the same color for applied inducer and its regulated connection (bolder lines) in the MINPA topology. The other non-regulated connections are represented by thin lines. (B) 3-D bifurcation diagram of MINPA. AR/AL is a lumped parameter composed of increasing concentrations of Arabinose and AHL, but the ratio of Arabinose and AHL is fixed, i.e., [Arabinose]/[AHL] is a constant. GFP and mCherry represent the states of node X and Y. Blue lines represent stable steady states, while red ones are unstable steady states. Grey, green, rose, and golden spheres represent low-low, GFP, mCherry, and high-high state, respectively. And the size of spheres correlates with the attractiveness of each state. C1, C2, C3, and C4 are four increasing concentrations of Arabinose and AHL used for experimental probing. (C–D) Hysteresis results of MINPA under induction of AR/AL. C1LL-C4LL: cells with low-low initial state (C) are induced with AR/AL at C1 to C4; C1HH-C4HH: cells with high-high initial state (D) are induced with AR/AL for 24 hr at C1 to C4. C1: no inducers; C2: 2.5*10−6m/v Arabinose and 1*10−7 M AHL; C3: 2.5*10−5m/v Arabinose and 1*10−6 M AHL; C4: 2.5*10−3m/v Arabinose and 1*10−4 M AHL. Arabinose and AHL were added at the same time to induce the cells. 100,000 cells were recorded for each sample by flow cytometry.
DOI:
http://dx.doi.org/10.7554/eLife.23702.009
The circuit’s quadrastability is illustrated as four similar-sized colored spheres on the same gray plane, which represents the low-low, GFP, mCherry, and high-high state, respectively. Blue lines represent stable steady states, while red ones are unstable steady states. Grey, green, rose, and golden spheres represent low-low, GFP, mCherry, and high-high state, respectively. And the size of spheres correlates with the attractiveness of each state. C2: 2.5*10−6m/v Arabinose and 1*10−7 M AHL.
DOI:
http://dx.doi.org/10.7554/eLife.23702.010
(A–D) One-dimensional bifurcation analysis for all four inducers in MINPA. We perform bifurcation analysis for each inducer while setting the concentration of other inducers to be very small (10−10). The blue curves are branches of stable steady states (SSS), while the red curves are branches of unstable steady states (USS). The bifurcation analyses are performed using Matlab. (E–H) Dual induction bifurcation analysis for Arabinose and AHL in MINPA. We perform bifurcation analysis for dual induction of different β (see Appendix for details). The blue curves are branches of SSS, while the red curves are branches of unstable steady states. (I) Hysteresis of MINPA for initial low-low state cells with induction of Arabinose and AHL. Cells with initial low-low state were induced with a series of concentrations of Arabinose (from 2.5*10−6m/v to 2.5*10−5m/v to 2.5*10−3m/v) and AHL (from 1*10−7 M to 1*10−6 M to 1*10−4 M). Data circled by red rectangles are shown in Figure 3C. Cells were grown for 24 hr before measured by flow cytometry. 10,000 events were recorded. (J) Hysteresis of MINPA for initial high-high state cells with induction of Arabinose and AHL. Initial high-high state cells were collected from the initial low-low state cells induced with 2.5*10−3m/v Arabinose and 1*10−4 M AHL for 12 hr. Cellular states were then monitored by flow cytometry to ensure its high-high state profile. The high-high state cells were washed and then inoculated into fresh medium with the same concentrations of Arabinose and AHL (from 2.5*10−6m/v to 2.5*10−5m/v to 2.5*10−3m/v) and AHL (from 1*10−7 M to 1*10−6 M to 1*10−4 M). Data circled by red rectangles are shown in Figure 3D. Cells were grown for 24 hr before measured by flow cytometry. 10,000 events were recorded.
DOI:
http://dx.doi.org/10.7554/eLife.23702.011
Bifurcation analysis and hysteresis of MINPA.
(A) Engineered MINPA is tunable to reach four individual states: low-low, GFP, mCherry, and high-high, under no induction, 1*10−4 M AHL and 100 ng/ml aTc, 2.5*10−5 (m/v) Arabinose, 1*10−4 M AHL and 2.5*10−3 (m/v) Arabinose, and respectively. To indicate the effects of inducers, we used the same color for applied inducer and its regulated connection (bolder lines) in the MINPA topology. The other non-regulated connections are represented by thin lines. (B) 3-D bifurcation diagram of MINPA. AR/AL is a lumped parameter composed of increasing concentrations of Arabinose and AHL, but the ratio of Arabinose and AHL is fixed, i.e., [Arabinose]/[AHL] is a constant. GFP and mCherry represent the states of node X and Y. Blue lines represent stable steady states, while red ones are unstable steady states. Grey, green, rose, and golden spheres represent low-low, GFP, mCherry, and high-high state, respectively. And the size of spheres correlates with the attractiveness of each state. C1, C2, C3, and C4 are four increasing concentrations of Arabinose and AHL used for experimental probing. (C–D) Hysteresis results of MINPA under induction of AR/AL. C1LL-C4LL: cells with low-low initial state (C) are induced with AR/AL at C1 to C4; C1HH-C4HH: cells with high-high initial state (D) are induced with AR/AL for 24 hr at C1 to C4. C1: no inducers; C2: 2.5*10−6m/v Arabinose and 1*10−7 M AHL; C3: 2.5*10−5m/v Arabinose and 1*10−6 M AHL; C4: 2.5*10−3m/v Arabinose and 1*10−4 M AHL. Arabinose and AHL were added at the same time to induce the cells. 100,000 cells were recorded for each sample by flow cytometry.DOI:
http://dx.doi.org/10.7554/eLife.23702.009
Another view of the 3-D bifurcation diagram of MINPA at C2.
The circuit’s quadrastability is illustrated as four similar-sized colored spheres on the same gray plane, which represents the low-low, GFP, mCherry, and high-high state, respectively. Blue lines represent stable steady states, while red ones are unstable steady states. Grey, green, rose, and golden spheres represent low-low, GFP, mCherry, and high-high state, respectively. And the size of spheres correlates with the attractiveness of each state. C2: 2.5*10−6m/v Arabinose and 1*10−7 M AHL.DOI:
http://dx.doi.org/10.7554/eLife.23702.010
Bifurcation analysis for and hysteresis of MINPA with induction of Arabinose and AHL.
(A–D) One-dimensional bifurcation analysis for all four inducers in MINPA. We perform bifurcation analysis for each inducer while setting the concentration of other inducers to be very small (10−10). The blue curves are branches of stable steady states (SSS), while the red curves are branches of unstable steady states (USS). The bifurcation analyses are performed using Matlab. (E–H) Dual induction bifurcation analysis for Arabinose and AHL in MINPA. We perform bifurcation analysis for dual induction of different β (see Appendix for details). The blue curves are branches of SSS, while the red curves are branches of unstable steady states. (I) Hysteresis of MINPA for initial low-low state cells with induction of Arabinose and AHL. Cells with initial low-low state were induced with a series of concentrations of Arabinose (from 2.5*10−6m/v to 2.5*10−5m/v to 2.5*10−3m/v) and AHL (from 1*10−7 M to 1*10−6 M to 1*10−4 M). Data circled by red rectangles are shown in Figure 3C. Cells were grown for 24 hr before measured by flow cytometry. 10,000 events were recorded. (J) Hysteresis of MINPA for initial high-high state cells with induction of Arabinose and AHL. Initial high-high state cells were collected from the initial low-low state cells induced with 2.5*10−3m/v Arabinose and 1*10−4 M AHL for 12 hr. Cellular states were then monitored by flow cytometry to ensure its high-high state profile. The high-high state cells were washed and then inoculated into fresh medium with the same concentrations of Arabinose and AHL (from 2.5*10−6m/v to 2.5*10−5m/v to 2.5*10−3m/v) and AHL (from 1*10−7 M to 1*10−6 M to 1*10−4 M). Data circled by red rectangles are shown in Figure 3D. Cells were grown for 24 hr before measured by flow cytometry. 10,000 events were recorded.DOI:
http://dx.doi.org/10.7554/eLife.23702.011To help design experiments to further investigate the circuit’s quadrastability, a detailed mathematical model was developed to describe the system (see Appendix for details). Using parameters derived from hybrid promoter testing experiments, bifurcation analysis was carried out to systematically quantify MINPA’s dynamic behavior (Figure 3B, Figure 3—figure supplement 1 and Figure 3—figure supplement 2A–H). Figure 3B is the three-dimensional bifurcation diagram, where levels of GFP and mCherry represent the states of node X and Y, and ‘AR/AL’ is a lumped parameter composed of a fixed ratio of the concentrations of Arabinose and AHL. Overall, it can be seen that the system, initialized without induction, is predicted to be quadrastable (shown as four colored spheres, representing LL (grey), GFP (green), mCherry (rose), and HH (golden) state, respectively) but with the low-low state to have dominant attractiveness (shown as the big gray sphere) when AR/AL is low (C1). However, when AR/AL level is within an intermediate range, relative stabilities between different states become comparable. When AR/AL level increased from C1 to C2, the circuit’s quadrastability becomes well pronounced, illustrated as four similar-sized colored spheres on the same gray plane, which represents the low-low, GFP, mCherry, and high-high state, respectively (Figure 3—figure supplement 1). As AR/AL continues to increase from C2 to C3, while the other three SSS remain stable, the stability of the GFP branch disappears. Further increase of AR/AL results in only one stable state-the high-high state, shown as the orange sphere with biggest size.
Figure 3—figure supplement 1.
Another view of the 3-D bifurcation diagram of MINPA at C2.
The circuit’s quadrastability is illustrated as four similar-sized colored spheres on the same gray plane, which represents the low-low, GFP, mCherry, and high-high state, respectively. Blue lines represent stable steady states, while red ones are unstable steady states. Grey, green, rose, and golden spheres represent low-low, GFP, mCherry, and high-high state, respectively. And the size of spheres correlates with the attractiveness of each state. C2: 2.5*10−6m/v Arabinose and 1*10−7 M AHL.
DOI:
http://dx.doi.org/10.7554/eLife.23702.010
Figure 3—figure supplement 2.
Bifurcation analysis for and hysteresis of MINPA with induction of Arabinose and AHL.
(A–D) One-dimensional bifurcation analysis for all four inducers in MINPA. We perform bifurcation analysis for each inducer while setting the concentration of other inducers to be very small (10−10). The blue curves are branches of stable steady states (SSS), while the red curves are branches of unstable steady states (USS). The bifurcation analyses are performed using Matlab. (E–H) Dual induction bifurcation analysis for Arabinose and AHL in MINPA. We perform bifurcation analysis for dual induction of different β (see Appendix for details). The blue curves are branches of SSS, while the red curves are branches of unstable steady states. (I) Hysteresis of MINPA for initial low-low state cells with induction of Arabinose and AHL. Cells with initial low-low state were induced with a series of concentrations of Arabinose (from 2.5*10−6m/v to 2.5*10−5m/v to 2.5*10−3m/v) and AHL (from 1*10−7 M to 1*10−6 M to 1*10−4 M). Data circled by red rectangles are shown in Figure 3C. Cells were grown for 24 hr before measured by flow cytometry. 10,000 events were recorded. (J) Hysteresis of MINPA for initial high-high state cells with induction of Arabinose and AHL. Initial high-high state cells were collected from the initial low-low state cells induced with 2.5*10−3m/v Arabinose and 1*10−4 M AHL for 12 hr. Cellular states were then monitored by flow cytometry to ensure its high-high state profile. The high-high state cells were washed and then inoculated into fresh medium with the same concentrations of Arabinose and AHL (from 2.5*10−6m/v to 2.5*10−5m/v to 2.5*10−3m/v) and AHL (from 1*10−7 M to 1*10−6 M to 1*10−4 M). Data circled by red rectangles are shown in Figure 3D. Cells were grown for 24 hr before measured by flow cytometry. 10,000 events were recorded.
DOI:
http://dx.doi.org/10.7554/eLife.23702.011
To establish MINPA’s quadrastability and tristability as predicted, hysteresis, a hallmark of multistability (Acar et al., 2005; Wu et al., 2014, 2013), of the network was tested. Initialized at the low-low state, cells were induced by increasing doses of AR/AL corresponding to C1 to C4 and measured by flow cytometry (Figure 3C and Figure 3—figure supplement 2I). As predicted, C1LL (cells with initial Low-Low state grown at C1 condition) experiment demonstrates uniform low-low fluorescence profile, due to the low-low state’s dominant attractiveness, and C4LL shows a uniform high-high profile. Interestingly, C3LL indeed illustrates tri-modality, which is the result of predicted tristability. C2LL experiment, on the other hand, exhibits enough heterogeneity to signal high-high, low-low, and mCherry state, but does not illustrate significant trace of GFP state. Given that GFP state is achieved through combinational induction of AHL and aTc (Figure 3A), we hypothesize that the GFP state here is not easily accessible with AHL induction only. Next, cells initialized at high-high states were collected and diluted into fresh media with the same concentrations of AR/AL (Figure 3D and Figure 3—figure supplement 2J). As predicted, these cells keep high-high expression profile even with inductions as low as C1, another demonstration that the system is already multistable at C1. Taken together, the two sets of experiments demonstrated clear hysteresis and verified the existence of three of the four predicted SSS.
Experimental demonstration of model-guided quadrastability of MINPA
To further investigate what determines the accessibility of certain SSS in this quadrastable system and how cells navigate this attractor landscape, we take into account gene expression stochasticity (Wu et al., 2013) to sketch out MINPA’s quasi-potential attractor landscape (Figure 4A and Appendix), which is calculated as the negative logarithmic function of stationary distribution density in the phase space of GFP and mCherry. Using the weighted ensemble random walk algorithm (Appendix), the stationary density distribution can be efficiently calculated from the initial uniform distribution. It can be seen that when there is no inducer, MINPA is already quadrastable with four local minima, which is consistent with bifurcation analysis for C1 condition. Furthermore, the much stronger stability of the low-low state (deepest well, Top landscape) and high state-transition barrier explain homogeneous low-low population (C1 experiment in Figure 3C) when cells were initialized with no inductions.
Figure 4.
Model-guided quadrastability of MINPA through triple induction.
(A) Dynamic evolution of computed energy landscapes of MINPA under sequential/simultaneous inductions of Arabinose, and/or AHL and aTc. Center route: simultaneous induction with three inducers; Left route: sequential induction with AHL and aTc first, and then Arabinose. Right route: sequential induction with Arabinose, and then AHL and aTc. Deeper wells represent the higher stability of corresponding states. For each three-dimensional landscape, corresponding two-dimensional state-potential plots were also shown. Red line sketches the potentials from mCherry state to high-high to GFP state while green one represents the potentials from mCherry state to low-low to GFP states. mC: mCherry; HH: high-high; LL: low-low. GFP* and mCherry* is the computed GFP and mCherry abundance from the model. To indicate the effects of inducers, we used the same color for applied inducers and its regulated connections, which were also shown in bolder lines. (B–D) Experimental validations of model-predicted quadrastability using flow cytometry. Quadrastable steady states were observed when Arabinose, AHL, and aTc were simultaneously added into the media (B), corresponding to the Center route in A). Four populations were also observed when AHL and aTc were first added to growth media for 6.5 hr and then Arabinose was added, and cells were grown for another 24 hr before measurement (C), corresponding to the Left route in A). Bimodality (low-low and mCherry states) was generated when Arabinose was first applied and then AHL and aTc were added (D), corresponding to the Right route in A). Concentrations for Arabinose, AHL and aTc are 2.5*10−5m/v, 1*10−4 M, and 400 ng/ml, respectively. Representative results from three replicates are showed and 100,000 cells were recorded for each sample by flow cytometry.
DOI:
http://dx.doi.org/10.7554/eLife.23702.012
(A) Up left: Flow cytometry result for cells simultaneously induced with 2.5*10−5m/v Arabinose, 1*10−4 M AHL and 200 ng/ml aTc for 6.5 hr. Up right: Cells were first induced with 1*10−4 M and 400 ng/ml aTc for 6.5 hr, and then measured by flow cytometry. About 12% cells were moving from low-low state to GFP state at 6.5 hr. Bottom left: Cells were first induced with 2.5*10−5m/v Arabinose and no obvious state transition was observed at 6.5 hr. However, at 9.5 hr, most cells (84.6%) were transitioned to mCherry state (Bottom right). (B) Microfluidic setup and device design (adopted from Dr. Hasty lab (Ferry et al., 2011). (C) Images showing E.coli growing in the device. White arrows indicate the flow direction. (D) Time course of the cells growing and fluorescence state change with 2*10−4 M IPTG and 200 ng/ml aTc induction in the trap. The red flow is medium without inducer for 6 hr, and then cells switch to medium with inducers for 18 hr. Small white arrows show single cells with state change from GFP to mCherry. Magnification: 40x. (E) Time-course sequential induction with AHL, aTc first and then Arabinose (corresponding to the Left route in Figure 4A). The indicated time point is the time after Arabinose added into the culture. 10,000 events were recorded. The low-low state cells changed from 21.2% (12 h) to 24.6% (24 h) to 30.6% (36 h).
DOI:
http://dx.doi.org/10.7554/eLife.23702.013
Model-guided quadrastability of MINPA through triple induction.
(A) Dynamic evolution of computed energy landscapes of MINPA under sequential/simultaneous inductions of Arabinose, and/or AHL and aTc. Center route: simultaneous induction with three inducers; Left route: sequential induction with AHL and aTc first, and then Arabinose. Right route: sequential induction with Arabinose, and then AHL and aTc. Deeper wells represent the higher stability of corresponding states. For each three-dimensional landscape, corresponding two-dimensional state-potential plots were also shown. Red line sketches the potentials from mCherry state to high-high to GFP state while green one represents the potentials from mCherry state to low-low to GFP states. mC: mCherry; HH: high-high; LL: low-low. GFP* and mCherry* is the computed GFP and mCherry abundance from the model. To indicate the effects of inducers, we used the same color for applied inducers and its regulated connections, which were also shown in bolder lines. (B–D) Experimental validations of model-predicted quadrastability using flow cytometry. Quadrastable steady states were observed when Arabinose, AHL, and aTc were simultaneously added into the media (B), corresponding to the Center route in A). Four populations were also observed when AHL and aTc were first added to growth media for 6.5 hr and then Arabinose was added, and cells were grown for another 24 hr before measurement (C), corresponding to the Left route in A). Bimodality (low-low and mCherry states) was generated when Arabinose was first applied and then AHL and aTc were added (D), corresponding to the Right route in A). Concentrations for Arabinose, AHL and aTc are 2.5*10−5m/v, 1*10−4 M, and 400 ng/ml, respectively. Representative results from three replicates are showed and 100,000 cells were recorded for each sample by flow cytometry.DOI:
http://dx.doi.org/10.7554/eLife.23702.012
Cells’ states under induction with the first inducer, microfludic results to demonstrate quadrastability with IPTG and aTc induction, and time course of sequential induction of AHL, aTc and Ara.
(A) Up left: Flow cytometry result for cells simultaneously induced with 2.5*10−5m/v Arabinose, 1*10−4 M AHL and 200 ng/ml aTc for 6.5 hr. Up right: Cells were first induced with 1*10−4 M and 400 ng/ml aTc for 6.5 hr, and then measured by flow cytometry. About 12% cells were moving from low-low state to GFP state at 6.5 hr. Bottom left: Cells were first induced with 2.5*10−5m/v Arabinose and no obvious state transition was observed at 6.5 hr. However, at 9.5 hr, most cells (84.6%) were transitioned to mCherry state (Bottom right). (B) Microfluidic setup and device design (adopted from Dr. Hasty lab (Ferry et al., 2011). (C) Images showing E.coli growing in the device. White arrows indicate the flow direction. (D) Time course of the cells growing and fluorescence state change with 2*10−4 M IPTG and 200 ng/ml aTc induction in the trap. The red flow is medium without inducer for 6 hr, and then cells switch to medium with inducers for 18 hr. Small white arrows show single cells with state change from GFP to mCherry. Magnification: 40x. (E) Time-course sequential induction with AHL, aTc first and then Arabinose (corresponding to the Left route in Figure 4A). The indicated time point is the time after Arabinose added into the culture. 10,000 events were recorded. The low-low state cells changed from 21.2% (12 h) to 24.6% (24 h) to 30.6% (36 h).DOI:
http://dx.doi.org/10.7554/eLife.23702.013Since Arabinose and AHL combination is not sufficient to enable the cells to reach all four SSS, we chose to add aTc to the mix to further facilitate cell transitions among these four SSS. Using our expanded model, we simulated simultaneous and sequential inductions and computed corresponding quasi-potential landscape (Figure 4A), showing cells harboring the same MINPA network exhibiting distinct landscapes under different inductions. AHL and aTc promote a more stable GFP state (Left center), while Arabinose induction modulates the landscape to be biased toward mCherry state (Right center). When the three inducers were applied simultaneously, the landscape changes and the four states show comparable stabilities (Bottom), suggesting a higher possibility of quadramodal cell population experimentally. Experimental validation is shown as flow cytometry measurements of cells treated with Arabinose, AHL, and aTc simultaneously for 24 hr (Figure 4B, and Figure 4—figure supplement 1A). Such a hybrid induction greatly facilitates the cells’ transition from low-low state to the other three states so that a quadramodal distribution emerges. Single-cell time lapse microscopy results also showed that the initial low-low state cells could differentiate into GFP, mCherry and high-high state cells (Figure 4—figure supplement 1B–D and Appendix 1—Video 1). This also finally verifies predicted quadrastability of MINPA.
Figure 4—figure supplement 1.
Cells’ states under induction with the first inducer, microfludic results to demonstrate quadrastability with IPTG and aTc induction, and time course of sequential induction of AHL, aTc and Ara.
(A) Up left: Flow cytometry result for cells simultaneously induced with 2.5*10−5m/v Arabinose, 1*10−4 M AHL and 200 ng/ml aTc for 6.5 hr. Up right: Cells were first induced with 1*10−4 M and 400 ng/ml aTc for 6.5 hr, and then measured by flow cytometry. About 12% cells were moving from low-low state to GFP state at 6.5 hr. Bottom left: Cells were first induced with 2.5*10−5m/v Arabinose and no obvious state transition was observed at 6.5 hr. However, at 9.5 hr, most cells (84.6%) were transitioned to mCherry state (Bottom right). (B) Microfluidic setup and device design (adopted from Dr. Hasty lab (Ferry et al., 2011). (C) Images showing E.coli growing in the device. White arrows indicate the flow direction. (D) Time course of the cells growing and fluorescence state change with 2*10−4 M IPTG and 200 ng/ml aTc induction in the trap. The red flow is medium without inducer for 6 hr, and then cells switch to medium with inducers for 18 hr. Small white arrows show single cells with state change from GFP to mCherry. Magnification: 40x. (E) Time-course sequential induction with AHL, aTc first and then Arabinose (corresponding to the Left route in Figure 4A). The indicated time point is the time after Arabinose added into the culture. 10,000 events were recorded. The low-low state cells changed from 21.2% (12 h) to 24.6% (24 h) to 30.6% (36 h).
DOI:
http://dx.doi.org/10.7554/eLife.23702.013
Appendix 1—Video 1.
A time-lapse movie growing in the microfluidic chip for 24 hr.
Time course of the cells growing and fluorescence state change with 2*10−4 M IPTG and 200 ng/ml aTc induction in the trap. The red flow is medium without inducer for 6 hr, and then cells switch to medium with inducers for 18 hr. Magnification: 40x.
DOI:
http://dx.doi.org/10.7554/eLife.23702.018
There are two other strategies to reach this condition: sequential inductions with AHL-and-aTc and then Arabinose (Figure 4A, Left route) or Arabinose and then AHL-and-aTc (Right route). Even though the initial and final landscapes are the same, the dynamics for each route are quite different, which could lead to distinct outcomes. By comparing state barrier heights (Figure 4A), we hypothesize that cells walking through the left route would start transitioning from low-low state to GFP state upon induction of AHL and aTc. Following Arabinose induction would then make the mCherry state accessible. So some cells with GFP state would transition to high-high state while some low-low state cells transition to mCherry state, resulting in cells in all four states. Experimental testing indeed shows four stable populations (Figure 4C). At 6.5 hrs of AHL and aTc induction, about 12% cells were moving to GFP state while the rest of them still stay ‘undecided’ at low-low state (Figure 4—figure supplement 1A and E). This is consistent with the simulated landscape as these two states are more stable and accessible to each other (Figure 4A, Left). Arabinose induction promoted some cells to transition into mCherry state while some cells continued moving into GFP state, of which some further transitioned to high-high state.Interestingly, the right route is predicted to generate different results. When first induced with Arabinose, the mCherry valley is so deep that it would be difficult for cells to jump out to high-high state, and low-low state cells are also hardly transit to GFP state due to its low attractiveness, and thus most cells would stay at mCherry and low-low state even with AHL and aTc inductions (Figure 4A, Right). Experimental testing of the right route indeed only produces two populations with low-low and mCherry state (Figure 4D). With 5 hrs of Arabinose induction, most cells still stay at low-low state because of slow transition to the mCherry state (Figure 4—figure supplement 1A), but 84.6% cells transitioned to mCherry state with 15.3% cells at low-low state at 9.5 hr (Figure 4—figure supplement 1A). This is consistent with our model predictions. The high barrier between the mCherry state and high-high state blocks the transition from mCherry state to high-high state, while the low attractiveness and relatively high barrier of the GFP state also decreases the probability of cells transitioning from low-low to GFP state. Hence, when AHL and aTc are applied, cells are predominantly in the mCherry state with a small portion in low-low state with low probability of transitioning out, resulting in a bimodal distribution.
Discussion
Multistability and the resulting landscape has long been proposed as an underlying mechanism that cells use to maintain pluripotency and guide differentiation (Kauffman, 1993; Laurent and Kellershohn, 1999; Huang et al., 2007; Guantes and Poyatos, 2008; Palani and Sarkar, 2009; Narula et al., 2010; Faucon et al., 2014). Theoretical frameworks have also been established to quantify the Waddington landscape and biological paths for cell development (Li and Wang, 2013a, 2013b; Wang et al., 2011). Experimental validation of this hypothesis and a full understanding of this mechanism will help reveal differentiation dynamics and routes for all cell types, which remains an outstanding problem in biology.In this study, we engineered the quadrastable MINPA circuit and show that it can guide cell fate choices, represented by fluorescence expression, through shaping the potential landscape. MINPA represents one of the most complicated two-node network topologies and includes four genes to implement a web of regulations. Biological complexity correlates with the number of regulatory connections (Szathmáry et al., 2001), not the number of genes. Hence, dense connectivity and complex dynamics of MINPA may provide a framework to understand similarly densely connected gene regulatory networks.Combining mathematical modeling and experimental investigation, this study serves as a proof-of-principle demonstration of the Waddington landscape. Furthermore, we used this circuit to demonstrate how different sequential inductions can change the landscape in a specific order and navigate cells to different final states. Such illustrations suggest mechanistic explanations of the need for fixed induction sequences for targeted differentiation to desired cell lineage. Overall, this study helps reveal fundamental mechanisms of cell-fate determination and provide a theoretical foundation for systematic understanding of the cell differentiation process, which will lead to development of new strategies to program cell fate.
Materials and methods
Strains, Media, and Chemicals
All the molecular cloning experiments were performed in E.coli DH10B (Invitrogen, USA), and measurements of MINPA and sub-networks were conducted in E.coli K-12 MG1655ΔlacIΔaraCBAD strain as previously described (from Dr. Collins Lab [Litcofsky et al., 2012]). The sequential induction for the toggle circuit was conducted in E.coli MG1655ΔlacI strain as previously described (Litcofsky et al., 2012). Cells were grown at 37°C in liquid and/or solid Luria-Bertani broth medium with 100 µg/mL ampicillin or kanamycin. Chemicals AHL (3oxo-C6-HSL, Sigma-Aldrich), Arabinose (Sigma-Aldrich, USA), isopropyl β-D-1-thiogalactopyranoside (IPTG, Sigma-Aldrich), and anhydrotetracycline (aTc, Sigma-Aldrich) were dissolved in ddH2O and diluted into indicated working concentrations. Chemical aTc solution was stocked in brown vials, and experiments involving aTc were performed in cabinet without light, and cell cultures were grown in darken incubator at 37°C. Cultures were shaken in 5 mL and/or 15 mL tubes at 220 rotations per minute (r.p.m).
Plasmids construction
All the plasmids (MINPA and its nine sub-networks) in this study were constructed using standard molecular cloning protocols and assembled by standardized BioBricks methods based on primary modules (Table 1) from the iGEM Registry (www.parts.igem.org). Hybrid promoter Para/lac was from Dr. Collins lab and amplified using forward primer: CGGAATTCGCTTCTAGAGAATTGTGAGCGGATAAC; and reverse primer: CGCTGCAGGCACTAGTTTGTGTGAAATTGTTATCCG. PCR product was purified using GenElute PCR Clean-Up Kit (Sigma-Aldrich), and then cut by restriction enzymes EcoRI and PstI. The purified product was inserted into pSB1K3 backbone, and finally verified by DNA sequencing. The MINPA circuit was constructed from promoter Para/lac and nine other Biobrick standard biological parts: BBa_B0034 (ribosome binding site, RBS), BBa_C0080 (AraC gene), BBa_C0040 (tetR gene), BBa_K176000 (Plux/tet hybrid promoter), BBa_C0062 (luxR gene), BBa_C0012 (lacI gene), BBa_B0015 (transcriptional terminator), BBa_E0240 (GFP generator), and BBa_J06702 (mCherry generator). The fragment and vector were separated by gel electrophoresis (1% TAE agarose) and purified using GenElute Gel Extraction Kit (Sigma-Aldrich). Then, fragment and vector were ligated together using T4 DNA ligase, and the ligation products were transformed into E. coli DH10B and clones were screened by plating on 100 μg/ml ampicillin LB agar plates. Finally, their plasmids were extracted and verified by double digestion (EcoRI and PstI). The detailed procedures of assembling DNA constructs were described in our previous study (Wu et al., 2014). Restriction enzymes (EcoRI, XbaI, SpeI, and PstI) and T4 DNA ligase were purchased from New England Biolabs. All the constructs were inserted into high copy number plasmid pSB1A3 and pSB1K3. All the constructs were verified by DNA sequencing (Biodesign sequencing lab in ASU) step by step.
Table 1.
Components from the Registry of standard biological parts
DOI:
http://dx.doi.org/10.7554/eLife.23702.014
Biobrick number
Abbreviation in the paper
Description
BBa_C0080
AraC
AraC arabinose operon regulatory protein from E. coli
BBa_C0040
TetR
Tetracycline repressor from transposon Tn10
BBa_C0062
LuxR
LuxR activator from Aliivibrio fischeri
BBa_C0012
LacI
LacI repressor from E. coli
BBa_E0240
GFP
GFP generator
BBa_J06702
mCherry
RFP generator
BBa_K176002
Plux/tet
Hybrid promoter with LuxR/HSL- and TetR-binding sites
BBa_B0034
RBS
Ribosome binding site
BBa_B0015
Terminator
Transcriptional terminator (double)
BBa_K176009
CP
Constitutive promoter
pSB1K3
pSB1K3
High copy BioBrick assembly plasmid with kanamycin resistance
pSB1A3
pSB1A3
High copy BioBrick assembly plasmid with ampicillin resistance
Components from the Registry of standard biological partsDOI:
http://dx.doi.org/10.7554/eLife.23702.014
Flow cytometry
All the samples were analyzed at the indicated time points on an Accuri C6 flow cytometer (Becton Dickinson, USA) with excitation/emission filters (488/530 nm for GFP, and 610 LP for mCherry). The data were collected in a linear scale and non-cellular low-scatter noise was removed by thresholding. All measurements of gene expression were obtained from at least three independent experiments. For each culture, 100,000 events were collected at a slow flow rate. Data files were analyzed using MATLAB (MathWorks).
Sequential induction and hysteresis
For sequential induction, initially uninduced overnight cell culture was diluted into fresh media without or with inducer I, grown at 37°C and 220 r.p.m till OD600 is 0.15 ~ 0.25 (the time usually takes 5 ~ 6.5 hr, depends on the inducers and concentrations). For samples induced individually by Ara, or AHL, or IPTG, it is ~5 hr; for samples induced with aTc, it takes ~6.5 hr. According to our experience, gene (GFP) is starting to be partially expressed while steady states are not yet stable. Then inducer II was added into the culture, and grown for another 24 hr. Flow cytometry was performed at 0 hr, 12 hr, and 24 hr after the second inducer was added into the culture. For each set of sequential induction, the first scenario: add inducer I first, then add inducer II; the second scenario: add inducer II first, then add inducer I; the third scenario: add inducers I and II at the same time. As a control, cells without any inducer were also prepared and measured. Inducer I and II were the two of four commercial chemicals: AHL, Arabinose, IPTG, and aTc. All the experiments were repeated for at least three times and only representative results were showed.For hysteresis experiments, initially uninduced cells were diluted into fresh media and distributed into new 5 ml tubes. Various amounts of Arabinose and AHL (3oxo-C6-HSL) were added into the media, and cells were then grown at 37°C shaker. The initially high-high state cells induced with 2.5 *10−3 m/v Arabinose and 1*10−4 M AHL were collected with low-speed centrifugation, washed twice, resuspended with fresh medium, and at last inoculated into fresh medium at a 1:100 ratio with the same series of inducer (Arabinose and AHL) concentrations. C1, C2, C3, and C4 (Figure 3B–D) are four increasing concentrations of Arabinose and AHL used for experimental probing, but the ratio of Arabinose and AHL is fixed. Specifically, cells were induced with the Arabinose and AHL at the same time (the third scenario), at concentrations from C1 to C4. C1: no inducers; C2: 2.5*10−6m/v Arabinose and 1*10−7 M AHL; C3: 2.5*10−5m/v Arabinose and 1*10−6 M AHL; C4: 2.5*10−3m/v Arabinose and 1*10−4 M AHL. Flow cytometry analyses were performed at 12 hr and 24 hr to monitor the fluorescence levels. Experiments were repeated two times with three replicates.
Microfludics and microscopy
Cells with MINPA circuit were grown overnight, which was then re-diluted into 5 mL fresh LB medium with Kanamycin the next day. When OD600 of the cells reached about 0.2, cells were spun down with low speed and resuspended in 5 ml of fresh medium and loaded into the device. Detailed description of chip design and device setup could be found from Hasty Lab (Ferry et al., 2011). Two media were prepared: one with inducers and the other without. Cells in the trap were first supplied by the medium without inducer for 6 hr, and then switched to medium with inducers for anther 18 hr, which was controlled by adjusting the heights of the medium syringes relative to one another. Images were taken by using Nikon Eclipse Ti inverted microscope (Nikon, Japan) equipped with an LED-based Lumencor SOLA SE. Phase and fluorescence images were taken every 5 min for 24 hr in total under the magnification 40x. Perfect focus was maintained automatically using Nikon Elements software. Experimental detail can also be found in Appendix.
Mathematical modeling
Ordinary differential equation models were developed to describe and analyze the MINPA system. Details are provided in the Appendix.In the interests of transparency, eLife includes the editorial decision letter and accompanying author responses. A lightly edited version of the letter sent to the authors after peer review is shown, indicating the most substantive concerns; minor comments are not usually included.Thank you for submitting your article "Engineering of a synthetic quadrastable gene network to approach Waddington landscape and cell fate determination" for consideration by eLife. Your article has been favorably evaluated by Naama Barkai (Senior Editor) and three reviewers, one of whom, Wenying Shou (Reviewer #1), is a member of our Board of Reviewing Editors. The following individual involved in review of your submission has agreed to reveal their identity: Gabor Balazsi (Reviewer #2).The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.Summary:To quantitatively and experimentally understand Waddington's landscape analogy commonly used to depict multiple cell fates, authors constructed a genetic network called MINPA (mutual inhibition and positive autoactivation). By analyzing various sub-networks of MINPA and the full MINPA network, authors find that the full MINPA is capable of achieving the most fate states of mCherry/GFP expression patterns. A total of four states can be achieved, with low or high mCherry and GFP. Aided by modeling, the authors charted how the "energy" landscape of cell fates changes in the presence of various chemicals, and was able to "guide" cells to transit from one state to another by applying chemicals at the correct orders.All three reviewers thought that your work was important and interesting. However, there are issues that will need to be clarified and addressed before acceptance. Details are provided in the reviewers' comments below. Please note that depending on your response, reviewers might conclude that additional major experiments could be necessary. To help us assess the likelihood of such an outcome, it would help if you responded to the critiques with a plan of action and a timetable for completion of the work recommended by the reviewers. The editor and reviewers will assess your response and provide a recommendation to assist you in preparing a revised submission.Reviewer #1:I enjoyed reading it as someone with an informal interest in landscape.Figure 3B: Not clear to me that at C2, the mCherry state (red dot) has low GFP. Need to make the 3-dimensional illustration more clear.Figure 3D: How long can the HH state be maintained? Does your model also predict the time scale of decay?Needs to better describe how "potential" in Figure 4 is calculated.Reviewer #2:This is an important and interesting manuscript that investigates experimentally the possibility of multistability in a library of two-gene networks with increasingly complex connectivity consisting of mutual inhibition and positive autoregulation. This topology has counterparts in mammalian cell fate-regulatory networks. The library consists of several synthetic networks, with a number of regulatory links that systematically increases from 2 to 4. Analyzing the dynamics of these networks reveals that the one with all 4 links present has the highest chance for multistability, with more than 2 stable steady states for a broad range of parameters. These findings are experimentally validated with clever sequential induction experiments and hysteresis using 4 different inducers.The manuscript represents an important step forward in synthetic biology and beyond, having relevance to many cell fate determination networks, including in higher organisms. Nonetheless, some details are clarifications are still needed.Therefore, I recommend publication once the following comments can be addressed:1) Synthetic biology often measures its progress by the number of genes in synthetic gene circuits. However, this view ignores the fact that biological complexity does not really correlate with gene number. In fact, biological complexity correlates with the number of regulatory connections. Some plants have more genes than us, humans. In fact, a 10-gene network may be much simpler from a dynamical or an information-processing perspective than a two-gene network – provided that the latter has more complex connectivity. The arguments on network complexity resulting from links rather than nodes may be a nice addition to the Discussion. See Science 292(5520):1315-6 (2001).2) From the Methods it seems like these networks are on high-copy plasmids rather than integrated. What is the effect of plasmid copy number variation on the results? Could the plasmid be lost from some cells, generating the impression of multistability? Flow cytometry at multiple time points will provide at least a partial answer.3) The sequential induction method is quite interesting and important for revealing multistability. However, its application to the T15 network (or other networks) could be explained better. I guess the sequence in which inducers are added determines how the network's dynamics changes from monostable to multistable – but the details may be important. If bistable, tristable, quadristable regions are small in the 4-dimensional space then the goal is to "hit" these regions as inducers are sequentially added. While this is shown for the toggle switch, it is unclear how was this done for the more complex networks. This should be much more clearly described, especially for T15 and possibly for some simpler networks. Overall, going from the toggle switch to T15 and even to simpler networks is a big step, which requires more explanation and investigation. In addition, to toggle switch would be worth adding to the experimentally measured networks as control, considering that its behavior is computationally predictable. Do the experiments validate the predictions in Figure 2A for the toggle switch?Reviewer #3:In this work, the authors quantified the cell fate decision making landscape through engineering the synthetic circuits. They have identified multiple states. They also considered the cell fate decision at different conditions. The results are interesting and I recommend its publication after revisions upon the following comments.1) Recently, the theoretical advances have been able to identify the landscape and flux as the driving force of the global dynamics of the biological circuits (Proc. Natl. Acad. Sci. USA, 105: 12271-12276. (2008).). The quantification of the Waddington landscape has been achieved and is directly related to the underlying gene regulatory network for cell fate decision of stem cell differentiation and development (Proc. Natl. Acad. Sci. USA. 108(20):8257-8262(2011).). These should be reflected in the revision.2) Furthermore, the multiple states have been predicted beyond the bistable states/switches without and with the epigenetic effects (Proc. Natl. Acad. Sci. USA. 108(20):8257-8262(2011); J. Phys. Chem. B, 115, 1254 (2011); Sci. Rep., 2,550 (2012); J R Soc Interface 10: 20130787 (2013); PLoS ONE. 9(8): e105216 (2014); Advances in Physics, 64:1, 1-137. (2015).). These should be reflected in the revision.3) The authors should explain more clearly the physical and biological origins of the quadrastable states. Why the triple stable states are less likely than the quadrastable states? What is the origin of the LL state?[…] Reviewer #1:I enjoyed reading it as someone with an informal interest in landscape.Figure 3B: Not clear to me that at C2, the mCherry state (red dot) has low GFP. Need to make the 3-dimensional illustration more clear.We thank the reviewer for this great comment. To make the illustration clearer, especially for GFP at C2, we rotated the diagram and got a better view of the states at C2, which is added as Figure 3—figure supplement 1.Figure 3D: How long can the HH state be maintained? Does your model also predict the time scale of decay?In our experiments, we found the HH state is very stable. When we tried to use AHL and Arabinose to induce MINPA, the HH state could be maintained up to 24 hours after induction. In the hysteresis results (Figure 3D and Figure 3—figure supplement 2J), the HH state cells were washed and resuspended in fresh media with Arabinose and AHL, and the state is stable for at least 24 hours.In our deterministic and stochastic models, protein degradation is the main factor determining time scales of state transitions. Once the system reaches its stable steady states, it will not change states until new induction is applied. Therefore, our model could qualitatively represent speed of state transitions by choosing appropriate protein degradation rate.Needs to better describe how "potential" in Figure 4 is calculated.We thank the reviewer for prompting us to improve the manuscript. As suggested, we summarized the method to calculate the “potential” in the revised main text (subsection “Experimental demonstration of model-guided quadrastability of MINPA”, first paragraph), and more details can be found in the Appendix (“Construct Quasi-potential Attractor Landscape”).Reviewer #2:[…] 1) Synthetic biology often measures its progress by the number of genes in synthetic gene circuits. However, this view ignores the fact that biological complexity does not really correlate with gene number. In fact, biological complexity correlates with the number of regulatory connections. Some plants have more genes than us, humans. In fact, a 10-gene network may be much simpler from a dynamical or an information-processing perspective than a two-gene network – provided that the latter has more complex connectivity. The arguments on network complexity resulting from links rather than nodes may be a nice addition to the Discussion. See Science 292(5520):1315-6 (2001).We thank the reviewer for this great suggestion. We have added it into the second paragraph of our Discussion section.2) From the Methods it seems like these networks are on high-copy plasmids rather than integrated. What is the effect of plasmid copy number variation on the results? Could the plasmid be lost from some cells, generating the impression of multistability? Flow cytometry at multiple time points will provide at least a partial answer.We thank the reviewer for this question. We constructed these networks on high-copy plasmids. It is true that the plasmid copy number in different cells harboring the same network and backbone may not be the same, resulting in varied gene expression levels within a cell population. Moreover, stochasticity in gene expression arising from fluctuations in transcription and translation would also lead to different levels of gene expressions. We think these factors are two of the most important ones causing noisy gene expression. Experimentally, the consequence of plasmid copy number and gene expression stochasticity is reflected on the size of each population. For example, the Low-Low state cells in Figure 3A is a population with green fluorescence ranging from 3*102 to 4*103 (a.u.), and GFP state cells from 104 to 2*105 (a.u.). If all the cells have the non-fluctuating gene expression, we would expect a much smaller cloud on the 2-D fluorescence plots.As the reviewer commented, it is possible that the plasmid may be lost from some cells, especially for long-term culture in which the active antibiotic concentration decreases over time. The cells lost their plasmid would have no fluorescent protein expression in a long time course, and might be only mixed/hidden with the low-low state cells. So it would not influence cells in the other three states (GFP, mCherry, and high-high states). A time-course induction with AHL, aTc first and then Arabinose (Left route in Figure 4A) were provided in the revision (Figure 4—figure supplement 1E), from which the low-low state cells has a percentage from 79.1% (0 h after inducer II addition) to 21.2% (12 h), to 24.6% (24 h), to 30.6% (36 h). If the multistability were generated by the plasmid lost, then it would not be stable for the four populations till 36 h. Thus, we think the plasmid lost may increase the portion of low-low state cells for long-time cultures, but would not generate the four populations.3) The sequential induction method is quite interesting and important for revealing multistability. However, its application to the T15 network (or other networks) could be explained better. I guess the sequence in which inducers are added determines how the network's dynamics changes from monostable to multistable – but the details may be important. If bistable, tristable, quadristable regions are small in the 4-dimensional space then the goal is to "hit" these regions as inducers are sequentially added. While this is shown for the toggle switch, it is unclear how was this done for the more complex networks. This should be much more clearly described, especially for T15 and possibly for some simpler networks. Overall, going from the toggle switch to T15 and even to simpler networks is a big step, which requires more explanation and investigation. In addition, to toggle switch would be worth adding to the experimentally measured networks as control, considering that its behavior is computationally predictable. Do the experiments validate the predictions in Figure 2A for the toggle switch?We thank the reviewer for this great comment. We think sequential induction is a good strategy to quickly evaluate multistable potentials and screen out systems harboring the most interesting dynamics. We added more detail about the sequential induction strategy and the application to T15 and other networks in the revised manuscript (subsection “Systematical multistability evaluation of MINPA and its sub-networks”, fourth paragraph), and Appendix (“Sequential Induction”).To validate the theoretical analysis for sequential induction in Figure 2A, we constructed a synthetic toggle switch circuit and tested with sequential inductions. We first employed IPTG to induce the circuit for 5 h, and then aTc was added. Time course results showed that cells stayed at low-GFP state till 24 hours (Figure 2—figure supplement 1B). However, cells induced with aTc first, and then IPTG mainly stayed at high-GFP state, another stable steady state under this condition. Simultaneous aTc and IPTG induction produced similar cell distributions. These results show that sequential induction can be used as a strategy to quickly explore a multistable potential landscape for complex non-equilibrium systems. Details can be found in the third paragraph of the subsection “Systematical multistability evaluation of MINPA and its sub-networks”, Figure 2—figure supplement 1, and subsection “Strains, Media, and Chemicals”Reviewer #3:[…] 1) Recently, the theoretical advances have been able to identify the landscape and flux as the driving force of the global dynamics of the biological circuits (Proc. Natl. Acad. Sci. USA, 105: 12271-12276. (2008).). The quantification of the Waddington landscape has been achieved and is directly related to the underlying gene regulatory network for cell fate decision of stem cell differentiation and development (Proc. Natl. Acad. Sci. USA. 108(20):8257-8262(2011).). These should be reflected in the revision.We thank the reviewer for the great suggestions. We have added the discussion and corresponding references in the revision (Introduction, second paragraph; and Discussion, first paragraph).2) Furthermore, the multiple states have been predicted beyond the bistable states/switches without and with the epigenetic effects (Proc. Natl. Acad. Sci. USA. 108(20):8257-8262(2011); J. Phys. Chem. B, 115, 1254 (2011); Sci. Rep., 2,550 (2012); J R Soc Interface 10: 20130787 (2013); PLoS ONE. 9(8): e105216 (2014); Advances in Physics, 64:1, 1-137. (2015).). These should be reflected in the revision.We thank the reviewer for the great suggestions. We have added the discussion and corresponding references in the revision (Introduction, second paragraph).3) The authors should explain more clearly the physical and biological origins of the quadrastable states. Why the triple stable states are less likely than the quadrastable states? What is the origin of the LL state?We thank the reviewer for the great question. The quadrastability presented in this work comes from coherent regulations in GFP and mCherry expressions. Experimentally, we used two hybrid promoters Para/lac and Plux/tet to drive the regulations. Each of the two promoters has two protein binding sites. AraC activates Para/lac in the presence of arabinose while LacI can bind and block its transcription. LuxR activates Plux/tet with induction of AHL while TetR can repress its transcription. Hence, each of the promoters has two possible states: ON and OFF. The interlocked circuit design of MINPA enables it has four possible expression levels in a cell population: Para/lac ON and Plux/tet OFF, Para/lac OFF and Plux/tet ON, Para/lac OFF and Plux/tet OFF, and Para/lac ON and Plux/tet ON. Since GFP and mCherry are reporters of the two promoters, so they could represent four stable states: GFP, mCherry, low-GFP and low-mCherry, and high-GFP and high-mCherry states.Physically, the quadrastable states stem from the MINPA design, which is described as ordinary differentiation equations. Our mathematical analysis revealed that there are four stable steady states in the MINPA system. We didn’t compare the emergence probability between tristability and quadrastability. But experimentally, it is shown that tri-modality is easier to emerge, such as in the case of induction of MINPA with Arabinose and AHL (Figure 3C (C2LL, C3LL)). However, quadra-modality can only occur with triple inductions (Arabinose, AHL and aTc, Figure 4B-D, and Figure 4−figure supplement 1E).We also compared our model with previous studies describing the same topology (Proc. Natl. Acad. Sci. USA. 108(20):8257-8262(2011); PLoS ONE. 9(8): e105216 (2014)), we found the main difference is the description of the relationship between positive autoregulation and negative feedback. Previous studies described it as a “plus” (which means the two events are independent and additive), however, we described it as a “multiply” (which means the two events are dependent and multiplicative). Specifically, Para/lac activation depends on the relative concentrations of AraC (from node X) and LacI (from node Y) in the cell. LacI binding to the promoter would block RNA polymerase progression and hence repress transcription. Therefore, the LL state origins from the high effective concentrations of LacI and TetR in the cell. We believe incorporating mutual dependence of two binding sites of the hybrid promoter is more appropriate for the MINPA system described in this work, although the “additive” description of hybrid promoter could be suitable for other systems with different regulatory mechanisms.
Authors: Michael J Lee; Albert S Ye; Alexandra K Gardino; Anne Margriet Heijink; Peter K Sorger; Gavin MacBeath; Michael B Yaffe Journal: Cell Date: 2012-05-11 Impact factor: 41.582
Authors: Jesse Stricker; Scott Cookson; Matthew R Bennett; William H Mather; Lev S Tsimring; Jeff Hasty Journal: Nature Date: 2008-10-29 Impact factor: 49.962
Authors: Corey E Hayford; Darren R Tyson; C Jack Robbins; Peter L Frick; Vito Quaranta; Leonard A Harris Journal: PLoS Biol Date: 2021-06-01 Impact factor: 8.029
Authors: Yang Li; Yanfei Jiang; Julie Paxman; Richard O'Laughlin; Stephen Klepin; Yuelian Zhu; Lorraine Pillus; Lev S Tsimring; Jeff Hasty; Nan Hao Journal: Science Date: 2020-07-17 Impact factor: 47.728