| Literature DB >> 28378144 |
D Shoba1, M Raveendran1, S Manonmani1, S Utharasu1, D Dhivyapriya1, G Subhasini1, S Ramchandar1, R Valarmathi1, Nitasha Grover2, S Gopala Krishnan2, A K Singh2, Pawan Jayaswal3, Prashant Kale3, M K Ramkumar3, S V Amitha Mithra3, T Mohapatra4, Kuldeep Singh5,6, N K Singh3, N Sarla7, M S Sheshshayee8, M K Kar9, S Robin10, R P Sharma11.
Abstract
BACKGROUND: Increased water and labour scarcity in major <span class="Species">rice growing areas warrants a shift towards direct seeded rice cultivation under which management of weeds is a major issue. Use of broad spectrum non-selective herbicides is an efficient means to manage weeds. Availability of rice genotypes with complete tolerance against broad-spectrum non-selective herbicides is a pre-requisite for advocating use of such herbicides. In the present study, we developed an EMS induced rice mutant, 'HTM-N22', exhibiting tolerance to a broad spectrum herbicide, 'Imazethapyr', and identified the mutations imparting tolerance to the herbicide.Entities:
Keywords: AHAS; EMS Mutagenesis; Herbicide tolerance; Imazethapyr; Rice
Year: 2017 PMID: 28378144 PMCID: PMC5380566 DOI: 10.1186/s12284-017-0151-8
Source DB: PubMed Journal: Rice (N Y) ISSN: 1939-8425 Impact factor: 4.783
Fig. 1Overall view of imazethapyr treated field and identification of resistant plant (inset) in M2 generation
Fig. 2Mutant progenies 15 days after imazethapyr treatment in M4 generation. a: HTM-N22 (25th Day after sowing and at the time of treatment); b: HTM-N22 emerging from the weeds 15 days after treatment; c: Efficacy of the weed control (20th day after treatment); d: Nagina 22 killed along with the weeds
Segregation pattern of herbicide tolerance in F2 population from cross Pusa 1656/HTM-N22
| Cross | Total no. of plants | No. of F2 plants | Expected Genetic ratio |
|
| |
|---|---|---|---|---|---|---|
| Survived | Died | |||||
| Pusa 1656/HTM-N22 | 254 | 197 | 57 | 3:1 | 0.887 | 0.3463 |
SSR markers identified in the vicinity of candidate genes for polymorphism survey between the HTM-N22 and Pusa 1656
| Candidate gene | SSR | Position (bp) | Primers (Forward/Reverse) | Polymorphism |
|---|---|---|---|---|
| Aceto-lactate synthase (LOC_Os06g51280 at 31049803 in chromosome 6) | RM20765 | 30593302 | CCAGCTCACCTCAGCTTCATCAGC | monomorphic |
| RM20767 | 30593847 | TCGATCGATCCTAGACTCCTTCC | polymorphic | |
| RM20768 | 30611463 | CAGGGAATAAACAGGAGGAAGAGG | monomorphic | |
| RM20769 | 30653429 | CAGATGCGGAGGATGAAGAGC | monomorphic | |
| RM20771 | 30665825 | CAAACCTGCGTCTCTGTCTCTCTCC | monomorphic | |
| RM20773 | 30692412 | TTGCCAATATTCCCTCCAGTGC | monomorphic | |
| AcetoHydroxy Acid Synthase (LOC_Os02g30630 at 18236025 bp in chromosome 2) | RM 6844 | 18169413 | AGTCCAAGAAAGGCACGAGAGG | polymorphic |
| RM13263 | 18187191 | AAGATTGCACACTGGTGTTCTCC | monomorphic | |
| RM13264 | 18192480 | ATCTCCATCGTCTCCTTCCTTGG | monomorphic | |
| RM13267 | 18220791 | TGAGGCGACGACCACCTTCG | monomorphic | |
| RM13268 | 18223511 | CCCAAACATCCAATACGACACC | monomorphic | |
| RM13269 | 18237768 | GCTTCGGTAATTTGGTTTCGTGATCC | monomorphic | |
| AcetoHydroxy Acid Synthase (LOC_Os04g32010 at 19169130 bp in chromosome 4) | RM16844 | 19095807 | CACCGACTGGTTCGTCTACAGG | monomorphic |
| RM16850 | 19172772 | TGCTTGTAAGAGAGGTCAAGAGAGG | monomorphic | |
| RM16867 | 19452211 | GGAACGTAGCTGAAGTCATGAACC | monomorphic | |
| RM16873 | 19485808 | GCATATGCATGCAGGAATTGACC | monomorphic | |
| RM1205 | 19643755 | CAATCACAGAGCAACACGTACCC | monomorphic | |
| RM1359 | 20041155 | CGACTTGCCAAAGGTCAACG | monomorphic | |
| RM3643 | 20128692 | GCTAAGCTAATCTGACCGGATCTACG | monomorphic | |
| RM5749 | 20131193 | GCTCGTTTCTCTCGATCACTCG | polymorphic |
Fig. 3F2 population of HTM-N22-/Pusa 1656 tested by BSA with polymorphic SSR marker, RM 6844 in the vicinity of candidate gene, AHAS on Chromosome 2
Fig. 4A representative gel picture showing the segregation pattern of RM 6844 in the F2 mapping population from the cross, Pusa 1656/HTM-N22. M -50 bp Ladder, SP – Herbicide susceptible parent, Pusa 1656; TP- Herbicide tolerant mutant, HTM-N22; 1– 46 progenies in F2 population
Genotypic segregation of F2 population from the cross, Pusa1656/HTM-N22 for RM6844 marker
| Cross | Total no. of plants | Allele (observed) | Expected Genetic ratio |
|
| ||
|---|---|---|---|---|---|---|---|
| Mutant type | Heterozygote | WT | |||||
| Pusa 1656/HTM-N22 | 254 | 55 | 135 | 64 | 1:2:1 (63.5:127:63.5) | 1.646 | 0.4392 |
Fig. 5Amino acid sequence alignment of AcetoHydroxy Acid Synthase (LOC_Os02g30630) between wild type Nagina 22 and herbicide tolerant mutant along with Nipponbare
Summary of amino acid substitutions in HTM-N22 as compared to WT with Nipponbare as reference
| Amino acid position | Amino acid substitutions in | Remarks on amino acid substitutions in the HTM-N22 with respect WT and Nipponbare | ||
|---|---|---|---|---|
| HTM-N22 | WT | Nipponbare | ||
| 11 | T | T | A | N22 type |
| 30 | F | V | V | Mutation |
| 50 | L | V | V | Mutation |
| 67 | T | T | P | N22 type |
| 71 | C | C | R | N22 type |
| 81 | R | Q | L | Different from both references |
| 118 | E | D | E | Nipponbare type |
| 146 | A | P | A | Nipponbare type |
| 152 | E | G | A | Different from both references |
| 293 | R | R | W | N22 type |
| 318 | S | S | L | N22 type |
| 357 | D | D | E | N22 type |
| 400 | D | D | Q | N22 type |
| 569 | S | G | S | Nipponbare type |
| 627 | N | S | S | Mutation |
| 643 | M | M | V | N22 type |
Fig. 6Line ribbon representation of the homology based protein model of WT (a) and HTM-N22 (b)
Functional motifs predicted in ALS proteins of WT and HTM-N22
| S. No. | Motif sites | WT | HTM-N22 | ||
|---|---|---|---|---|---|
| Position of the amino acid | Features | Position of the amino acid | Features | ||
| 1 | PS00005 PKC_PHOSPHO_SITE Protein kinase C phosphorylation site | 17 – 19 | TaK | 17 – 19 | TaK |
| 20 – 22 | TgR | 20 – 22 | TgR | ||
| 132 – 134 | SgR | 132 – 134 | SgR | ||
| 218 – 220 | SgR | 218 – 220 | SgR | ||
| 273 – 275 | SrR | 273 – 275 | SrR | ||
| 319 – 321 | SlR | 319 – 321 | SlR | ||
| 353 – 355 | TgK | 353 – 355 | TgK | ||
| 404 – 406 | TtK | 404 – 406 | TtK | ||
| 471 – 473 | TyK | 471 – 473 | TyK | ||
| 590 – 592 | TkK | 590 – 592 | TkK | ||
| 2 | PS00009 AMIDATION Amidation site | 20 – 23 | tGRK | 20 – 23 | tGRK |
| 3 | PS00008 MYRISTYL N-myristoylation site | 136 – 141 | GVcvAT | 136 – 141 | GVcvAT |
| 152 – 157 | GLadAL | ||||
| 281 – 286 | GGgcSA | 281 – 286 | GGgcSA | ||
| 282 – 287 | GGcsAS | 282 – 287 | GGcsAS | ||
| 283 – 288 | GCsaSG | 283 – 288 | GCsaSG | ||
| 299 – 304 | GIpvTT | 299 – 304 | GIpvTT | ||
| 310 – 315 | GNfpSD | 310 – 315 | GNfpSD | ||
| 324 – 329 | GMhgTV | 324 – 329 | GMhgTV | ||
| 327 – 332 | GTvyAN | 327 – 332 | GTvyAN | ||
| 490 – 495 | GLpaAA | 490 – 495 | GLpaAA | ||
| 496 – 501 | GAsvAN | 496 – 501 | GAsvAN | ||
| 563 – 568 | GNpeCE | 563 – 568 | GNpeCE | ||
| 4 | PS00006 CK2_PHOSPHO_SITE Casein kinase II phosphorylation site | 287 – 290 | SgdE | 287 – 290 | SgdE |
| 407 – 410 | TssD | 407 – 410 | TssD | ||
| 431 – 434 | TfgE | 431 – 434 | TfgE | ||
| 449 – 452 | TkgE | 449 – 452 | TkgE | ||
| 505 – 508 | TvvD | 505 – 508 | TvvD | ||