Literature DB >> 32930909

Marker Assisted Development and Characterization of Herbicide Tolerant Near Isogenic Lines of a Mega Basmati Rice Variety, "Pusa Basmati 1121".

Nitasha Grover1,2, Aruna Kumar2, Ashutosh Kumar Yadav1, S Gopala Krishnan1, Ranjith Kumar Ellur1, Prolay Kumar Bhowmick1, K K Vinod1, Haritha Bollinedi1, M Nagarajan3, C Viswanathan4, Amitha Mithra V Sevanthi5, Nagendra Kumar Singh5, Trilochan Mohapatra6, Ashok Kumar Singh7.   

Abstract

BACKGROUND: Direct-seeded rice (DSR) is a potential technology for sustainable rice farming as it saves water and labor. However, higher incidence of weed under DSR limits productivity. Therefore, there is a need to develop herbicide tolerant (HT) rice varieties.
RESULTS: We used marker assisted backcross breeding (MABB) to transfer a mutant allele of Acetohydroxy acid synthase (AHAS) gene, which confers tolerance to imidazolinone group of herbicides from the donor parent (DP) "Robin" into the genetic background of an elite popular Basmati rice variety, Pusa Basmati 1121 (PB 1121). Foreground selection was done using the AHAS gene linked Simple Sequence Repeat (SSR) marker RM6844 and background selection was performed using 112 genome-wide SSR markers polymorphic between PB 1121 and Robin. Phenotypic selection for agronomic, Basmati grain and cooking quality traits in each generation was carried out to improve the recovery of recurrent parent phenome (RPP). Finally, a set of 12 BC4F4 near isogenic lines (NILs), with recurrent parent genome (RPG) recovery ranging from 98.66 to 99.55% were developed and evaluated. PB 1121-HT NILs namely 1979-14-7-33-99-10, 1979-14-7-33-99-15 and 1979-14-7-33-99-66 were found superior to PB 1121 in yield with comparable grain and cooking quality traits and herbicide tolerance similar to Robin.
CONCLUSION: Overall, the present study reports successful development of HT NILs in the genetic background of popular Basmati rice variety, PB 1121 by introgression of mutated AHAS allele. This is the first report on the development of HT Basmati rice. Superior NILs are being evaluated in the national Basmati trials, the release of which is likely to provide a viable option for the adoption of DSR technology in Basmati rice cultivation.

Entities:  

Keywords:  AHAS; Basmati rice; DSR; Foreground and background selection; Grain and cooking quality; Herbicide tolerant; Marker assisted backcross breeding

Year:  2020        PMID: 32930909      PMCID: PMC7492307          DOI: 10.1186/s12284-020-00423-2

Source DB:  PubMed          Journal:  Rice (N Y)        ISSN: 1939-8425            Impact factor:   4.783


Background

In South-East Asian countries, where rice is primarily cultivated by transplanting, DSR holds great promise as it is a potential water and labor saving technology, which offers the possibility of saving huge amount of water and labour needed for puddling and transplanting. However, DSR cultivation suffers from high weed infestation. Weeds pose a serious threat by competing with the crop for water, nutrients and light, thereby hampering productivity (Powles and Yu 2010). In India, upto 30% of the total cost of rice cultivation goes in controlling weeds (Rao et al. 2015). It has been demonstrated that with effective weed management, the yields from DSR is widely comparable to transplanted rice (Pathak et al. 2011). The use of herbicides is the most effective and economical option to control weeds (Anderson and Georgeson 1989). However, the herbicides that are safe and effective at minimal doses should be used to ensure environmental safety. Imidazolinone group of herbicides (imazapyr, imazapic, imazethapyr, imazamox, imazamethabenz and imazaquin etc.), control weeds by inhibiting the enzyme acetohydroxyacid synthase (AHAS), also called acetolactate synthase (ALS). AHAS is a critical enzyme for the biosynthesis of branched-chain amino acids namely, leucine, isoleucine and valine in plants. These herbicides, also have low mammalian toxicity due to lack of AHAS gene (Tan et al. 2006; Piao et al. 2018). Due to the above benefits, the herbicides of imidazolinone group are most widely used for weed control in crops like soybean, groundnut etc., which possess natural tolerance to these herbicides. However, the crops like rice, maize, wheat, oilseed rape and sunflower etc. are highly sensitive to imidazolinones. Several variants of AHAS genes conferring imidazolinone tolerance have been developed through mutagenesis and selection in different crops and commercialized as Clearfield® crops since 1992. Imidazolinone herbicides control a broad spectrum of grass and broadleaf weeds in imidazolinone-tolerant crops, including weeds that are closely related to the crop itself and some key parasitic weeds (Tan et al. 2005). Here, we report the transfer of mutant allele of AHAS gene conferring herbicide tolerance from Robin into a mega Basmati rice variety, PB 1121, through MABB and assessment of PB 1121 NILs for agronomic, grain and cooking quality performance in addition to herbicide tolerance.

Material and Methods

Plant Materials

In this study, we used the herbicide tolerant rice mutant Robin as donor and a mega-Basmati rice variety, PB 1121 as the recurrent parent (RP) for the transfer of HT trait. The mutant Robin was developed from an upland rice variety Nagina 22 (N22) through induced mutagenesis using ethyl methane sulfonate (EMS) (Shoba et al. 2017). PB 1121, developed by our group at ICAR-Indian Agricultural Research Institute (IARI), New Delhi, is a Basmati rice variety par excellence in grain and cooking quality with an exceptionally high cooked kernel length (22 mm) and elongation ratio of > 2.5. This variety is currently grown on approximately 1.2 million ha area (60% of the Basmati area in India) and contributes annually 3.41 billion USD to foreign exchange earnings through the export of Basmati rice (Singh et al. 2018b).

MABB Strategy for Development of HT Lines

PB 1121 and mutant Robin were first evaluated for their tolerance to the herbicide “Imazethapyr” at the dose of 2.5 ml/litre. The F1 seeds were produced by crossing PB 1121 as female and Robin as male and the hybridity of the F1 plants was tested using the SSR marker RM6844 linked with AHAS gene. The F1s were designated as Pusa 1979 and single F1 was backcrossed with PB 1121 to generate BC1F1 seeds. One BC1F1 plant with the highest recovery of RPG and recurrent parent phenome (RPP) was backcrossed to PB 1121 to generate the BC2F1 seeds. A similar strategy was employed till BC4F1 generation, wherein in each of the generations, the plant heterozygous for the mutant AHAS allele along with maximum recovery for RPG and RPP were identified. The superior BC4F1 plants were advanced to BC4F2 generation and plants homozygous for the mutant AHAS allele were identified. Further, the selected BC4F2 plants were advanced to BC4F4 generation via pedigree-based phenotypic selection (Fig.1).
Fig. 1

Marker aided backcross breeding strategy used for transferring the herbicide tolerance trait into PB 1121

Marker aided backcross breeding strategy used for transferring the herbicide tolerance trait into PB 1121

Molecular Analysis

Total genomic DNA from leaf tissues was extracted using Cetyl Trimethyl Ammonium Bromide (CTAB) method (Doyle 1991). The PCR reaction of a total 10 μl volume was set up which included, 25–30 ng of template DNA, 5 pmol each of the forward and reverse primers and 2X red dye PCR master mix (Genei Laboratories Pvt. Ltd., Bangalore). The program of PCR amplification consisted of initial denaturation at 95 °C for 5 min; 35 cycles of denaturation at 95 °C for 40s, annealing at 58 °C for 40s, extension at 72 °C for1 min; and a final extension at 72 °C for 10 min. The amplified products were resolved on 3.5% Metaphor™ Agarose gel mixed with 0.1 mg/ml ethidium bromide. The amplicons were visualized on ultraviolet trans-illuminator (Gel Doc™ + Imager, Bio- Rad Laboratories Inc., U.S.A).

Foreground and Background Selection

Foreground selection for the identification of plants carrying the mutant AHAS allele was carried out using SSR marker RM6844 linked with AHAS gene at a distance of 1.2 cM in chromosome 2 (Shoba et al. 2017), primer details are given in Table 1. For background selection, the primer sequence of genome-wide SSR markers was fetched from the rice marker database of Gramene (http://www.gramene.org). A total of 856 SSR markers were used to identify 112 polymorphic SSR markers between the parents PB 1121 and Robin, for use in background selection (Table 2). Agarose gel image and graphical presentation of all 112 polymorphic SSR markers is given in additional file 1: Figure S1 and additional file 2: Figure S2, respectively. Primers details are provided in additional file 5: Table S1. During the background selection in backcross generations, the homozygous and heterozygous plants for PB 1121 allele at each marker loci were counted separately. A reductionist strategy was considered for this, markers that were found to be homozygous for PB 1121 allele in a given generation were not included in subsequent generations for background selection. RPG recovery was estimated using the formula:
Table 1

Details of SSR marker linked to the AHAS gene which was used in foreground selection

MarkerPrimer SequencesTmPB 1121 AlleleRobin AllelePosition
RM6844F: AGTCCAAGAAAGGCACGAGAGG58 °C140 bp200 bp1.2 cM
R: CTGCATCGAAGAAGAAGAAGAAGC
Table 2

Details of SSR markers used for parental polymorphic survey

Markers used forTotal No. of Markers surveyedTotal No. of Polymorphic markersPolymorphic Markers usedPolymorphism (%)
Foreground111
Backgrounda85611211213.08
Chromosome 296181818.75

aIncludes markers on Chromosome 2

Details of SSR marker linked to the AHAS gene which was used in foreground selection Details of SSR markers used for parental polymorphic survey aIncludes markers on Chromosome 2 The RPG recovery was visualized using Graphical GenoTypes (GGT) Version 2.0 software (Van Berloo 1999). Based on molecular marker analysis, similarity of NILs to PB 1121 was computed using Jaccard’s coefficient of similarity for generating a dendrogram following an unweighted pair group method with arithmetic mean (UPGMA). Further, for cluster analysis, NTSYS-PC-2.02f (Rohlf 1998) was used.

Molecular Screening for Aroma Gene

The NILs and the parents were also screened for the presence of badh2 gene, responsible for aroma in Basmati rice, using gene based marker ‘nksbad2’ (Amarawathi et al. 2008). Primer details are given in Table 3.
Table 3

Details of nks_bad2 gene based SSR marker for aroma

MarkerPrimer SequencesTmPB1121 AlleleRobin AllelePosition (Mb)
nks_bad2F: GGTTGCATTTACTGGGAGTTATG58 °C82 bp90 bpGene based
R: TCCACAGAAATTTGGAAACAAA
Details of nks_bad2 gene based SSR marker for aroma

Screening for Imazethapyr Tolerance

Twelve HT-NILs of PB 1121 along with PB 1121 and Robin were planted in a randomized complete block design (RCBD) with three replications and sprayed with herbicide, Imazethapyr (commercially available as Pursuit™) @ concentration of 2.5 ml/liter, after 10 days of transplanting. Another set of same experimental material was grown side by side and used as unsprayed control with manual weeding. Visual observation of herbicide tolerance of the HT-NILs was made on 15 days after spray as per the standard protocol in rice (Shoba et al. 2017).

Evaluation of Agro-Morphological, Grain and Cooking Quality Parameters

Agro-morphological evaluation of the HT-NILs and parents was done in RCBD with three replications following recommended agronomic practices. Data on the agro-morphological traits viz, days to 50% flowering (DFF), plant height (PH), number of productive tillers per plant (NPT), panicle length (PL), spikelet fertility percent (SF %), thousand grain weight (TGW) were recorded on five plants taken at random from the two middle rows of each plot under both sprayed and unsprayed conditions. The plot yield was recorded in kilogram/hectare (kg/ha) from each replication. The data on grain and cooking quality traits such as hulling percentage (HUL%), milling percentage (MIL%), head rice recovery percentage (HRR%), kernel length before cooking (KLBC), kernel breadth before cooking (KBBC), kernel length after cooking (KLAC), kernel breadth after cooking (KBAC), kernel elongation ratio (ER), alkali spreading value (ASV) (Little 1958) and aroma (Sood and Siddiq 1978) was recorded. The statistical analysis of agro-morphological data was carried out using CropStat 7.2 (IRRI, CropStat 7.2 2014). Student’s t-test was performed for statistical significance differences for yield between unsprayed and herbicide sprayed condition at P ≤ 0.05.

Results

Development of PB 1121-NILs with Herbicide Tolerance

The recurrent parent PB 1121 and donor Robin were validated for their tolerance to herbicide, Imazethapyr. PB 1121 was highly susceptible and exhibited complete mortality within 15–20 days of herbicide spray, while the donor Robin was highly tolerant to Imazethapyr (Fig. 2). MABB was adopted to transfer the HT trait into PB 1121 from Robin. F1 plants obtained from the cross, PB 1121 and Robin were confirmed for their hybridity using AHAS gene linked SSR marker, RM6844 (Additional file 3: Figure S3). A true F1 plant was backcrossed to PB 1121 and 262 BC1F1 plants were generated. Of these, 128 plants were heterozygous for RM6844 with RPG recovery ranging from 70.98–80.35%. A plant, Pusa 1979–14 with the highest RPG (80.35%) and with a higher level of phenotypic similarity to PB 1121 was backcrossed and 188 BC2F1 plants were generated, of which 94 plants were heterozygous for foreground marker, RM6844 and the RPG recovery ranged from 81.25 to 92.85%. The superior BC2F1 plant was further backcrossed and 152 BC3F1 seeds were produced, out of which 73 plants were found to be heterozygous for the foreground marker and these plants were subjected to phenotypic evaluation for agro-morphological traits and background selection was done using 16 SSR markers remained heterozygous in the BC2F1 generation. The RPG recovery in the BC3F1 generation ranged from 93.30 to 95.08%. One superior BC3F1 plant, with maximum RPG (95.08%) and relatively superior recovery for RPP was backcrossed to generate 122 BC4F1 plants. A total of 58 plants were found to be heterozygous for RM6844 with RPG recovery range from 94.64 to 98.21%. A plant with maximum RPG recovery (98.21%) was selfed to produce BC4F2 population. Out of 384 BC4F2 plants, 88 plants were found to be homozygous for AHAS gene linked SSR marker RM6844 (Additional file 4: Figure S4).
Fig. 2

Phenotypic evaluation of donor parent, “Robin” and recurrent parent, “PB 1121” for Imazethapyr herbicide tolerance @ concentration of 2.5 ml/liter, a Unsprayed, b Sprayed

Phenotypic evaluation of donor parent, “Robin” and recurrent parent, “PB 1121” for Imazethapyr herbicide tolerance @ concentration of 2.5 ml/liter, a Unsprayed, b Sprayed The mutant AHAS homozygous plants were evaluated for grain and cooking quality traits and 40 superior plants were identified. These 40 progenies were further evaluated for yield and quality traits. Based on the family bulk yield and quality traits, twelve families were selected for further detailed evaluation (Table 4). The RPG recovery of these families ranged from 98.66 to 99.55% with an average 99.10%, some residual donor segments were observed in chromosome 8 and 11, whereas complete recovery was achieved in all other chromosomes (Fig. 3). All the PB 1121 HT-NILs clustered together with PB 1121 with an average similarity index (SI) of 0.9756. Among the HT-NILs, Pusa 1979-14-7-33-99-15 and Pusa 1979-14-7-33-99-66 showed maximum similarity with SI of 0.982 (Fig. 4).
Table 4

Number of plants generated and recurrent parent genome recovery in the backcross generations during marker aided introgression of mutant AHAS allele in PB 1121

GenerationNo. of plants generatedNo. of plants carrying mutant AHAS allele in heterozygous/ homozygous stateNo. of selected plants/familiesGenome recovery (%)Mean Observed RPG Recovery (%)Expected Average Recovery (%)
F11515b1a
BC1F1262128b170.98–80.3575.6675
BC2F118894b181.25–92.8587.0587.5
BC3F115273b193.30–95.0894.1993.8
BC4F112258b194.64–98.2196.4296.9
BC4F238488c40a
BC4F34040c12a
BC4F41212c1298.66–99.5599.10

aNot estimated

bPlants with mutant AHAS allele in heterozygous state

cPlants homozygous for mutant AHAS allele

Fig. 3

Graphical representation of PB 1121 HT-NILs carrying mutant AHAS gene showing the extent of recurrent parent genome (RPG) recovery. CH: chromosome

Fig. 4

Dendrogram showing the genetic relationship among different PB 1121 HT-NILs in BC4F4 generation and their parents, PB 1121 and Robin based on 112 polymorphic SSR markers

Number of plants generated and recurrent parent genome recovery in the backcross generations during marker aided introgression of mutant AHAS allele in PB 1121 aNot estimated bPlants with mutant AHAS allele in heterozygous state cPlants homozygous for mutant AHAS allele Graphical representation of PB 1121 HT-NILs carrying mutant AHAS gene showing the extent of recurrent parent genome (RPG) recovery. CH: chromosome Dendrogram showing the genetic relationship among different PB 1121 HT-NILs in BC4F4 generation and their parents, PB 1121 and Robin based on 112 polymorphic SSR markers Finally, selected 12 BC4F4 families were validated for homozygosity for the mutated AHAS allele using gene linked SSR marker RM6844 (Fig. 5), and also evaluated for Imazethapyr tolerance, agronomic, grain and cooking quality characters in the sprayed and unsprayed condition in a replicated trial.
Fig. 5

A representative gel image showing the amplification profile of AHAS gene linked marker RM6844 in the PB 1121 HT-NILs along with recurrent parent (RP), PB 1121 and donor parent (DP) Robin. M: 50 base pair DNA ladder, DP: Robin, RP: PB 1121, 1–12: PB 1121 HT-NILs, Pusa 1979-14-7-33-99-8, Pusa 1979-14-7-33-99-10, Pusa 1979-14-7-33- 99-15, Pusa 1979-14-7-33-99-34, Pusa 1979-14-7-33-99-56, Pusa 1979-14-7-33-99-66, Pusa 1979-14-7-33-99-87, Pusa 1979-14-7-33-99-101, Pusa 1979-14-7-33-99-143, Pusa 1979-14-7-33-99-166, Pusa 1979-14-7-33-99-182 and Pusa 1979-14-7-33-99-226

A representative gel image showing the amplification profile of AHAS gene linked marker RM6844 in the PB 1121 HT-NILs along with recurrent parent (RP), PB 1121 and donor parent (DP) Robin. M: 50 base pair DNA ladder, DP: Robin, RP: PB 1121, 1–12: PB 1121 HT-NILs, Pusa 1979-14-7-33-99-8, Pusa 1979-14-7-33-99-10, Pusa 1979-14-7-33- 99-15, Pusa 1979-14-7-33-99-34, Pusa 1979-14-7-33-99-56, Pusa 1979-14-7-33-99-66, Pusa 1979-14-7-33-99-87, Pusa 1979-14-7-33-99-101, Pusa 1979-14-7-33-99-143, Pusa 1979-14-7-33-99-166, Pusa 1979-14-7-33-99-182 and Pusa 1979-14-7-33-99-226

Evaluation of PB 1121- HT NILs for Tolerance to Herbicide Imazethapyr

The PB 1121 HT-NILs along with parents, PB 1121 and Robin were screened for tolerance to herbicide Imazethapyr. All the NILs homozygous for the mutant AHAS allele exhibited complete tolerance to Imazethapyr. The level of herbicide tolerance in NILs was comparable to DP Robin. While, the RP PB 1121 possessing the wild type AHAS allele did not survive after herbicide spray and showed complete mortality within 15 to 20 days of the Imazethapyr spray (Fig. 6).
Fig. 6

Phenotypic screening of PB 1121-HT NILs along with Recurrent Parent (RP), PB 1121 and Donor Parent, Robin for tolerance to the herbicide, Imazethapyr, a application of Imazethapyr @ 2.5 ml/liter after 10 days of transplanting, b 20 days after herbicide spray showing that complete death of RP, c 60 days after herbicide spray, d 90 days after herbicide spray

Phenotypic screening of PB 1121-HT NILs along with Recurrent Parent (RP), PB 1121 and Donor Parent, Robin for tolerance to the herbicide, Imazethapyr, a application of Imazethapyr @ 2.5 ml/liter after 10 days of transplanting, b 20 days after herbicide spray showing that complete death of RP, c 60 days after herbicide spray, d 90 days after herbicide spray

Evaluation of PB 1121 HT-NILs for Agronomic, Grain and Cooking Quality

The mean performance of PB 1121 HT-NILs for yield, yield components and phenological traits, when grown under herbicide sprayed and unsprayed conditions were recorded. All the data from the sprayed condition and only yield data for unsprayed conditions are presented in Table 5. Under herbicide sprayed conditions, PB 1121 showed complete mortality within 15–20 days of spray, while the NILs showed normal growth and development (Fig. 7). Therefore, the yield and quality traits of NILs under sprayed condition were compared with the data of PB 1121 from unsprayed conditions. It was observed that NILs were at par with PB 1121 in yield, grain and cooking quality traits. NILs Pusa 1979-14-7-33-99-66 and Pusa 1979-14-7-33-99-143 were slightly taller in stature and the NILs Pusa 1979-14-7-33-99-15, Pusa 1979-14-7-33-99-10 and Pusa 1979-14-7-33-99-66 were significantly superior in yield as compared to PB 1121 (Fig. 8 & Table 5) which could be attributed to its higher spikelet fertility. There was no significant difference in the performance of NILs when compared under sprayed and unsprayed conditions (based on Student t-test) while PB 1121 was completely dead under sprayed condition.
Table 5

Agronomic performance of PB 1121 HT-NILs in comparison with the recurrent parent PB 1121

GenotypeDFFPHNPTPLSF%TGWYLD (kg/ha)%RPG
USPSP
Pusa 1979-14-7-33-99-8106.0123.1519.3027.8988.2028.876701 ± 274.406517 ± 311.3498.66
Pusa 1979-14-7-33-99-10109.0*122.4520.60*28.4092.70*28.737129 ± 322.95*7217 ± 425.32*99.11
Pusa 1979-14-7-33- 99-15106.0131.5320.20*28.5292.87*28.937310 ± 382.05*7417 ± 467.53*99.55
Pusa 1979-14-7-33-99-34107.0126.2519.70*29.2887.5327.996673 ± 497.096255 ± 350.3999.11
Pusa 1979-14-7-33-99-56106.5128.8517.2027.5687.7528.886836 ± 359.896582 ± 300.7899.11
Pusa 1979-14-7-33-99-66106.5136.85*19.10*29.2992.74*28.327248 ± 237.14*7300 ± 490.75*99.55
Pusa 1979-14-7-33-99-87105.5127.9515.7028.7971.4826.434716 ± 379.944634 ± 358.8398.66
Pusa 1979-14-7-33-99-101105.5125.1013.8027.5886.6427.325799 ± 368.335866 ± 231.1398.66
Pusa 1979-14-7-33-99-143106.0134.35*15.5028.5684.8028.305832 ± 586.795559 ± 265.9698.66
Pusa 1979-14-7-33-99-166107.0133.4717.3027.7389.1128.546910 ± 426.377017 ± 522.4199.11
Pusa 1979-14-7-33-99-182107.5124.8516.9027.3387.1127.926502 ± 346.166506 ± 316.1798.66
Pusa 1979-14-7-33-99-226106.0126.0016.8027.4888.1427.906599 ± 368.686547 ± 282.8999.11
PB 1121a106.0125.5816.0629.8186.1028.926250 ± 369.38
CD (0.05)2.907.392.761.315.351.29868.26828.96

Data on DFF, PH, NPT, PL, SF%, TGW presented is from Imazethapyr sprayed plots while the yield data (YLD) is presented for both unsprayed and herbicide sprayed plots. *Significant at 5%; DFF days to 50% flowering, PH Plant height in cm, NPT Number of productive tillers, PL Panicle length in cm, SF Spikelet fertility percentage, TGW Thousand grain weight in grams (g), YLD Plot yield in kg/ha, USP Unsprayed condition, SP herbicide (Imazethapyr) Sprayed condition, RPG Recurrent Parent Genome, CD Critical difference. aData on DFF, PH, NPT, PL, SF%, TGW for PB 1121 is from unsprayed plots for comparison, as PB 1121 did not survive under Imazethapyr spray

Fig. 7

Field view of the PB 1121 HT-NILs at (a) booting and (b) maturity

Fig. 8

Comparison of yield (kg/ha) between PB 1121 HT-NILs and their parents in unsprayed and herbicide sprayed condition; #PB 1121 seedling did not survive Imazethapyr spray; *Significantly superior to the recurrent parent, PB 1121

Agronomic performance of PB 1121 HT-NILs in comparison with the recurrent parent PB 1121 Data on DFF, PH, NPT, PL, SF%, TGW presented is from Imazethapyr sprayed plots while the yield data (YLD) is presented for both unsprayed and herbicide sprayed plots. *Significant at 5%; DFF days to 50% flowering, PH Plant height in cm, NPT Number of productive tillers, PL Panicle length in cm, SF Spikelet fertility percentage, TGW Thousand grain weight in grams (g), YLD Plot yield in kg/ha, USP Unsprayed condition, SP herbicide (Imazethapyr) Sprayed condition, RPG Recurrent Parent Genome, CD Critical difference. aData on DFF, PH, NPT, PL, SF%, TGW for PB 1121 is from unsprayed plots for comparison, as PB 1121 did not survive under Imazethapyr spray Field view of the PB 1121 HT-NILs at (a) booting and (b) maturity Comparison of yield (kg/ha) between PB 1121 HT-NILs and their parents in unsprayed and herbicide sprayed condition; #PB 1121 seedling did not survive Imazethapyr spray; *Significantly superior to the recurrent parent, PB 1121 The mean performance of grain and cooking quality traits of the PB 1121 HT-NILs evaluated under sprayed condition is presented in Table 6. All the NILs possessed extra-long slender grain type with a very strong aroma, and ASV of 7.0, which was similar to that of PB 1121. HUL%l, MIL%, HRR%, KLBC, KBBC, and KBAC were comparable to PB 1121. Three NILs namely, Pusa 1979-14-7-33-99-15, Pusa 1979-14-7-33-99-10 and Pusa 1979-14-7-33-99-143 were found significantly superior for KLAC and elongation ratio as compared to PB 1121 (Table 6 & Fig. 9).
Table 6

Grain quality traits of PB 1121 HT-NILs in comparison to PB 1121

GenotypeHULMILHRRKLBCKBBCKLACKBACE/RASVAROMA
Pusa 1979-14-7-33-99-877.7767.4655.968.771.6118.542.282.1173
Pusa 1979-14-7-33-99-1079.7770.4058.408.561.6919.66*2.362.29*73
Pusa 1979-14-7-33- 99-1578.9268.3354.838.711.6819.69*2.292.26*73
Pusa 1979-14-7-33-99-3476.7066.7355.138.831.6719.352.322.1873
Pusa1979-14-7-33-99-5678.6667.9053.808.811.6419.102.312.1673
Pusa 1979-14-7-33-99-6678.2368.3356.058.721.6318.972.48*2.1873
Pusa 1979-14-7-33-99-8777.5069.2355.368.621.6918.462.312.1473
Pusa 1979-14-7-33-99-10181.1270.2557.158.821.6719.322.332.1973
Pusa 1979-14-7-33-99-14378.6069.6556.678.971.7420.29*2.322.26*73
Pusa 1979-14-7-33-99-16677.0767.8954.098.751.6718.882.312.1673
Pusa 1979-14-7-33-99-18277.7666.6454.958.731.6419.322.312.2173
Pusa 1979-14-7-33-99-22677.4567.6355.428.681.6919.042.352.1973
PB 1121a78.1569.7055.808.761.6818.822.302.1573
CD (0.05)3.413.993.270.310.090.780.080.08

*Significant at 5%; HUL hulling recovery in percentage, MIL milling recovery in percentage, HRR head rice recovery in percentage, KLBC kernel length before cooking in mm, KBBC kernel breadth before cooking in mm, KLAC kernel length after cooking in mm, KBAC kernel breadth after cooking in mm, E/R kernel elongation ratio, ASV alkali spreading value, AROMA aroma score from panel test; aPB 1121 showed complete mortality after herbicide spray, the data of PB 1121 taken from the unsprayed area is presented for the purpose of comparison

Fig. 9

Grain and cooking quality of selected PB 1121 HT-NILs and their parents, PB 1121 and Robin

Grain quality traits of PB 1121 HT-NILs in comparison to PB 1121 *Significant at 5%; HUL hulling recovery in percentage, MIL milling recovery in percentage, HRR head rice recovery in percentage, KLBC kernel length before cooking in mm, KBBC kernel breadth before cooking in mm, KLAC kernel length after cooking in mm, KBAC kernel breadth after cooking in mm, E/R kernel elongation ratio, ASV alkali spreading value, AROMA aroma score from panel test; aPB 1121 showed complete mortality after herbicide spray, the data of PB 1121 taken from the unsprayed area is presented for the purpose of comparison Grain and cooking quality of selected PB 1121 HT-NILs and their parents, PB 1121 and Robin Based on molecular analysis of badh2 locus, all the HT-NILs were confirmed to have badh2 allele with 8 bp deletion which is identical to PB 1121 (Fig. 10). In sensory evaluation, the HT-NILs were found to be strongly scented with an aroma score of 3.
Fig. 10

A representative image showing the amplification profile of the marker, “nksbad2” based on 8 bp deletion in badh2 in the PB 1121 HT-NILs along with recurrent parent (RP), PB 1121 and the non-aromatic donor parent (DP) Robin. M: 50 base pair DNA ladder, RP: PB 1121, DP: Robin, 1–12: PB 1121 HT-NILs, Pusa 1979-14-7-33-99-8, Pusa 1979-14-7-33-99-10, Pusa 1979-14-7-33- 99-15, Pusa 1979-14-7-33-99-34, Pusa 1979-14-7-33-99-56, Pusa 1979-14-7-33-99-66, Pusa 1979-14-7-33-99-87, Pusa 1979-14-7-33-99-101, Pusa 1979-14-7-33-99-143, Pusa 1979-14-7-33-99-166, Pusa 1979-14-7-33-99-182 and Pusa 1979-14-7-33-99-226

A representative image showing the amplification profile of the marker, “nksbad2” based on 8 bp deletion in badh2 in the PB 1121 HT-NILs along with recurrent parent (RP), PB 1121 and the non-aromatic donor parent (DP) Robin. M: 50 base pair DNA ladder, RP: PB 1121, DP: Robin, 1–12: PB 1121 HT-NILs, Pusa 1979-14-7-33-99-8, Pusa 1979-14-7-33-99-10, Pusa 1979-14-7-33- 99-15, Pusa 1979-14-7-33-99-34, Pusa 1979-14-7-33-99-56, Pusa 1979-14-7-33-99-66, Pusa 1979-14-7-33-99-87, Pusa 1979-14-7-33-99-101, Pusa 1979-14-7-33-99-143, Pusa 1979-14-7-33-99-166, Pusa 1979-14-7-33-99-182 and Pusa 1979-14-7-33-99-226

Discussion

Basmati rice of India attracts consumers worldwide due to its peerless grain and cooking quality characteristics and appealing aroma. Among the Basmati rice varieties developed in India, PB 1121 is considered as the hallmark of Basmati, owing to its exceptional KLAC (20 to 25 mm) and high volume expansion upon cooking (> 4 times) (Singh et al. 2018b). Basmati rice is protected under Geographical Indications (GI) for cultivation in seven states of north-western India where rice is primarily cultivated under transplanted conditions. However, due to the limited availability of labor on time, high transplanting cost and depleting water table, there is a need to shift rice cultivation to DSR. Although DSR is a potential technology, the response of farmers for its adoption has been lukewarm owing to heavy weed infestation under DSR. Herbicide tolerant rice varieties provide a potential alternative for effective weed management under DSR. MABB has several advantages over conventional breeding and has been successfully deployed for improving elite rice varieties for resistance to biotic stresses such as bacterial blight and blast (Joseph et al. 2004; Gopalakrishnan et al. 2008; Singh et al. 2012a, 2012b; Singh et al. 2013; Khanna et al. 2015; Ellur et al. 2016a, 2016b), and abiotic stresses such as salinity tolerance (Babu et al. 2017; Singh et al. 2018a) which it has brought a paradigm shift in Basmati rice breeding (Singh et al. 2011). In this study, we report the transfer of herbicide tolerance trait from Robin into the genetic background of PB 1121 through MABB. Robin is an EMS induced mutant of an upland drought tolerant rice variety N22, which possess tall plant stature, short grains and lacks aroma (Shoba et al. 2017). Using poor grain quality DP to transfer HT trait into the genetic background of high quality Basmati rice variety PB 1121, is a challenging task especially for the recovery of exquisite grain and cooking quality of this Basmati rice variety in the improved HT-NILs. Foreground selection together with background and phenotypic selection led to precise transfer of mutant AHAS allele for herbicide tolerance as well as accelerated the RPG recovery to an extent of 98.66 to 99.55% with four backcross generations. The complete recovery of RPG in mutant AHAS gene carrier chromosome as well as rest of chromosome was achieved except chromosomes 8 and 11, which retained some residual donor fragment (Fig. 3). Using the SSR markers for background analysis generally target the non-coding and heterochromatic regions and hence could not quantify the recovery of functional part of the genome. Therefore, background selection was coupled with phenotypic selection for RPP which helped in speeding the process of reconstruction of RPP as it entails the indirect selection for functionally expressed part of the genome (Ellur et al. 2016a). PB 1121 HT-NILs were at par with PB 1121 for agro-morphological, grain and cooking quality traits, while exhibiting herbicide tolerance similar to Robin. This was possible due to stringent phenotypic selection for agro-morphological traits, grain and cooking quality traits for RP PB 1121 phenotype carried out in each of the backcross generations. The significance of phenotypic selection with background selection in the development of NILs with maximum RPG and RPP recovery has also been earlier demonstrated (Ellur et al. 2016b; Babu et al. 2017). Three NILs, Pusa 1979-14-7-33-99-15, Pusa 1979-14-7-33-99-10 and Pusa 1979-14-7-33-99-66 were significantly superior in yield, grain and cooking quality as compared to PB 1121 indicating the effectiveness of augmenting rigorous phenotypic selection for the cooking quality traits along with background selection. Pleasant aroma is an essential trait of Basmati rice, which is primarily governed by a recessive gene badh2 located on chromosome 8. The accumulation of 2-acetyl-1-pyrroline (2-AP) in aromatic rice is explained by the loss of function mutations in the badh2 gene (Bradbury et al. 2005; Chen et al. 2008). All the PB 1121 HT-NILs and the recurrent parent PB 1121 were found to carry an 8 bp deletion corresponding to the aromatic allele for the production of 2-AP (Fig. 10). AHAS is an enzyme which catalyzes two reactions for the synthesis of branched chain amino acids namely, valine, leucine, and isoleucine (Singh and Shaner 1995). Condensation of two pyruvate molecules forms 2-acetolactate which leads to the formation of valine and leucine. While for isoleucine biosynthesis, 2-acetohydroxybutyrate is synthesized from pyruvate and 2-ketobutyrate (Zhou et al. 2007). AHAS-inhibiting herbicides block the substrate access channel in the AHAS enzyme by binding to it and elicit deficiency of branched-chain amino acids (Garcia et al. 2017). The resulting decrease of protein synthesis slows down cell division thus leading to growth difficulties in plants (Yu and Powles 2014). However, the mutations within the AHAS gene results in altered AHAS enzyme which confers resistance to the AHAS inhibiting herbicides (Tranel and Wright 2002; Duggleby and Pang 2000; Christoffers et al. 2006). All the PB 1121 HT-NILs carrying mutated AHAS allele displayed tolerance to Imazethapyr herbicide when applied @ 2.5 ml/liter with no significant difference in the yield performance, grain and cooking quality traits when compared to HT-NILs under unsprayed conditions. This indicates the effectiveness of mutant AHAS gene to overcome the adverse effect of herbicide Imazethapyr. In all, the present study reports successful development of HT NILs in the genetic background of popular Basmati rice variety PB 1121 by introgression of mutated AHAS allele using MABB program. The PB 1121 HT-NILs are being evaluated in the National Basmati Trials for their subsequent release as commercial varieties. These NILs will help the farmers in adopting DSR in Basmati rice production which would help in economizing the rice production. Additional file 1: Figure S1. Agarose gel image (a-e) of all 112 SSR markers polymorphic between RP PB 1121 and DP Robin. M: 50 base pair DNA ladder; P1: PB 1121; P2: Robin. Additional file 2: Figure S2. Chromosome wise Graphical representation of all 112 SSR markers polymorphic between RP PB 1121 and DP Robin. Additional file 3: Figure S3. Gel image showing the amplification profile of AHAS linked SSR marker RM6844 in the F1 plants. M: 50 base pair DNA ladder; DP: Robin; RP: PB 1121; 1–15: F1 plants. Additional file 4: Figure S4. A representative gel amplification image of the SSR marker, RM6844 used in foreground selection in the BC4F2 population. M: 50 base pair DNA ladder; RP: PB 1121; DP: Robin; 1–68: BC4F2 plants. Additional file 5: Table S1. Details of 112 polymorphic SSR markers used in Background selection for development of PB 1121 HT-NILs.
  17 in total

1.  Biosynthesis of Branched Chain Amino Acids: From Test Tube to Field.

Authors:  B. K. Singh; D. L. Shaner
Journal:  Plant Cell       Date:  1995-07       Impact factor: 11.277

Review 2.  Resistance to AHAS inhibitor herbicides: current understanding.

Authors:  Qin Yu; Stephen B Powles
Journal:  Pest Manag Sci       Date:  2014-01-20       Impact factor: 4.845

3.  Comprehensive understanding of acetohydroxyacid synthase inhibition by different herbicide families.

Authors:  Mario D Garcia; Amanda Nouwens; Thierry G Lonhienne; Luke W Guddat
Journal:  Proc Natl Acad Sci U S A       Date:  2017-01-30       Impact factor: 11.205

Review 4.  Imidazolinone-tolerant crops: history, current status and future.

Authors:  Siyuan Tan; Richard R Evans; Mark L Dahmer; Bijay K Singh; Dale L Shaner
Journal:  Pest Manag Sci       Date:  2005-03       Impact factor: 4.845

Review 5.  Herbicidal inhibitors of amino acid biosynthesis and herbicide-tolerant crops.

Authors:  S Tan; R Evans; B Singh
Journal:  Amino Acids       Date:  2006-03-20       Impact factor: 3.520

6.  Badh2, encoding betaine aldehyde dehydrogenase, inhibits the biosynthesis of 2-acetyl-1-pyrroline, a major component in rice fragrance.

Authors:  Saihua Chen; Yi Yang; Weiwei Shi; Qing Ji; Fei He; Ziding Zhang; Zhukuan Cheng; Xiangnong Liu; Mingliang Xu
Journal:  Plant Cell       Date:  2008-07-03       Impact factor: 11.277

7.  Development and Genetic Characterization of A Novel Herbicide (Imazethapyr) Tolerant Mutant in Rice (Oryza sativa L.).

Authors:  D Shoba; M Raveendran; S Manonmani; S Utharasu; D Dhivyapriya; G Subhasini; S Ramchandar; R Valarmathi; Nitasha Grover; S Gopala Krishnan; A K Singh; Pawan Jayaswal; Prashant Kale; M K Ramkumar; S V Amitha Mithra; T Mohapatra; Kuldeep Singh; N K Singh; N Sarla; M S Sheshshayee; M K Kar; S Robin; R P Sharma
Journal:  Rice (N Y)       Date:  2017-04-04       Impact factor: 4.783

8.  Marker Aided Incorporation of Saltol, a Major QTL Associated with Seedling Stage Salt Tolerance, into Oryza sativa 'Pusa Basmati 1121'.

Authors:  N Naresh Babu; S Gopala Krishnan; K K Vinod; S L Krishnamurthy; Vivek K Singh; Madan P Singh; Renu Singh; Ranjith K Ellur; Vandna Rai; Haritha Bollinedi; Prolay K Bhowmick; Ashutosh K Yadav; Mariappan Nagarajan; Nagendra K Singh; Kumble V Prabhu; Ashok K Singh
Journal:  Front Plant Sci       Date:  2017-01-26       Impact factor: 5.753

Review 9.  Pusa Basmati 1121 - a rice variety with exceptional kernel elongation and volume expansion after cooking.

Authors:  Vijaipal Singh; Ashok Kumar Singh; Trilochan Mohapatra; Gopala Krishnan S; Ranjith Kumar Ellur
Journal:  Rice (N Y)       Date:  2018-04-09       Impact factor: 4.783

10.  Molecular breeding for the development of multiple disease resistance in Basmati rice.

Authors:  Atul Singh; Vikas K Singh; S P Singh; R T P Pandian; Ranjith K Ellur; Devinder Singh; Prolay K Bhowmick; S Gopala Krishnan; M Nagarajan; K K Vinod; U D Singh; K V Prabhu; T R Sharma; T Mohapatra; A K Singh
Journal:  AoB Plants       Date:  2012-11-02       Impact factor: 3.276

View more
  4 in total

1.  OsVIT2 Mutation Increases Fe and Zn of Grain Without Compromising the Growth in Paddy Field.

Authors:  Prashant Kandwal; Toru Fujiwara; Takehiro Kamiya
Journal:  Front Plant Sci       Date:  2022-06-22       Impact factor: 6.627

Review 2.  Introgression Lines: Valuable Resources for Functional Genomics Research and Breeding in Rice (Oryza sativa L.).

Authors:  Bo Zhang; Ling Ma; Bi Wu; Yongzhong Xing; Xianjin Qiu
Journal:  Front Plant Sci       Date:  2022-04-26       Impact factor: 6.627

3.  Marker-assisted transfer of leaf and stripe rust resistance from Triticum turgidum var. durum cv. Trinakria to wheat variety HD2932.

Authors:  Niharika Mallick; Shailendra K Jha; Priyanka Agarwal; Sachin Kumar; Anchal Mall; Niranjana M; Manish K Choudhary; Ajay Kumar Chandra; Shreshtha Bansal; M S Saharan; J B Sharma
Journal:  Front Genet       Date:  2022-08-11       Impact factor: 4.772

4.  Molecular Breeding for Improving Productivity of Oryza sativa L. cv. Pusa 44 under Reproductive Stage Drought Stress through Introgression of a Major QTL, qDTY12.1.

Authors:  Kyaw Swar Oo; Subbaiyan Gopala Krishnan; Kunnummal Kurungara Vinod; Gaurav Dhawan; Priyanka Dwivedi; Pankaj Kumar; Prolay Kumar Bhowmick; Madan Pal; Viswanathan Chinnuswamy; Mariappan Nagarajan; Haritha Bollinedi; Ranjith Kumar Ellur; Ashok Kumar Singh
Journal:  Genes (Basel)       Date:  2021-06-24       Impact factor: 4.096

  4 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.