Microsatellite loci for an old rare species, Pseudotaxus chienii, and transferability in Taxus wallichiana var. mairei (Taxaceae).

PREMISE OF THE STUDY: Microsatellite loci were developed for Pseudotaxus chienii, an old rare species endemic to China, and which provided a useful tool for investigating the patterns of population genetic structure, phylogeography, evolutionary history, and adaptive potential. Transferability was assayed in the related species, Taxus wallichiana var. mairei. • METHODS AND
RESULTS: A total of 15 microsatellite loci were targeted in P. chienii using the Fast Isolation by AFLP of Sequences COntaining Repeats (FIASCO) protocol. Polymorphism was evaluated in five populations of P. chienii and five populations of T. wallichiana var. mairei. Of these loci, 13 were polymorphic in P. chienii, whereas 15 were polymorphic in T. wallichiana var. mairei. •
CONCLUSIONS: The 15 microsatellite loci developed lay a solid foundation for further studies on population genetic variability and investigations of local adaptation. Additionally, cross-species amplification in T. wallichiana var. mairei showed that these loci may also have potential utility in other genera of Taxaceae.

Pseudotaxus chienii (W. C. Cheng) W. C. Cheng belongs to Pseudotaxus W. C. Cheng (Taxaceae), which is a monotypic genus endemic to China (Fu et al., 1999). The species (white-berry yew) has a restricted distribution in northern Guangdong, northern Guangxi, Hunan, southwestern Jiangxi, and southern Zhejiang provinces (Fu et al., 1999). It should be regarded as an “old rare species,” which is well adapted to habitat isolation and ecological heterogeneity in a wide range of climatic and soil conditions (Wang et al., 2006; Su et al., 2009). As an evergreen shrub or small tree that grows up to 4 m tall, P. chienii is closely related to the sister genus Taxus L. Morphological differences include the white stomatal bands and arils (Fu et al., 1999). In addition, its dioecy with low fertilization rates and fruit production lead to poor natural regeneration (Fu et al., 1999). Environmental factors and human-induced disturbances, such as climate change, habitat destruction, and overexploitation, have been causing population size to continuously decrease in P. chienii over the past decades (Fu and Jin, 1992; Yang et al., 2005). As early as 1992, P. chienii was categorized as an endangered species in the Red List of Endangered Plants in China (Fu and Jin, 1992). Although we have known that P. chienii is able to maintain high variation in isolated populations from previous studies using random-amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) markers (Wang et al., 2006; Su et al., 2009), its evolutionary history, phylogeography, and adaptive potential remain unresolved. Codominant microsatellite markers are urgently needed to further survey the pattern of population genetic structure and local adaptation processes in P. chienii. In this study, 15 microsatellite loci of P. chienii were developed and applied to assess their transferability in the closely related T. wallichiana Zucc. var. mairei (Lemée & H. Lév.) L. K. Fu & Nan Li.

METHODS AND RESULTS

Microsatellite loci were targeted in P. chienii following the Fast Isolation by AFLP of Sequences COntaining Repeats (FIASCO) protocol (Zane et al., 2002). Genomic DNA was prepared from the silica gel–dried leaves of one individual from Bijiashan population according to a modified cetyltrimethylammonium bromide (CTAB) method (Doyle and Doyle, 1987). Approximately 500 ng of genomic DNA was completely digested with the restriction enzyme MseI (New England Biolabs, Ipswich, Massachusetts, USA), and then ligated to an MseI adapter pair (5′-TACTCAGGACTCAT-3′/5′-GACGATGAGTCCTGAG-3′) using T4 DNA ligase (New England Biolabs). The ligation was diluted by 10× and amplified using the adapter-specific primer MseI-N (5′-GATGAGTCCTGAGTAAN-3′) with the following PCR program: 24 cycles of 94°C for 30 s, 53°C for 60 s, and 72°C for 60 s. A 20-μL reaction volume consisted of 5 μL of diluted product, 1× PCR buffer (Mg2+ free), 1.5 mM MgCl2, 0.2 mM dNTPs, 0.5 μM primer, and 1 U Taq DNA polymerase (TaKaRa Biotechnology Co., Dalian, Liaoning, China). The amplified product was denatured at 95°C for 3 min and hybridized with a 5′-biotinylated (AC)10 probe at room temperature for 15 min. The probe-bound fragments were captured by streptavidin-coated magnetic beads (Promega Corporation, Madison, Wisconsin, USA) to enrich the fragments containing microsatellite repeats. The enriched fragments were reamplified with the primer MseI-N using the PCR conditions described above. The recovered products were purified with E.Z.N.A. Cycle-Pure Kit (Omega Bio-Tek, Norcross, Georgia, USA), then ligated to a pMD-18T vector (TaKaRa Biotechnology Co.), and transformed into DH5α competent cells. Positive clones were tested by PCR with universal M13 primers. A total of 154 positive clones were randomly selected and sequenced on an ABI PRISM 3730 automated DNA sequencer (Applied Biosystems, Foster City, California, USA). Ninety-nine sequences contained simple sequence repeats. Of these, 60 sequences were discarded due to short flanking regions or unsuitability for primer design. The remaining 39 sequences with sufficient flanking regions were used to design primers using Primer Premier 5.0 software (PREMIER Biosoft International, Palo Alto, California, USA). The primers were commercially synthesized by BGI (Beijing Genomics Institute, Shenzhen, Guangdong, China), and the annealing temperature was optimized by a gradient PCR. The 20-μL PCR reaction volume contained 20 ng of genomic DNA, 1× PCR buffer (Mg2+ free), 1.5 mM MgCl2, 0.2 mM dNTPs, 0.25 μM of each primer, and 1 U Taq DNA polymerase (TaKaRa Biotechnology Co.). The final PCR program was carried out as follows: initial denaturation at 94°C for 5 min; 40 cycles of 94°C for 45 s, 47–57°C for 45 s, 72°C for 45 s; and a final extension at 72°C for 10 min (Table 1). Amplified products were separated on 6% denaturing polyacrylamide gels and visualized by silver staining. Sizes of fragments were determined by a 50-bp DNA ladder (TaKaRa Biotechnology Co.). Approximately 38% (15 of 39) successfully amplified PCR products.

Table 1.

Characterization of 15 microsatellite loci developed in Pseudotaxus chienii.

Locus	Primer sequences (5′–3′)	Repeat motif	Ta (°C)	Size (bp)	GenBank accession no.
PTC01	F: ACAGTTCCTGACAGTCGTTAGA	(CA)7	56	139	JX512258
	R: TACACCATTGAGGGTATTTGA
PTC02	F: GGGGAAAATGTAGACACCAA	(AC)14	54	270	JX512259
	R: CAACAATCCTTTAGCCAGAGT
PTC03	F: TAGATTGTAGCCTTGGTGTAG	(TG)18	50	193	JX512260
	R: TCATTATGTTTTGATGGGTT
PTC04	F: ATAGTCCCTTTGGGCACAT	(CA)10	55	176	JX512261
	R: TCATCCTTGAGGTCCTTTCT
PTC05	F: GTCAAGAGCACAAAAGTGAACAT	(AC)16	57	104	JX512262
	R: AGGAGGAGGAAAGTAAAATCG
PTC06	F: ATAGAACTCATTTTGAAGCCATA	(AC)4AT(AC)15ATAG(AT)5	54	251	JX512263
	R: CAAGGTTTTGTGACCATTTTA
PTC07	F: TCCTACACATTGTTTCCTGG	(AC)7	54	165	JX512264
	R: CACTCTACCTTTTTTAGTTTCTGA
PTC08	F: TGACTATGTGATTGAAAGAGAA	(AC)15	54	151	JX512265
	R: GACCCCAACTGTTACGAA
PTC09	F: CAGAAGCAAAGAAATGTATG	(CA)8	47	108	JX512266
	R: TGTGAAAGAATCAATGAGAAA
PTC10	F: CACGGACTCCCAAACAT	(GT)16A(TG)15	54	119	JX512267
	R: CGCTTGCGAGATAGATAAT
PTC11	F: ACATTAGTTCCCATCGCA	(TG)7	51	110	JX512268
	R: GTGGTAGTATGAATAAGACAAGG
PTC12	F: TGCTATCAGTGTTGGAGGG	(TG)7	52	241	JX512269
	R: CCATCGCATCATCGCC
PTC13	F: AAATGCTTAGTATGTCGGC	(TG)15	50	130	JX512270
	R: ATAAATCTACAAAGAGTAAACCA
PTC14	F: CCTGGGTGGAAATCATAAAGT	(GT)11	53	147	JX512271
	R: TAAGAAAAGGGTCCCGAAGT
PTC15	F: GACATTTCTACTTTGCTGGAT	(AC)8	51	129	JX512272
	R: ACTGATGCTTGTTATTGGTTTA

Note: Ta = annealing temperature.

Voucher: Q Fan 201107, BJS7, SYSU. See Appendix 1 for location information.

Appendix 1.

Information on GPS coordinates of each population for Pseudotaxus chienii and Taxus wallichiana var. mairei. Representative voucher specimens were deposited at the herbarium of Sun Yat-sen University (SYSU).

Species	Population	GPS coordinates	Voucher specimens
Pseudotaxus chienii	Dayuanwei, Zhejiang Province	28°43′N, 118°57′E	Y Jiang 200308, DYW4
	Damingshan, Guangxi Zhuang Autonomous Region	22°42′N, 107°46′E	Y Jiang 200308, DMS2
	Tianzishan, Hunan Province	29°22′N, 110°30′E	Y Jiang 200308, TZS4
	Sanqingshan, Jiangxi Province	28°54′N, 118°04′E	WB Liao 200808, SQS3
	Bijiashan, Jiangxi Province	26°30′N, 114°09′E	Q Fan 201107, BJS7
Taxus wallichiana var. mairei	Longqishan, Fujian Province	26°31′N, 117°16′E	ZY Li 200608, LQS174
	Fenshui, Jiangxi Province	28°56′N, 118°02′E	WB Liao 200808, FS1
	Lianzhou, Guangdong Province	24°59′N, 112°14′E	WB Liao 201108, LZ1
	Jinyunshan, Chongqing Municipality	29°50′N, 106°22′E	WB Liao 200808, JYS1
	Tuankou, Zhejiang Province	30°00′N, 119°03′E	ZY Li 200608, TK198

The 15 microsatellite loci were measured in 50 individuals of P. chienii from five natural populations (10 samples per population), including Dayuanwei from Zhejiang Province, Damingshan from Guangxi Zhuang Autonomous Region, Tianzishan from Hunan Province, and Sanqingshan and Bijiashan from Jiangxi Province (Fig. 1 ; Appendix 1). Voucher specimens were deposited at the herbarium of Sun Yat-sen University (Appendix 1). Genetic parameters, null alleles, and linkage disequilibrium (LD) were calculated using GenAlEx version 6.41, MICRO-CHECKER version 2.2.3, and GENEPOP version 4.1.3, respectively (Van Oosterhout et al., 2004; Peakall and Smouse, 2006; Rousset, 2008). Of the 15 loci, 13 were polymorphic (all but PTC14 and PTC15; Table 1). The actual number of alleles (A) per polymorphic locus ranged from one to seven, the effective number of alleles (Ae) ranged from 1.000 to 6.061, observed heterozygosity (Ho) per locus varied from 0.000 to 1.000, and expected heterozygosity (He) varied from 0.000 to 0.835 (Table 2). PTC11 significantly deviated from Hardy–Weinberg equilibrium (HWE) in the Dayuanwei, Sanqingshan, and Bijiashan populations. Null alleles were only detected at one locus (PTC04) in the Dayuanwei, Damingshan, and Bijiashan populations. No loci pairs demonstrated significant LD.

Fig. 1.

The population locations of Pseudotaxus chienii (solid triangle) and Taxus wallichiana var. mairei (solid dots). BJS = Bijiashan; DMS = Damingshan; DYW = Dayuanwei; FS = Fenshui; JYS = Jinyunshan; LQS = Longqishan; LZ = Lianzhou; SQS = Sanqingshan; TK = Tuankou; TZS = Tianzishan.

Table 2.

Genetic analysis and results of polymorphism in Pseudotaxus chienii.

	Zhejiang Province, Dayuanwei (N = 10)				Guangxi Zhuang Autonomous Region, Damingshan (N = 10)				Hunan Province, Tianzishan (N = 10)				Jiangxi Province
													Sanqingshan (N = 10)				Bijiashan (N = 10)				Total (N = 50)
Locusa	A	Ae	Ho	He	A	Ae	Ho	He	A	Ae	Ho	He	A	Ae	Ho	He	A	Ae	Ho	He	A	Ae	Ho	He
PTC01	2	1.471	0.400	0.320	2	1.923	0.800	0.480	2	1.471	0.400	0.320	2	1.980	0.900	0.495	2	1.923	0.800	0.480	2	1.873	0.660	0.466
PTC02	3	2.740	0.900	0.635	3	2.740	0.900	0.635	3	2.532	1.000	0.605	3	2.597	0.900	0.615	3	2.410	0.600	0.585	3	2.675	0.860	0.626
PTC03	3	2.899	0.900	0.655	4	2.564	0.700	0.610	3	2.667	1.000	0.625	3	2.597	1.000	0.615	3	2.381	1.000	0.580	4	2.919	0.920	0.657
PTC04	3	2.632	0.200	0.620	5	4.167	0.200	0.760	3	2.299	0.700	0.565	5	4.167	0.500	0.760	3	2.632	0.200	0.620	5	3.915	0.360	0.745
PTC05	4	2.740	0.900	0.635	3	2.899	0.500	0.655	2	1.923	0.600	0.480	4	3.226	0.700	0.690	2	2.000	1.000	0.500	4	2.664	0.740	0.625
PTC06	2	1.105	0.100	0.095	5	1.942	0.600	0.485	4	2.469	0.900	0.595	2	1.220	0.200	0.180	2	1.105	0.100	0.095	6	1.498	0.380	0.332
PTC07	7	6.061	0.900	0.835	5	3.774	0.900	0.735	3	2.020	0.700	0.505	4	3.175	0.900	0.685	2	1.835	0.700	0.455	7	4.429	0.820	0.774
PTC08	3	2.174	0.800	0.540	3	2.062	0.800	0.515	3	1.852	0.600	0.460	3	2.020	0.700	0.505	3	2.632	1.000	0.620	3	2.211	0.780	0.548
PTC09	2	1.342	0.300	0.255	2	1.835	0.700	0.455	1	1.000	0.000	0.000	1	1.000	0.000	0.000	3	1.361	0.200	0.265	3	1.827	0.240	0.453
PTC10	2	1.923	0.800	0.480	6	2.198	0.600	0.545	2	1.105	0.100	0.095	5	2.174	0.700	0.540	2	1.342	0.300	0.255	6	1.719	0.500	0.418
PTC11	2	2.000	1.000	0.500*	2	1.600	0.500	0.375	2	1.835	0.700	0.455	5	2.985	1.000	0.665*	2	2.000	1.000	0.500*	6	4.600	0.840	0.783
PTC12	3	2.198	1.000	0.545	2	1.724	0.600	0.420	3	2.740	1.000	0.635	3	2.062	0.800	0.515	3	2.532	1.000	0.605	4	3.501	0.880	0.714
PTC13	3	1.942	0.700	0.485	3	2.198	0.800	0.545	3	2.062	0.800	0.515	3	1.504	0.400	0.335	2	1.980	0.900	0.495	3	2.036	0.720	0.509
Mean	3.000	2.402	0.685	0.508	3.462	2.433	0.662	0.555	2.615	1.998	0.654	0.450	3.308	2.362	0.669	0.508	2.462	2.010	0.677	0.466	4.308	2.759	0.669	0.588

Note: A = actual number of alleles; Ae = effective number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; N = sample size.

PTC14 and PTC15 are not included because they are monomorphic.

*Deviation from Hardy–Weinberg equilibrium (P < 0.05).

Fifty individuals of T. wallichiana var. mairei from Longqishan (Fujian), Fenshui (Jiangxi), Lianzhou (Guangdong), Jinyunshan (Chongqing), and Tuankou (Zhejiang) were used to assess cross-species amplification of the 15 microsatellite loci (Fig. 1; Appendix 1). All 15 loci were polymorphic (Table 1). A ranged from one to nine and Ae varied between 1.000 and 4.481. Ho and He were 0.000–1.000 and 0.000–0.777, respectively (Table 3). No null alleles or significant LD were detected. Moreover, PTC14 was found to significantly deviate from HWE in the Longqishan, Lianzhou, and Tuankou populations, respectively.

Table 3.

Genetic analysis and results of transferability in Taxus wallichiana var. mairei.

	Fujian Province, Longqishan (N = 10)				Jiangxi Province, Fenshui (N = 11)				Guangdong Province, Lianzhou (N = 11)				Chongqing Municipality, Jinyunshan (N = 8)				Zhejiang Province, Tuankou (N = 10)				Total (N = 50)
Locus	A	Ae	Ho	He	A	Ae	Ho	He	A	Ae	Ho	He	A	Ae	Ho	He	A	Ae	Ho	He	A	Ae	Ho	He
PTC01	5	2.985	0.800	0.665	6	2.881	0.909	0.653	2	2.000	1.000	0.500	4	2.246	0.750	0.555	4	2.198	0.800	0.545	9	2.618	0.860	0.618
PTC02	3	2.247	0.200	0.555	3	2.305	0.455	0.566	2	1.984	0.182	0.496	4	2.510	0.875	0.602	4	2.778	0.600	0.640	4	3.544	0.440	0.718
PTC03	2	1.835	0.700	0.455	3	2.123	0.364	0.529	2	1.541	0.455	0.351	3	2.169	0.625	0.539	2	1.980	0.500	0.495	3	2.408	0.520	0.585
PTC04	2	1.471	0.400	0.320	4	1.793	0.364	0.442	5	4.033	0.818	0.752	2	1.600	0.500	0.375	2	1.835	0.100	0.455	5	2.860	0.440	0.650
PTC05	3	2.299	0.500	0.565	4	3.270	0.909	0.694	3	2.469	0.909	0.595	4	3.657	0.875	0.727	3	1.681	0.500	0.405	4	3.501	0.740	0.714
PTC06	2	1.835	0.700	0.455	2	1.308	0.273	0.236	1	1.000	0.000	0.000	2	1.969	0.875	0.492	2	1.220	0.200	0.180	3	1.465	0.380	0.317
PTC07	3	2.532	1.000	0.605	3	1.754	0.364	0.430	3	1.766	0.545	0.434	3	2.462	0.250	0.594	3	2.062	0.600	0.515	3	2.130	0.560	0.531
PTC08	3	2.469	0.700	0.595	5	4.481	0.909	0.777	5	3.507	0.727	0.715	4	2.723	0.750	0.633	4	2.857	0.700	0.650	5	4.122	0.760	0.757
PTC09	2	1.471	0.400	0.320	4	2.659	0.909	0.624	4	2.180	0.727	0.541	2	1.438	0.375	0.305	3	1.802	0.600	0.445	4	1.952	0.620	0.488
PTC10	2	1.471	0.400	0.320	4	2.988	0.636	0.665	4	2.547	0.636	0.607	3	1.855	0.625	0.461	3	2.469	0.700	0.595	4	2.473	0.600	0.596
PTC11	2	1.835	0.700	0.455	3	1.716	0.545	0.417	4	2.373	0.636	0.579	4	1.939	0.250	0.484	3	2.532	1.000	0.605	5	3.408	0.640	0.707
PTC12	2	2.000	0.600	0.500	4	2.916	0.727	0.657	4	2.782	1.000	0.640	3	2.133	0.750	0.531	2	1.835	0.700	0.455	6	2.664	0.760	0.625
PTC13	3	2.899	0.300	0.655	4	2.000	0.455	0.500	3	2.469	0.545	0.595	3	1.662	0.500	0.398	3	2.247	0.600	0.555	4	3.388	0.480	0.705
PTC14	2	2.000	1.000	0.500*	2	1.936	0.636	0.483	2	2.000	1.000	0.500*	2	1.969	0.875	0.492	2	2.000	1.000	0.500*	2	1.993	0.900	0.498
PTC15	4	2.740	0.500	0.635	4	3.143	0.091	0.682	2	1.308	0.091	0.236	2	1.969	0.625	0.492	4	3.175	0.700	0.685	4	3.236	0.380	0.691
Mean	2.667	2.139	0.593	0.507	3.667	2.485	0.570	0.557	3.067	2.264	0.618	0.503	3.000	2.154	0.633	0.512	2.933	2.178	0.620	0.515	4.333	2.784	0.605	0.613

Note: A = actual number of alleles; Ae = effective number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; N = sample size.

*Deviation from Hardy–Weinberg equilibrium (P < 0.05).

CONCLUSIONS

The 15 microsatellite loci isolated from P. chienii can provide a useful tool to detect population genetic structure and candidate loci for local adaptation. Additionally, the cross-species amplifications in T. wallichiana var. mairei showed that these loci may also be valuable for population genetic studies of other Taxus species.